COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..1199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..1051 product IS5-like element ISVch5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 sequence02 source 1..1203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 81..1175 product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 sequence03 source 1..1398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 495..941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 sequence04 source 1..2619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(948..>2619) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226013942.1:retention module-containing protein locus_tag LOCUS_00050 sequence05 source 1..4900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(756..1229) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene ybaK CDS complement(1624..1917) product DUF3144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 3760..4158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(4266..4436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 sequence06 source 1..7843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..739) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene folE CDS complement(956..2926) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(3057..3650) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene slmA CDS complement(3675..4133) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073925.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene dut CDS complement(4130..5326) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene coaBC CDS 5455..6132 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene radC CDS 6255..6491 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006079870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene rpmB CDS 6498..6671 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006079871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene rpmG CDS 6973..7740 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 sequence07 source 1..12471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..809) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071732.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 929..2299 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(2409..3392) product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029302595.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 3891..4406 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071734.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 4606..6303 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(6421..8526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 note possible pseudo, frameshifted CDS complement(8481..9539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 note possible pseudo, frameshifted CDS 9796..10260 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(10325..10834) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(10939..11460) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 11806..12144 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene glnB sequence08 source 1..15161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..1181) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene hemE CDS 1795..2277 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 2725..3129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 3407..4639 product iron hydrogenase large subunit HydA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073665.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene hydA CDS 4650..4967 product iron hydrogenase small subunit HydB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene hydB CDS 4978..5643 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 5712..7166 product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene hydG CDS 7163..7774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 7771..8784 product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073670.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene hydE CDS 8777..10009 product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene hydF CDS complement(9969..11132) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(11129..12277) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(12289..13263) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073793.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(13253..14653) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 sequence09 source 1..15418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..3409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(3470..4561) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070705.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(4667..6025) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 6262..6816 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(7155..7931) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 8086..9201 product multidrug efflux MFS transporter EmrD-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850833.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene emrD3 CDS 9712..10002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 9992..11341 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 11359..12363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(12325..12579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(12754..13617) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073931.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 13798..14511 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073930.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene rph CDS 14616..15257 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene pyrE sequence10 source 1..50491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..880) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(1021..1674) product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(1793..2446) product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 2678..3040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 3077..3823 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(3838..5403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038717.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(5501..6226) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(6219..6896) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(6903..7628) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071302.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 8039..8605 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(8663..9952) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(10121..10333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(10468..13113) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene pepN CDS complement(13336..13929) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene lpoB CDS complement(13952..15307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(15304..15792) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene def CDS complement(15814..16026) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071317.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(16030..16911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(17027..17185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 17210..17986 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene fkpA CDS complement(18077..19045) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 19457..19831 product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(19887..20516) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073713.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(20509..22233) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene narQ CDS 22534..23937 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene nrfA CDS complement(24031..24573) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(24648..24839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 24875..25213 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071066.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 25224..26474 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 26765..27136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071064.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 27230..28459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071063.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(28618..29907) product DUF4785 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071846.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(29918..30775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 31300..32355 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene aroG CDS complement(32394..32567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 32884..34689 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 34751..35020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(35034..35246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(35364..36854) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(36864..37370) product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 37507..38085 product DUF5610 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 38199..38948 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 38962..39552 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(39514..39993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 40186..41202 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 41299..42873 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071050.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 42873..43913 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071049.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 44192..45829 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene ggt CDS 45943..46863 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071047.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(46924..47394) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene argR CDS 47680..48615 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene mdh CDS complement(48693..49115) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 49227..50129 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene pssA sequence11 source 1..62594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..1432) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070797.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene purD CDS complement(1567..3156) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene purH CDS 3433..3930 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene zntR CDS 3924..5258 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(5343..5474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(5899..6786) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071335.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 6912..7715 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(8072..8464) product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071338.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(8691..9593) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 9543..9779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 10349..10816 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925817.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 10817..11134 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(11191..11442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 11653..12531 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(12532..13377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 13501..13992 product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(14012..14791) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene ygiD CDS 15203..16378 product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073834.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(16452..16664) product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 16972..17730 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene udp CDS complement(17789..18541) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 18953..19414 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 19437..20363 product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 20360..21316 product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 21737..22267 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(22321..23205) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073920.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene rarD CDS complement(23312..23776) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 23927..25768 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073918.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene recQ CDS complement(25750..27513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 27993..29561 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene leuA CDS 29558..30652 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene leuB CDS 30652..32061 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene leuC CDS 32063..32668 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073913.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene leuD CDS 33176..34540 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 34719..35189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 35215..36720 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073911.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene glpK CDS 36810..37523 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 37664..38542 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 38555..40135 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(40167..40466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 41038..41496 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene mraZ CDS 41526..42467 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene rsmH CDS 42475..42789 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene ftsL CDS 42786..44522 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073906.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 44519..45988 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073905.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene murE CDS 45985..47361 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene murF CDS 47362..48444 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene mraY CDS 48451..49770 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene murD CDS 49760..50977 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene ftsW CDS 50974..52077 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073900.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene murG CDS 52074..53543 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene murC CDS 53640..54404 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 54408..55643 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene ftsA CDS 55679..56851 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene ftsZ CDS 57030..57950 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073895.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene lpxC CDS complement(57959..58411) product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 58440..59339 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073893.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 59398..62121 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene secA sequence12 source 1..81672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..1798) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(2260..2922) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene maiA CDS complement(3085..4074) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(4336..5874) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene tyrR CDS complement(6073..6411) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(6466..7257) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene phhA CDS 7538..8455 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene galU CDS 8452..9465 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene galE CDS 9468..9947 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071814.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene napF CDS 10062..10466 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 10612..11592 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 11874..14138 product OmcA/MtrC family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(14245..14919) product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(14988..15767) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(15964..16866) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene mak CDS complement(16895..17716) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene cysQ CDS complement(17845..19011) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene rfbD CDS complement(19216..19977) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(20233..21456) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073255.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 21684..24068 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(24228..29174) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 29364..29879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 note possible pseudo, frameshifted CDS complement(30218..31261) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(31289..31561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 31445..32026 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(32073..33647) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(33667..33846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 33911..34633 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(34708..35064) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene raiA CDS 35415..35717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 35719..37326 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 37323..37646 product DUF3325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073266.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(37729..39291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 39634..40077 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(40183..43449) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(43585..43899) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 44107..44445 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704429.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 44442..44864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(45070..45540) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071096.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(45680..46432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(46429..47031) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(47127..48740) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 48825..48983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 49420..51207 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene dauA CDS 51439..52524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 52535..53926 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 54025..55191 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 55433..55924 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073383.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene purE CDS 55926..57005 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073384.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene purK CDS 57077..58294 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073385.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 58350..60659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071268.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(60909..61325) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(61337..62200) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene tesB CDS complement(62271..63155) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 63446..64264 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(64376..65914) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene gndA CDS complement(66072..66386) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072008.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene sugE CDS complement(66679..68658) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 68987..69394 product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072005.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 69455..70624 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 70693..72300 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 72312..73166 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072002.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 73180..75237 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925856.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 75240..76130 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 76195..76896 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 76912..77568 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(77728..79389) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene recN CDS complement(79486..80439) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 80663..81565 product LysR family transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene lldR sequence13 source 1..22931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 646..1359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 1356..2684 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459330.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 2681..3175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 3179..3586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 3555..4214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 4198..5394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 5522..6223 product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene ric CDS 6288..6803 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(6773..7357) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073963.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(7478..7948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(8028..8744) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(8744..9640) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene xerC CDS complement(9640..10275) product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(10272..11099) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene dapF CDS complement(11149..12393) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene lysA CDS complement(12394..12555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 12624..12953 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene cyaY CDS complement(12968..15394) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 15594..16523 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene hemC CDS 16536..17264 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 17316..18425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 18422..19591 product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073975.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 sequence14 source 1..206793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(358..1365) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 1544..2215 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 2781..4448 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072087.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene ushA CDS 4717..5166 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(5280..6599) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072696.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 6913..7518 product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(7820..9805) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 10015..11226 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene fabB CDS 11392..12522 product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 12523..13539 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 13783..17007 product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 17140..17925 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene truA CDS 17994..19265 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene folC CDS 19284..19874 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 19983..20471 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072963.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 20515..22029 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene purF CDS 22145..22936 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461763.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(23015..23635) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(23806..25857) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 26292..28457 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073393.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 28517..28933 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(29059..31269) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 31628..33103 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(33210..33614) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(33910..34803) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072765.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 34925..35698 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 35823..36965 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 36962..40144 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 40355..41599 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072761.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 41726..42577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464201.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(42615..43025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072760.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(43416..44333) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(44429..45166) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 45443..47896 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 48104..48346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 48315..48698 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 48926..49615 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(50073..50396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(50504..52741) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(52767..52994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 53273..53776 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158164.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(53998..54891) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072126.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 55024..56148 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 56159..56995 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene fghA CDS 57174..57635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(57657..58322) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(58560..58991) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(59187..60251) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(60493..61305) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072591.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 61430..63799 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene ppsA CDS 63891..66929 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 67003..67452 product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 67901..68323 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(68352..68687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(68864..69898) product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 70199..70633 product DUF4826 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(70885..71790) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(71787..72629) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(72780..73496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(73664..74497) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071980.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 74774..75004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 75553..75699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071981.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 75807..76682 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene speE CDS 76711..78624 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene speA CDS 78677..79606 product S-adenosylmethionine decarboxylase SpeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071983.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 79638..80567 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998707.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene speB CDS 80650..81288 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072804.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene pdxH CDS complement(81347..81562) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764082.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(81878..83017) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072583.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(83141..84511) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene purB CDS complement(84540..85157) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene hflD CDS complement(85161..86276) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072580.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene mnmA CDS complement(86444..86896) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(86889..87719) product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925722.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 88046..90271 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(90371..90577) product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene cspD CDS 90974..91282 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene clpS CDS 91317..93575 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene clpA CDS complement(93767..93985) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene infA CDS complement(94066..94776) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072573.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(94766..95476) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene aat CDS 95530..96009 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(96086..96433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 96665..97417 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(97615..97935) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(97966..98163) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(98178..101768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(101846..102694) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 102900..104699 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 104800..105225 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 106005..108557 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 109798..112350 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(112519..114612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(115199..116941) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene ggt CDS 117034..118215 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(118212..118826) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(118976..120052) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene hppD CDS complement(120088..121248) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 121493..122407 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 122526..123320 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(123498..123818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072062.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(123815..124279) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 124423..124773 product DUF6508 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072064.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 125100..126821 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(126885..127874) product diheme cytochrome c5 peroxidase CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072214.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene ccpA CDS 128218..128985 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 128987..130066 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 130059..130835 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(130901..131308) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 131582..132595 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(132611..132847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(133162..133335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 133850..135421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(135507..136004) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072288.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene ilvN CDS complement(136004..137725) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(138212..139444) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072290.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 139985..141781 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072293.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(141837..142541) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 142821..143804 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 144230..145606 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 145621..147258 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 147497..148321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(148372..149862) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene ppx CDS complement(149882..151981) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene ppk1 CDS 152482..153855 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene yegD CDS 153885..154373 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(154500..154919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 155559..157736 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 157865..158266 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072691.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene ybgC CDS 158289..158945 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene tolQ CDS 158942..159379 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene tolR CDS 159380..160339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 160349..161674 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072687.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene tolB CDS 161696..162238 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene pal CDS 162265..162993 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene ybgF tRNA 163131..163206 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 163233..163308 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 163344..163419 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 163455..163530 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 163568..163643 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 163672..163747 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 163783..163858 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 163887..163962 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 163998..164073 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 164111..164186 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 164215..164290 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 164319..164394 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 164430..164505 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 164525..164600 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 164826..165995 product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(166445..168397) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene acs CDS 168725..172153 product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(172224..173024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 173355..176591 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 177225..178712 product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267071.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 179695..180600 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(180890..181405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(181778..182791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(183176..183619) product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261792.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(183656..184171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(184970..185149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(185623..185970) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene hypA CDS complement(185970..186974) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene hypE CDS complement(186974..188098) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene hypD CDS complement(188085..188333) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072156.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(188333..189202) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene hypB CDS complement(189278..191764) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene hypF CDS complement(191764..193647) product NiFe hydrogenase assembly chaperone HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(193634..194233) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(194241..194912) product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene cybH CDS complement(194925..196628) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene hyaB CDS complement(196632..197768) product nickel-dependent hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072163.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene hyaA CDS 198090..198587 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 198591..198815 product DUF4266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 198806..200155 product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 200183..201145 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 201310..201969 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072168.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 201966..203357 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(203445..205394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 tRNA 205778..205865 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 206487..206577 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence15 source 1..164611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(94..170) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(202..278) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(297..388) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(593..790) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006082602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene csrA CDS complement(907..2145) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(2168..4792) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene alaS CDS complement(5261..5692) product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(5704..6768) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene recA CDS 7086..9644 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073287.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene mutS CDS complement(9848..10777) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925663.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 11073..11984 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071725.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene rdgC CDS complement(12173..13915) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524104.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(14065..14229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 14347..16263 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 16423..17979 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 18015..19370 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene ppnN CDS 19367..20128 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene xni CDS 20171..20587 product DUF3192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 21174..21593 product DUF3192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(21769..24621) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 24877..25884 product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 28165..28791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 28907..29254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(29280..29567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(29692..30945) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 31212..31520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(31628..32710) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene rlmM CDS complement(32996..34567) product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene tet(35) CDS complement(34938..35861) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(35862..36611) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 36931..37326 product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 37585..40689 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 40686..41990 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 42052..42432 product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rcsF CDS 42443..43177 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene tsaA CDS 43237..43827 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 43926..45104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 45205..46923 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(47085..47702) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071703.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene grpE CDS 47797..48675 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071702.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene nadK CDS complement(49340..49540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 49431..50975 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 51056..53860 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 54172..54915 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 54926..56302 product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 56307..56876 product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071697.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(56948..57352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 57772..58278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 58332..58589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 58586..58720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 58701..59051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(59336..60130) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(60132..61577) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(61843..62337) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(62338..63309) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene thiL CDS complement(63383..63790) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene nusB CDS complement(63804..64280) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene ribE CDS complement(64400..65506) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene ribBA CDS complement(65588..66244) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(66245..67369) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene ribD CDS complement(67410..67862) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene nrdR CDS complement(67972..69225) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 69454..71121 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073319.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene ettA CDS complement(71172..71486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(71497..75105) product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 75609..76700 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073326.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 76700..79819 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073327.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(79903..80256) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(80465..80890) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073336.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 81344..81826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 81889..82314 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(82326..83819) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(83867..84709) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 85140..86504 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene yegQ CDS 86774..87025 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071475.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 87036..87233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(87325..87693) product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071672.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(87860..88876) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene ltaE CDS 89187..89879 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073212.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(90021..91313) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene thrC CDS complement(91353..92312) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene thrB CDS complement(92309..94774) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene thrA CDS 95427..96038 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene slyD CDS 96193..96573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(96575..96850) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene trpR CDS 97048..97500 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(97562..98239) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 98552..98905 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073280.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene raiA CDS 99172..101127 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071575.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(101115..102416) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(102463..102798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071573.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(102898..103995) product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(104065..105726) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene hcp CDS complement(105956..107095) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071570.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene tyrA CDS complement(107109..108200) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071569.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(109769..110074) product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(110087..110737) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071771.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 111072..111302 product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(111319..111684) product DUF3192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 111875..112189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 112189..112962 product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071767.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(113038..113679) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925666.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene syd CDS 113706..114596 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071765.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene queF CDS complement(114659..115426) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071761.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(115473..115757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 116158..116943 product transcriptional regulator of eicosapentaenoic acid synthesis PfaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 116940..124541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 124538..126706 product PfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071758.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 126722..132616 product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966575.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 132660..134273 product eicosapentaenoate synthase subunit PfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene pfaD CDS complement(134418..134798) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene acpS CDS complement(134798..135535) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene pdxJ CDS complement(135648..136373) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene recO CDS complement(136382..137371) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene era CDS complement(137368..138051) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071557.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene rnc CDS complement(138048..138962) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071556.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene lepB CDS complement(139132..140922) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene lepA CDS complement(141040..141519) product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(141530..142462) product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(142472..143092) product sigma-E factor negative regulatory protein RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071552.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(143117..143695) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene rpoE CDS 143895..145505 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071550.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene nadB CDS complement(145522..145788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(145925..146176) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(146263..147171) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene nhaR CDS complement(147188..147571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(147568..148743) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071545.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene nhaA CDS complement(148860..149654) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene thyA CDS complement(149654..150481) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene lgt CDS complement(150519..151319) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(151367..153601) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071541.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene ptsP CDS complement(153627..154151) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071540.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene rppH CDS 154850..155524 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene mutH CDS 155647..156729 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071538.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(157116..157496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(157556..159169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(159555..160460) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(160605..160769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(161302..161466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(162223..162840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 162947..163111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(163188..164396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 sequence16 source 1..58342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(512..1066) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene gmhB CDS complement(1260..1784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(1788..3911) product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(3926..4570) product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 4912..7239 product decaheme c-type cytochrome OmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071902.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene omcA CDS 7496..8167 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 8255..9331 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072771.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(9563..10435) product flagellar protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene motY CDS 10577..11245 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072694.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene rnt CDS complement(11399..12406) product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(12790..13059) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(13063..14181) product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(14233..15420) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072975.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(15421..16515) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072976.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene aroC CDS complement(16612..17556) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072977.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene prmB CDS 17641..18171 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene smrB CDS complement(18342..18812) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene sixA CDS 18985..21774 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 23873..26353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 26508..27065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(27657..30110) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(30110..30877) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 30861..31535 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(31599..32099) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 32308..33369 product DUF3083 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(33466..34185) product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 34424..37066 product SO2930 family diheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072834.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(37731..38981) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071949.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(38983..39603) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(39605..40009) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(40023..40550) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(40550..41905) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(41905..42687) product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(43361..46114) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(46533..47741) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(47956..50325) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925854.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 50412..52484 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene dinG CDS 52506..53279 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 53276..53938 product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 53948..54643 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071937.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 54647..55552 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 55616..55906 product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(56587..57492) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(57615..58058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 sequence17 source 1..6044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 2..77 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 106..181 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 assembly_gap 182..307 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 309..384 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 414..489 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 575..2479 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 2595..3173 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene rsxA CDS 3178..3747 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene rsxB sequence18 source 1..46533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(833..1195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(1241..1957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(2356..3582) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene hutI CDS 3728..4450 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene hutC CDS 4498..6168 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 6168..7709 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070508.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene hutH CDS complement(7838..8512) product DUF3157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070522.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 9032..9466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 9588..10877 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070528.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(10908..11528) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(11593..12192) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 12535..12960 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 13023..13592 product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(13555..14334) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070532.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(14413..16092) product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 16279..16866 product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070534.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 16899..19028 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene ygjK CDS 19128..19415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 19412..22225 product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(22295..22873) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070536.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 22786..23049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 22991..23386 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070537.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 23379..24452 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070538.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene rlmF CDS complement(24495..25400) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(25425..26255) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 26534..26992 product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 26992..27618 product DUF3306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074124.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 27757..29433 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925937.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 29444..30100 product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 30176..30373 product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 30392..33241 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074128.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 33269..33865 product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene fdh3B CDS 33911..34909 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 35283..35480 product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074131.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 35499..38351 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 38381..38950 product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene fdh3B CDS 39004..39984 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(40168..40317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 40413..41999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 42257..43594 product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(43670..44086) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(44119..45939) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 sequence19 source 1..1357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 354..1338 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 62 percent of the 16S ribosomal RNA locus_tag LOCUS_r00010 sequence20 source 1..24393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 704..1015 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070616.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene rpsJ CDS 1043..1681 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene rplC CDS 1699..2304 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene rplD CDS 2301..2603 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037421480.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene rplW CDS 2615..3439 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070620.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene rplB CDS 3454..3732 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene rpsS CDS 3748..4080 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene rplV CDS 4090..4779 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene rpsC CDS 4791..5201 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene rplP CDS 5201..5392 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rpmC CDS 5392..5640 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene rpsQ CDS 5829..6188 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083590.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene rplN CDS 6200..6514 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene rplX CDS 6527..7066 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene rplE CDS 7078..7383 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene rpsN CDS 7408..7803 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene rpsH CDS 7814..8347 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070626.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene rplF CDS 8358..8708 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070627.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene rplR CDS 8720..9223 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644438.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene rpsE CDS 9230..9412 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083582.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene rpmD CDS 9416..9850 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070628.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene rplO CDS 9858..11198 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene secY CDS 11449..11805 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene rpsM CDS 11820..12212 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene rpsK CDS 12247..12867 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene rpsD CDS 12892..13881 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene rpoA CDS 13923..14321 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene rplQ CDS complement(14388..15362) product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(15466..15924) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene ccmE CDS complement(15951..16151) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070634.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene ccmD CDS complement(16151..16897) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070635.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(16899..17585) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene ccmB CDS complement(17598..18245) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene ccmA CDS 18569..18862 product monoheme cytochrome c5 ScyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene scyA CDS complement(18928..20181) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene ccmI CDS 20634..22610 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 22627..23181 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 23178..23657 product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070642.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene nrfF CDS 23657..24241 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 sequence21 source 1..77058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(447..1454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 1730..2287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 2244..2783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074149.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(2785..3249) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene trmL CDS 3483..6368 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036532.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(6530..8050) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 8287..10089 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 10298..11281 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481249.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 11495..11713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(11691..11948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 12122..12412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 12477..12731 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393126.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 12849..13853 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(14125..15492) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074106.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(15492..16178) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 16387..16932 product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 16978..17847 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074103.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 17859..18191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(18243..19646) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074101.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene glnG CDS complement(19663..20721) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074100.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene glnL CDS complement(20837..21382) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(21454..22611) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(22624..24603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(24710..25942) product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(26033..26890) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074144.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(27013..28059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 28296..29219 product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 29229..29726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(29831..31240) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene glnA CDS 31698..33509 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene typA CDS complement(33593..34597) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479808.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 34736..35500 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 35544..36050 product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 36060..37121 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(37287..39527) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(39524..39979) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(39983..40612) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(40624..41676) product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(41830..43062) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074053.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(43227..43877) product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(43898..44116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 44299..45186 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 45164..46129 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 46126..46563 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene dtd CDS 46565..47035 product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 47245..47838 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene azoR CDS complement(47909..48076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(48082..48402) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 48549..49676 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(49778..51010) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(51007..51732) product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(51729..52220) product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074035.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(52217..53407) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(53439..54122) product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(54119..55375) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(55372..57729) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074031.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(57729..58439) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(58577..59014) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(59011..60564) product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(60561..62273) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(62270..62632) product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074026.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(62625..63995) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(64006..64554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(64554..64802) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(64812..65066) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(65053..65850) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(65847..66575) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(66820..67686) product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(67875..69950) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene recG CDS complement(70121..70360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(70537..71142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(71188..71556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(71603..72070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 72665..73186 product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(73336..74265) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(74434..76089) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(76249..76941) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068431.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene trmH sequence22 source 1..75371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 869..1507 product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene cas6f repeat_region 1658..6545 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcccaggcagcttagaaa CDS complement(6664..8949) product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene pbpC CDS complement(8946..14471) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070479.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 15261..16580 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925787.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene argA CDS complement(16687..17952) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rho CDS complement(18166..18516) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070766.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene trxA CDS 18646..19959 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rhlB CDS 19960..20880 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070768.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(20986..21525) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070769.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(21726..22736) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073891.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene hemB CDS complement(22733..24634) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(24627..25430) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073889.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(25427..25942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073888.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(25991..26746) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073887.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene tatC CDS complement(26757..27164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(27171..27416) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073885.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene tatA CDS complement(27476..29125) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene ubiB CDS complement(29122..29754) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073883.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(29756..30511) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene ubiE CDS complement(30782..31804) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(31913..32398) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073880.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene rraA CDS 32733..32975 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073879.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 33097..33609 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 33619..34713 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(34757..35137) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(35293..35991) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070849.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene fre CDS complement(36057..37538) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene ubiD CDS 37865..38365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070852.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 38371..39033 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070853.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 39113..39955 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 40131..41378 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073820.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 41566..43479 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene csrD CDS 43703..44587 product MSHA biogenesis protein MshI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 44584..45183 product MSHA biogenesis protein MshI2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073817.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 45180..45839 product MSHA biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073816.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 45853..46146 product MSHA biogenesis protein MshK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 46146..47876 product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene mshL CDS 47885..48796 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 48793..50151 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 50148..51902 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 51905..53125 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 53125..53619 product MSHA biogenesis protein MshF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073809.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 53684..54286 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 54321..54827 product type IV pilin MshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106342.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene mshA CDS 54843..55358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 55467..55934 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073806.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 55924..56424 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 56424..57260 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 57250..57723 product MSHA biogenesis protein MshP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 57983..61435 product MSHA biogenesis protein MshQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 61556..62998 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706094.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 63207..64256 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 64446..65264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 65261..65749 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073800.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene mreD CDS 65751..66353 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073799.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 66485..67951 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene rng CDS 68002..72249 product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 72173..73018 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 73055..74503 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene tldD CDS 74848..75246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 sequence23 source 1..94480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..2285) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene fusA CDS complement(2358..2828) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070613.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene rpsG CDS complement(2905..3414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(3458..7669) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene rpoC CDS complement(7754..11785) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene rpoB CDS complement(12019..12387) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644333.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene rplL CDS complement(12442..12942) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070609.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene rplJ CDS complement(13205..13906) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070608.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene rplA CDS complement(13911..14339) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene rplK CDS complement(14463..14978) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene nusG CDS complement(15023..15403) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070605.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene secE CDS complement(16166..16441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(16438..18510) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 19096..19749 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene ribB CDS 20009..23206 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(23248..23775) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene ftnA CDS complement(23903..24094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 24050..25294 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070542.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 25302..26054 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene moeB CDS complement(26105..27934) product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230690.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 28207..28866 product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 29077..29586 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074064.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(29555..30439) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 30548..31204 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(31290..31457) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(31574..32254) product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074068.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(32258..33526) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(33570..34247) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(34250..34771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074071.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(34827..35189) product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(35311..36405) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(36402..37067) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene modB CDS complement(37068..37868) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene modA CDS complement(37881..38339) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074081.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene moaE CDS complement(38341..38589) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene moaD CDS complement(38594..39070) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene moaC CDS complement(39063..39593) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene moaB CDS complement(39664..40596) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene moaA CDS 40997..42649 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 42924..44834 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 44986..45303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(45406..46944) product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 47091..47645 product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 47849..48772 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(48701..48892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(49167..49691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 49842..51020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 51017..52039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 52041..55094 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 55091..55396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(55387..56004) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(56080..57261) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074297.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(57422..57637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(57638..58369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(58383..58907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(58924..59607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(59597..60946) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(60949..63639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 63990..65348 product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(65345..66091) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 66202..66411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 66329..66988 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 67076..67537 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(67694..68431) product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(68571..69518) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 70092..71129 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 71143..74274 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 74514..75194 product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070497.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene mtnC CDS 75368..75793 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070493.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 75904..76770 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071265.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene pbpG CDS 76896..80390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 80560..80970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 80999..82189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(82445..82843) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(82871..83062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(83189..84982) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070488.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(85120..86352) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(86349..87200) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(87213..87596) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 87680..89170 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 89167..89901 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 89898..91034 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070482.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(91161..91694) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene mog CDS complement(91768..92607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(92624..93139) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070475.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 93377..93649 product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528685.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 93904..94101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 sequence24 source 1..56360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(490..807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 note possible pseudo, internal stop codon, frameshifted tRNA 1143..1219 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(1313..2329) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(2322..2549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 2846..2986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(3032..5047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(5190..7301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(7298..7669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(7721..8308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 8720..9286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 9666..9899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 9896..10729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 10729..11442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(11587..12186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(12267..12800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 14050..14526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 14930..15286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 15273..17249 product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104272554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene traD CDS 17246..20353 product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene mobF CDS 20453..21976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 22124..22384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 22381..22608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 22621..23433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 23465..23722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(23846..24205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(24208..25371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(25364..25750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(26730..27026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 27781..28041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(28118..29320) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133040744.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 29477..29938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(30902..31372) product DNA starvation/stationary phase protection protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene dpsA CDS 31651..31986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 31983..32441 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene rimI CDS complement(32590..33555) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene lipA CDS complement(33548..34213) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene lipB CDS complement(34345..34611) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ybeD CDS complement(34747..36555) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(36697..36960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 37076..38266 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037154163.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 38351..39127 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071596.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(39159..39479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073989.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 39642..40868 product metallopeptidase MdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene mdpA CDS complement(40997..41650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(41637..42482) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(42497..43168) product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(43168..44799) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(44796..45515) product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(45628..47181) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene lnt CDS complement(47178..48059) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071409.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene corC CDS complement(48092..48553) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071410.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene ybeY CDS complement(48543..49589) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071411.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(49719..51143) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene miaB CDS complement(51241..51564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 51648..52985 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071414.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 53175..53762 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071415.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene pth CDS 53848..54939 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071416.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene ychF tRNA 55115..55191 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 55223..55307 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 55343..55417 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 55438..55512 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 55539..55615 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 55683..55757 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 sequence25 source 1..373573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(747..4724) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072176.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(4736..6586) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 6720..7754 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 7779..8369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 8479..12354 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene hrpA CDS complement(12568..14001) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene nrfA CDS 14502..14663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 14702..14959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 14956..17451 product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene napA CDS 17465..17947 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173083.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 17956..18543 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(18654..19046) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009876549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(19198..20208) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072241.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(20405..22408) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene recD CDS complement(22405..26058) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene recB CDS complement(26060..29689) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene recC CDS complement(29741..31804) product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(31801..32781) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(32789..33691) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(33705..34421) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(34592..36541) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(36586..38082) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene rmuC CDS 38363..39358 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene msrP CDS 39358..39969 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072116.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene msrQ CDS complement(39996..41321) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(41318..42316) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(42692..43009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 43232..43726 product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 43767..45602 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 45602..46141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(46398..46658) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007648439.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene minE CDS complement(46662..47471) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene minD CDS complement(47498..48163) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene minC CDS 48286..48573 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 48589..49566 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735487.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 49614..50054 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(50136..50648) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene dsbB CDS complement(50787..52376) product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072797.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene nhaB CDS 52680..53399 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072796.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene fadR CDS complement(53619..56210) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072799.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 56924..58015 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818717.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 58009..58926 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 59147..60361 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(60492..60911) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 60978..61238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(61388..62791) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072558.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene rsmF CDS 62863..64089 product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(64153..66774) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(66752..67390) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(67380..68027) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 68223..68510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 68524..68982 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 69246..69902 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072551.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene proQ CDS 69927..71996 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925720.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene prc CDS 72122..74707 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene pepN CDS 74716..74931 product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072548.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 75247..77301 product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 77315..78682 product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 78770..79810 product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 79823..82132 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 82398..87245 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 87307..88326 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene pyrD CDS 88594..89046 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072541.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(89097..89975) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464957.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 90085..90948 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144396477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 90942..91688 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(91887..92537) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene hisIE CDS complement(92675..93448) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene hisF CDS complement(93430..94167) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene hisA CDS complement(94164..94826) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072137.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene hisH CDS complement(94826..95893) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072138.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene hisB CDS complement(95937..97040) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072139.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene hisC CDS complement(97046..98434) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072140.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene hisD CDS complement(98438..99334) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene hisG CDS 99908..101848 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925684.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(101962..102972) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072536.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene hemB CDS complement(103123..103557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(103602..104537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(104698..105993) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 106163..106879 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072535.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene tsaB CDS 106942..107241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 107228..107932 product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 108059..108904 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 108926..109819 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072531.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 110024..111697 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072530.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene fadD CDS 111769..112878 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene rnd CDS complement(113070..114620) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(114785..116314) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(116592..117404) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene gloB CDS 117521..118264 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 118270..119184 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072514.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(119181..119657) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene rnhA CDS 119730..120476 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072512.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene dnaQ CDS 120485..121804 product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 tRNA 121906..121982 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 122034..122110 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(122258..123472) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene emrD CDS 124044..124838 product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 124941..126218 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 126219..129359 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769702.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 129356..130810 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766157.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(130830..131525) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(131662..132207) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene eco CDS complement(132482..134545) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 134799..135857 product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene dmeF CDS 135871..136308 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 136676..138295 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072121.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(138369..141071) product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 tRNA complement(141298..141374) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(141386..141462) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(141601..142977) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 143011..143628 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(143711..144274) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene efp CDS complement(144320..145579) product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene earP CDS complement(145595..146122) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072322.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene fldA CDS complement(146177..146446) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene ybfE CDS complement(146461..146682) product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(146782..147558) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072325.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 147859..148413 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene seqA CDS 148454..150103 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072327.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene pgm CDS complement(150174..150653) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene msrA CDS 150984..152021 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene astE CDS 152185..153363 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 153366..154343 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 154354..155952 product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072332.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 156120..157187 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene nadA CDS 157350..157742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 note possible pseudo, frameshifted CDS 157718..159340 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 note possible pseudo, frameshifted tRNA 159507..159594 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(159784..160416) product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072194.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 160760..163363 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene adhE CDS 163834..165621 product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 165864..166529 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 166665..167792 product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 167802..168119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 168116..168397 product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(168463..169479) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene ansA CDS complement(169587..171440) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene sppA CDS 171637..173658 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(173999..174949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(174949..176169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(176159..176578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(176580..177437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(177482..178711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(178810..179124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(179114..180244) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene nrdB CDS complement(180304..182580) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072392.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene nrdA CDS complement(183083..183751) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(183756..184466) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 184825..187464 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072389.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene gyrA CDS 187525..188619 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene serC CDS complement(188705..189901) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 190365..191645 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene aroA CDS 191801..192496 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072382.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene cmk CDS 192569..194263 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene rpsA CDS 194334..194621 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene ihfB CDS 194744..195013 product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072379.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 195015..196175 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene lapB CDS 196197..196892 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene pyrF CDS 196964..197782 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 197801..198346 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072375.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(198350..198550) product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 198822..200750 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene thrS CDS 200835..201296 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene infC CDS 201381..201575 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene rpmI CDS 201593..201952 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene rplT CDS complement(202094..203047) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene trxB CDS complement(203191..204306) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene ald CDS 204487..204990 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene lrp CDS 205197..207782 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072306.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 207800..208414 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072307.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene lolA CDS 208417..209748 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 209741..210115 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene crcB CDS 210134..211420 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene serS CDS complement(211619..211957) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(211951..212232) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072360.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene tusB CDS complement(212232..212588) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072359.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene tusC CDS complement(212588..212959) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene tusD CDS complement(213036..213695) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(213842..214744) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene punR CDS 215008..216114 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072355.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene punC tRNA 216196..216286 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(217355..217822) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071986.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene bcp CDS complement(217863..218411) product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071987.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 218640..219470 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071988.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene dapA CDS 219475..220575 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene bamC CDS 221001..222086 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 222083..225175 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(225231..226301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(226438..227289) product DUF3080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240016.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 228062..228334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 228706..229926 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(229996..231453) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112492.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene dgt CDS 231644..232105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(232280..233242) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene ttcA CDS complement(233320..234246) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene uspE CDS complement(234336..235016) product electron transport transcriptional regulator EtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene etrA CDS complement(235144..235836) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(235826..236053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(236050..238446) product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072346.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(238455..238934) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(239039..240025) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072348.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene ccoP CDS complement(240025..240201) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072349.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(240212..240817) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072350.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene ccoO CDS complement(240830..242266) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene ccoN CDS 242706..242993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(243030..244607) product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 245086..246390 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 247341..247598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 247595..247882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070803.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 247883..249520 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(249597..250223) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 250379..251272 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(251375..252466) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072783.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(252528..252791) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 252876..254345 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072785.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 254468..254818 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072786.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene arsC CDS 254819..255196 product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(255481..256305) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(256309..256842) product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(256912..257508) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071418.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(257611..259494) product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(259494..260999) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 261275..261748 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 261745..262332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(262334..262612) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 262924..264873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(264953..265663) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene hda CDS complement(265740..266828) product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 267097..268350 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(268568..269950) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 270608..271741 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072448.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 271850..272437 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene yfbR CDS 272449..273783 product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(274393..277215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 278226..279074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 279238..280623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 280891..281169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 281917..283626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 283651..285642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 285706..285957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 286049..286459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 tRNA complement(286545..286631) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(286674..286747) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(286768..286843) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(287457..288899) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 289093..290040 product DUF2989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 290252..291262 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene gap CDS 291608..293158 product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072385.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(293272..293481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 293662..294246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(294233..295168) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(295288..296601) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072370.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene pssA CDS 296950..297114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 297166..298704 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene dacB CDS complement(298809..300578) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072374.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(300831..301565) product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene bluB CDS complement(301740..303728) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(304070..305074) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072404.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene ruvB CDS complement(305110..305727) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072405.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene ruvA CDS complement(305724..306245) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072406.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene ruvC CDS complement(306257..307003) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(307110..308891) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072408.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene aspS CDS complement(309080..311896) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072409.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 312043..312774 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072410.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene cmoA CDS 312771..313739 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072411.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene cmoB CDS 313803..314567 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 314576..316081 product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 316083..317030 product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 317017..318840 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072412.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 318746..319870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 319929..320825 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 321254..321799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(321940..322761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(323326..323580) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(323705..324862) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene thiH CDS complement(324855..325634) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(325636..325836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(325826..328489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(328491..330599) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072421.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene thiC CDS complement(331092..332291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 332657..333337 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072423.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(333412..333927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(334102..337320) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(337320..338690) product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(339043..339855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 340392..341819 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(341816..342310) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene def CDS 342487..342849 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925718.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 342866..343597 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072491.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(343541..344341) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 344595..347045 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072493.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene fadE CDS complement(347525..349570) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(349637..351154) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072246.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 351410..352819 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene pabB CDS 352917..353486 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(353622..353957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(353869..354129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 354160..355560 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene asnS CDS complement(355634..356341) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061030497.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(356338..358203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(358200..359246) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261408.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(359252..360727) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700231.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(360693..360881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 361403..361813 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene nikR CDS complement(361973..362926) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072152.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene lpxM CDS complement(363073..363369) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene ihfA CDS complement(363373..365760) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072150.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene pheT CDS complement(365776..366756) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072149.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene pheS CDS 367044..368870 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072683.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 368921..369178 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072684.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(369448..371238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(371400..373481) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 sequence26 source 1..110159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 4..80 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 89..180 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 227..303 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 994..1260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1287..3077 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene oadA CDS 3087..4220 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(4404..4571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(4600..5586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 5802..6227 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 6265..9120 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 9394..10986 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene gshA CDS 10983..11408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 11514..12146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(12355..14361) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(14810..17896) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(17893..19071) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 19218..19832 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 19879..20769 product DUF6268 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(20834..21397) product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(21481..22134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(22155..22481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 22688..23518 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 23525..24391 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 24433..25248 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791711.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 25250..25972 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene pstB CDS complement(26042..28372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 29263..30168 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(30491..31375) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089840.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 31681..33651 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene betT tRNA complement(34359..34434) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(34490..35647) product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073141.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 36347..36997 product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073140.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 36997..37464 product LPP20 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(37706..38137) product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(38137..38457) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene flgM CDS complement(38528..39142) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073136.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene flgA CDS 39423..40343 product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 40488..41321 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 41496..41894 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene flgB CDS 41897..42313 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene flgC CDS 42328..43011 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073131.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene flgD CDS 43066..44427 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene flgE CDS 44578..45336 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073129.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene flgF CDS 45348..46136 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene flgG CDS 46149..46823 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene flgH CDS 46834..47925 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 47960..48961 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene flgJ CDS 48982..50907 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene flgK CDS 50919..52124 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene flgL CDS 52220..52432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 note possible pseudo, frameshifted CDS 52467..53414 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 note possible pseudo, frameshifted CDS 53694..54872 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 55102..55509 product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073120.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 55540..56895 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene fliD CDS 56914..57261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 57271..57681 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073117.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene fliS CDS 58185..59390 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073116.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 59471..60535 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073115.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 60532..61863 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 62041..62373 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073113.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene fliE CDS 62415..64124 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene fliF CDS 64117..65160 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene fliG CDS 65174..66148 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073110.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene fliH CDS 66114..67457 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073109.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene fliI CDS 67582..68031 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073108.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene fliJ CDS 68165..69712 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 69779..70303 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene fliL CDS 70330..71358 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene fliM CDS 71370..71750 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene fliN CDS 71755..72117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 72114..72860 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene fliP CDS 72870..73139 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene fliQ CDS 73143..73940 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene fliR CDS 73940..75076 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073099.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene flhB CDS 75139..77244 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene flhA CDS 77251..78627 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene flhF CDS 78614..79513 product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 79506..80225 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 80273..80656 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene cheY CDS 80670..81407 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 81423..83744 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 83765..84913 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073092.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 84942..85391 product membrane anchored protein in chemotaxis locus inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 85468..86259 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073090.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 86375..87178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 87186..87680 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 87711..88124 product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073087.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(88255..88578) product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073086.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(88588..90330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073085.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 90604..91374 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 91452..92558 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073083.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(92658..94169) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 94602..95099 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene rfaH CDS 96019..98757 product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925895.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 98843..99814 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 99974..100678 product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene neuA CDS 100675..101718 product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 101722..102840 product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene neuC CDS 103000..104262 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 104240..104725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 105483..105965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 105958..106914 product glycosyltransferase family 52 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 106904..107953 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079978687.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 107958..108836 product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 109144..109881 product IS5-like element ISVpa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021706804.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 sequence27 source 1..145268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(647..808) product small highly charged protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(973..2289) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(2407..3078) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(3095..3715) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 3950..4474 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(4536..5210) product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 5391..7634 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071745.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 7734..8306 product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 8451..9005 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071747.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 9393..10055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262054.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 10068..10658 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 10719..11228 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(11234..11449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054775761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(11482..11823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(11820..13121) product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211045.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene ndh CDS complement(13555..13920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(14248..15396) product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene yiaY CDS complement(15749..16579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(16576..18030) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(18034..19221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 19493..20005 product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene cosR CDS 20346..22610 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071677.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene malQ CDS 22585..24855 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene glgB CDS 24855..27218 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene glgX CDS 27211..29751 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 29785..31053 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene glgC CDS 31053..32657 product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925847.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 32778..35834 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071683.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 35888..37156 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 37255..37602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 37722..38819 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 38995..40356 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071689.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 40482..41783 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(41847..42863) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 43260..45893 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073350.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(46193..46369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 46298..46837 product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071562.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(46861..48042) product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(48229..49017) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene ccsA CDS 49314..50687 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene ffh CDS 50903..51154 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071566.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene rpsP CDS 51176..51706 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071567.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene rimM CDS 51723..52466 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071568.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene trmD CDS 52501..52854 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080791.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene rplS CDS complement(53895..54284) product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(54281..55294) product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 55399..55722 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 55694..56536 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071776.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene truC CDS 57105..57569 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071778.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 57521..59002 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 59089..59922 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925851.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene purU CDS complement(59948..60313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(60571..61395) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene dapD CDS complement(61413..63992) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071782.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene glnD CDS complement(64013..64816) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene map CDS 65247..65960 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071784.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene rpsB CDS 66093..66944 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene tsf CDS 67014..67745 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene pyrH CDS 67774..68331 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071787.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene frr CDS 68416..69243 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene uppS CDS 69360..70121 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 70126..71316 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071790.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene ispC CDS 71332..72714 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071791.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene rseP CDS 72746..75229 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene bamA CDS 75279..75785 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037416754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 75790..76815 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene lpxD CDS 76853..77314 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene fabZ CDS 77311..78081 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene lpxA CDS 78096..79256 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071797.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene lpxB CDS 79253..79873 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene rnhB CDS 80115..83588 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071799.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene dnaE CDS 83588..85198 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071800.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene tilS CDS complement(87347..87625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(87794..88423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020887103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(88460..88933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(89004..89351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(89489..90490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(92882..93769) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 93955..95901 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 96058..96996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(97004..98128) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073043.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(98290..100155) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071704.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene dxs CDS complement(100177..101058) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071705.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene ispA CDS complement(101059..101298) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071706.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene xseB CDS 101694..102461 product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071707.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene pomA CDS 102466..103401 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 103621..105018 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071709.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene thiI CDS complement(105085..105363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 105549..106460 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 106537..107172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 107179..107670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480696.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 107795..108439 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 108442..108831 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(109012..111150) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 111424..112002 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073032.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 112081..113091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(113110..114225) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(114431..114892) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(115107..116498) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(116839..117951) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(118266..118847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(119002..120042) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929827.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(120132..120575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(120640..121062) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089492.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(121163..121552) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026141403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(121592..122734) product DUF5694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(123241..123507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(123500..124108) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073305.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(124098..126863) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene barA CDS 126981..128318 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene rlmD CDS 128445..130655 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene relA CDS 130778..131587 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073298.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene mazG CDS complement(131714..131860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 131859..133382 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 133530..134825 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073296.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene eno CDS 134924..135226 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene ftsB CDS 135255..136007 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene ispD CDS 136023..136502 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073293.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene ispF CDS 136537..137601 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 137598..138344 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene surE CDS 138341..138976 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 139004..140038 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 140117..141073 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073288.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene rpoS CDS 141769..142458 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071727.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene phoB CDS 142533..143834 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071728.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene phoR CDS complement(143949..144089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 144249..145154 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071729.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 sequence28 source 1..11599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(130..205) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(266..341) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(393..468) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(575..1984) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene gltX CDS 2251..2478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 2740..3759 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 3766..4443 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 4452..5849 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 5938..7734 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 7731..9098 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(9077..10339) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072018.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 10485..11366 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 sequence29 source 1..340670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(183..258) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(380..455) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(577..652) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(695..770) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(886..1431) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070927.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene orn CDS 1562..2608 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070926.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene rsgA CDS 2640..3503 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070925.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene asd CDS 3506..4396 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 4472..7675 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070924.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 7682..8401 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(8434..8766) product DUF3392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 8814..9740 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 10033..10224 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070919.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(10301..12568) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene parC CDS complement(12568..13743) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(13791..15677) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene parE CDS complement(15731..16306) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(16342..17181) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073647.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene cpdA CDS complement(17197..17631) product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(17615..18238) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073649.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene nudF CDS 18475..19791 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073650.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene tolC CDS complement(19865..20602) product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(20606..21577) product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073652.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(21590..22057) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 22110..22850 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(22913..23287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(23284..23478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(23606..23905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(24148..25131) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene dusA CDS complement(25265..25909) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(25936..27642) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 27962..28705 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 28695..29768 product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene nrfD CDS 29768..32878 product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 33058..33525 product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(33584..34660) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene alr CDS complement(34729..36135) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene dnaB CDS 36266..38467 product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073664.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(38764..39216) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene rplI CDS complement(39247..39474) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083042.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene rpsR CDS complement(39486..39791) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073673.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene priB CDS complement(39800..40201) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene rpsF CDS 40407..41150 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(41177..41683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(41753..42490) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene rlmB CDS complement(42491..44905) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073678.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene rnr CDS complement(44951..45571) product flagellar protein MotX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene motX CDS complement(45685..46980) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(47046..47234) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(47347..47739) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083052.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene rpsI CDS complement(47754..48182) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene rplM CDS complement(48481..49575) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene zapE CDS 49791..50144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 50289..51644 product Do family serine endopeptidase DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene degQ CDS 51800..52876 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073685.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene degS CDS complement(52953..53342) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene rraB CDS complement(53374..54117) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070907.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(54266..55033) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(55030..55938) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(55922..57121) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 57245..57499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 57739..57864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(57869..58204) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 58386..60005 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162232748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(60063..61769) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070900.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(62004..62864) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 63006..63830 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070898.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(63791..64426) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene cheD CDS complement(64472..65359) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070897.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 65407..65718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070896.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 65840..67570 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(67567..68091) product DUF3016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 68369..68674 product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070893.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(68681..69190) product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 69310..69705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 69879..70151 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070888.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 70418..71110 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(71152..72057) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene rimK CDS complement(72142..73878) product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(73882..74313) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(74310..76445) product CHASE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 76747..76929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(76965..77930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 78153..79505 product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(79562..80917) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(81044..82006) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073534.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 82099..83040 product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(83028..83600) product K(+)-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene kdpF CDS 83840..84241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 84304..84543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(84665..86119) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(86546..87787) product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene arsJ CDS complement(87799..88812) product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(88826..89848) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene arsB CDS complement(89914..90249) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 90845..91024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 91028..92524 product proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242814.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene opuE CDS 92630..93772 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene proB CDS 93819..95066 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(95237..95467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 96942..97487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 97729..98226 product DUF2165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209941.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 98237..98977 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073830.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(99218..100027) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 100364..100981 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(100951..101235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(101246..102178) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071842.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(102528..102674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(102804..103157) product DP-EP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071844.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(103178..106432) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(106528..107814) product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071852.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 108240..110960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 111137..113848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(113899..114300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(114382..116337) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(116731..117762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(117766..117978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(118028..119917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(119975..121864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(121888..123633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(124202..124681) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene tsaA CDS complement(124761..125519) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 126034..126690 product Qnr family pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261921.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 126834..127133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 127175..127609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(127747..127962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 128000..128164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 128562..130487 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 130498..130872 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073568.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 tRNA complement(131400..131486) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(131617..133206) product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073637.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(133693..134304) product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 134472..136103 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073640.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(136105..137394) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene pepT CDS complement(137421..138266) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073641.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene tcdA CDS complement(138446..138625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 138905..139984 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073642.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(140098..140754) product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070918.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 141190..142083 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481255.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene rarD CDS complement(142069..142779) product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene mnmD CDS complement(142872..143609) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480164.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(143621..144148) product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421462.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(144145..146232) product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(146295..146699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 147533..147781 product type II toxin-antitoxin system antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene hipB CDS 147781..149082 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262056.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(149223..150590) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 150894..152921 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 153185..154936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(154920..155636) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073518.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene mtgA CDS complement(155939..156586) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(156586..157011) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene trxC CDS complement(157078..157818) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462606.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(157985..159037) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071380.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 159586..159825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 159803..160246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 160269..161624 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene mgtE CDS complement(161739..163502) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 163750..164169 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(164265..164549) product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(164546..164908) product Hg(II) uptake system permease component MerT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(164880..166022) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(166298..167518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(167515..168165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422308.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(168165..171836) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(172010..172411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(172486..172833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070917.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 173062..174870 product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(174867..177650) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073743.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(177771..180176) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(180237..183929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(184064..185458) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070914.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 185803..188709 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070913.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene rapA CDS 188937..189917 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(189993..190496) product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(190587..191456) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070911.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 191753..192748 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 192764..193723 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(193789..195048) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073687.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene murA CDS complement(195058..195315) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073688.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(195323..195610) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073689.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(195607..196263) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073690.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(196274..196747) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene mlaD CDS complement(196791..197576) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene mlaE CDS complement(197563..198390) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene mlaF CDS 198643..199638 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711559.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 199669..200646 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 200646..201197 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene kdsC CDS 201194..201754 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene lptC CDS 201741..202274 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene lptA CDS 202271..202999 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene lptB CDS 203095..204558 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073699.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 204590..204877 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene hpf CDS 204880..205323 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073701.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene ptsN CDS 205320..206174 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene rapZ CDS 206161..206436 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 206520..207884 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene mgtE CDS complement(208026..208409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(208566..209261) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(209547..210209) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 210720..210953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(211069..212049) product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 212189..213580 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene fumC CDS 213681..214229 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073709.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(214809..215495) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 216727..217536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 217626..218114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 218288..218641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 218644..220044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(220967..222607) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071022.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene groL CDS complement(222666..222956) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071021.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 223206..224570 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(224786..225484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 225685..226017 product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 226014..227819 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 227947..229566 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 229773..230924 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene galK CDS 230957..231988 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071012.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 231985..232383 product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(232479..232883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(233309..234289) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070965.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(234533..234766) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070517.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene yedF CDS complement(234766..235980) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene yedE CDS complement(236285..237121) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070515.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene fdhD CDS complement(237223..239262) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025822336.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene selB tRNA 237263..237357 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(239259..240680) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene selA CDS complement(240743..241657) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070512.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene fdhE CDS complement(241658..242299) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070511.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(242296..243219) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene fdxH CDS complement(243222..246236) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070509.1 transl_table 11 codon_start 1 transl_except (pos:245655..245657,aa:Sec) note codon on position 194 is selenocysteine opal codon. locus_tag LOCUS_17380 gene fdnG CDS 246270..246443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(247131..247835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(247869..249236) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 249458..252280 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene uvrA CDS 252288..252638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073747.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 252718..253743 product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073748.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 253913..255715 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(255751..255957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(255954..256334) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 257107..257502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(257720..258772) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073761.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(258782..259336) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(259625..260653) product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073763.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(260662..261720) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073764.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(261731..262231) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073765.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene slyA CDS 262490..264400 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073766.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(264468..265358) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073767.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene metF CDS 266127..266312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(267179..269578) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073768.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(269595..270755) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925915.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene metB CDS 270971..271285 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073770.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene metJ CDS 271361..272104 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073771.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(272112..273305) product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(273463..274407) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073772.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene nrfD CDS complement(274404..274976) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073773.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(274989..277268) product thiosulfate reductase PhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073774.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene phsA CDS 277825..278148 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 278514..280241 product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073840.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 280254..281654 product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 281946..283088 product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(283120..284976) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 285123..285740 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073853.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 285848..287893 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(288012..288542) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(288539..289816) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073863.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 290156..291949 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073865.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 292038..292940 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263889.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 293156..294001 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 294017..294319 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418034.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene ureA CDS 294333..294653 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 294650..296353 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene ureC CDS 296389..296919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 296909..297652 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 297661..298281 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene ureG CDS 298394..298906 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038821.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 299080..299262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 note possible pseudo, internal stop codon, frameshifted CDS complement(299732..301312) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(301777..302484) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 302718..304142 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073781.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene rimO CDS complement(304180..304404) product ribosome alternative rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 304591..305445 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 305537..305884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(305981..307324) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene pmbA CDS 307473..308006 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073786.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene yjgA CDS complement(308424..311021) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070790.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene acnB CDS 311414..312076 product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene hxpB CDS complement(312135..314189) product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070787.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(314332..316557) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925601.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(316637..321079) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(321250..322680) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene lpdA CDS complement(322838..324829) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene aceF CDS complement(324843..327509) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene aceE CDS complement(327582..328334) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070781.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene pdhR CDS complement(328612..329463) product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070780.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene ampE CDS complement(329517..329966) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070779.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene ampD CDS 330247..331107 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070778.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene nadC CDS 332137..332601 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694367.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 332610..334316 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene pilB CDS 334492..335760 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 335835..336749 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070774.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 336750..337361 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070773.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene coaE CDS 337358..338098 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070772.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene zapD CDS 338143..338358 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070771.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene yacG CDS 338355..338753 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070770.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene mutT CDS 339577..339783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(339767..340006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 sequence30 source 1..39973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..1199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1565..2764) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene prpF CDS complement(2850..5441) product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene acnD CDS complement(5546..6670) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene prpC CDS complement(6850..7725) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070710.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene prpB CDS complement(7738..8463) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070711.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 8843..9340 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816335.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(9413..10351) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070712.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(10351..11247) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070713.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 12107..14110 product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(14190..15032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(15056..15775) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439170.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(15786..16043) product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054380.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(16439..17863) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene creD CDS 18125..19102 product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072675.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(19166..19513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 19681..21693 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene rep CDS complement(21721..24375) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073983.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 tRNA 24596..24672 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 24714..24789 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 24924..25000 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 25063..25139 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 25202..25278 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 25341..25417 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS complement(25762..27681) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(27690..28397) product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073981.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(28415..29020) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073980.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(29020..30423) product type I protein secretion system protein AggA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073979.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene aggA CDS complement(30457..31839) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073978.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(31841..34012) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 misc_feature complement(34115..>39973) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:retention module-containing protein locus_tag LOCUS_18390 sequence31 source 1..106783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3077..3409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(3538..5712) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(5709..6146) product VPA1267 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(6146..6823) product gamma-mobile-trio protein GmtX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477284.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene gmtX CDS complement(6823..9483) product integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477239.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(9483..10940) product gamma-mobile-trio recombinase GmtY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477115.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene gmtY CDS complement(11122..12381) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(12378..13499) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071362.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene proB CDS 13404..13643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(13682..14974) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071361.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(16181..17716) product peptidase M17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 17928..19388 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(19610..20104) product non-specific DNA-binding protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene dpsA CDS 20465..21847 product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074243.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(21958..22608) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262154.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene grxB CDS complement(22608..23528) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(23550..24611) product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 24953..25519 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073581.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 25585..26169 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073582.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 26237..26557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073583.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 26719..28404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(28401..28886) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 29032..29391 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 29396..30322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(30324..30668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(30791..31639) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073591.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene kdsA CDS complement(31684..32955) product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(33035..33826) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073593.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(33826..34221) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(34378..35223) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene prmC CDS complement(35235..36320) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073597.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene prfA CDS complement(36335..37630) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073598.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene hemA CDS 37770..38495 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073599.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene lolB CDS 38492..39370 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073600.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene ispE CDS 39450..40397 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073601.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 41435..42409 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070524.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(42633..43637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(43637..44191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(44367..44537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 45083..45274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 46028..46582 product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 46695..47828 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 47935..48393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 48390..48806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 49096..50409 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065016884.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(50674..51945) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene gabT CDS complement(51993..53435) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene gabD CDS complement(53482..54768) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071493.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(54934..55749) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071492.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(55746..56645) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(56642..57778) product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071490.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene potA CDS complement(57897..58994) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(59150..60523) product putrescine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene spuC CDS complement(60534..61883) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(61885..62649) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071487.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(63019..63567) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071486.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 63777..65084 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071485.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 65172..65393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(65448..66944) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 67200..68537 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 68554..70038 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 70057..70419 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073340.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 70524..71261 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(71393..71575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073240.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 71784..72125 product DUF3634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(72126..72356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(72464..73024) product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(73012..73701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(73714..74355) product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103433.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(74359..75618) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(75777..76583) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(76580..77851) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(77848..78597) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(78594..79088) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073250.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(79116..80615) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene phrB CDS complement(80617..81588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(81578..82534) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(82835..83755) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 84149..84643 product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 84742..85908 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925649.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 85905..86534 product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(86593..87153) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071600.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 87271..87819 product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(87806..89116) product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 89572..90042 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071597.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(90185..90685) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 90793..93387 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene leuS CDS 93405..93914 product LPS exporter LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 93914..94945 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071403.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene holA CDS 94955..95611 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene nadD CDS 95703..96032 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene rsfS CDS 96032..96502 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene rlmH CDS 96590..98434 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071399.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene mrdA CDS 98418..99521 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene rodA CDS 99533..100528 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071397.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene mltB CDS 100533..101306 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 101438..102616 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071395.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 102889..104190 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(104361..104918) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 105214..105846 product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071589.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 sequence32 source 1..56490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(344..1126) product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073480.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(1123..1515) product curli assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(1528..1950) product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073482.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(2115..3449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(3446..4876) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073484.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(5003..5188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(5136..6203) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 note possible pseudo, frameshifted CDS complement(6214..7524) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073486.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(7536..8258) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(8294..8542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(8553..9815) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073489.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(10206..11078) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 11327..12733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 12744..15095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 15108..16781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 16856..17422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 17448..17972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(18064..18369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(18629..20557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074435.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(20568..22727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074434.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 23022..23279 product DUF2999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 23951..24556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 24556..27081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(27099..27455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(27614..28774) product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 29024..30583 product POT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070418.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 31612..32715 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073777.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 32919..33377 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(33388..34668) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(34840..35679) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(35679..36377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(36410..36682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(36669..37973) product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070836.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene nosD CDS complement(37979..38479) product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(38557..39210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(39222..39965) product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070831.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(40013..40459) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070830.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(40513..42516) product dissimilatory sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene sirA CDS 42941..44869 product heme lyase NrfEFG subunit NrfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene nrfE CDS 44862..45260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 45320..45856 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070826.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(45981..47033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073867.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(47033..48361) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073868.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(48354..48941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 note possible pseudo, internal stop codon CDS 48900..49169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(49065..49745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 note possible pseudo, internal stop codon CDS complement(50004..50939) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(51022..51609) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(51778..52833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 53303..55696 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 55911..56375 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 sequence33 source 1..37737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1544..2734 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2802..5945) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(5954..7606) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(7633..7953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(8069..8491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220591441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(8656..9111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(9180..9545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 9933..10496 product NapC/NirT family cytochrome c CymA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074189.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene cymA CDS complement(10655..11089) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070588.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(11094..11906) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene cysQ CDS complement(11965..12528) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070586.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene nudE CDS complement(12744..13505) product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(13515..13994) product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070572.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(13995..15185) product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene gspL CDS complement(15234..16226) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070570.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene gspK CDS complement(16226..16969) product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070569.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene gspJ CDS complement(16950..17333) product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene gspI CDS complement(17320..17895) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene gspH CDS complement(17897..18331) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070566.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene gspG CDS complement(18381..19604) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene gspF CDS complement(19608..21173) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene gspE CDS complement(21166..23289) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene gspD CDS complement(23315..24226) product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene gspC CDS 24485..24883 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene hslR CDS 24903..25766 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene hslO CDS 25932..27473 product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 27662..29401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(29521..31275) product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene urdA CDS complement(31318..32082) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(32351..33562) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074218.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(33565..34227) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074219.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(34229..34969) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074220.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 35304..35999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(36067..37647) product aromatic amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 sequence34 source 1..92353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(1974..2492) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071474.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 2633..3634 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071473.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 3645..4505 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(4539..5219) product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071471.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 5771..7315 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071593.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 7605..8963 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 9477..9911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 note possible pseudo, frameshifted CDS 9793..10341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 note possible pseudo, frameshifted CDS 10357..12105 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 12157..12564 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071464.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(12600..12899) product TapY2 family type IVa secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073356.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(12896..13291) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(13300..16827) product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(16832..17272) product pilus assembly PilX N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(17277..18251) product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(18256..18801) product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925904.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene pilV CDS complement(19057..20010) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073362.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene ispH CDS complement(20012..20434) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene fkpB CDS complement(20440..20955) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073364.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene lspA CDS complement(20967..23792) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073365.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene ileS CDS complement(23826..24761) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene ribF CDS complement(24827..26443) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene murJ CDS 26642..26908 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073368.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene rpsT CDS complement(26971..27267) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006084975.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 27403..28806 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(28880..29656) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene yaaA CDS complement(29769..31259) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 31685..34051 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073372.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 34342..35442 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925751.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 35687..36640 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073375.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene tal CDS 36679..38316 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073376.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene pgi CDS 38506..38688 product DUF3545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073377.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(38777..39319) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073378.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(39558..40655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(40643..42652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 42751..43605 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171345.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene nfo CDS complement(43651..44247) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene tpx CDS complement(44352..45176) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(45207..45782) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 46358..46495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(46560..47117) product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 47296..47610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 47792..48121 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene yciH CDS 48149..48709 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073216.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 48723..49142 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene ruvX CDS complement(49259..50389) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074059.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(50400..51134) product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(51307..52320) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene hemH CDS complement(52355..52936) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073219.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(52976..54085) product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(54210..55322) product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073220.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(55332..56369) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 56406..57101 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 57234..58052 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073223.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene proC CDS 58076..58627 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 58627..58914 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073225.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene yggU CDS 58977..59411 product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 59631..60233 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene rdgB CDS 60233..61369 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene hemW CDS 61586..63445 product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(63887..64834) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073231.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(65150..65953) product YggN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(68593..69519) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene glsB CDS complement(69507..69830) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(69853..70569) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene trmB CDS 70741..71847 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene mutY CDS 71850..72128 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073237.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(72365..73732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(74034..75224) product CmlA/FloR family chloramphenicol efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene cml CDS complement(75392..75730) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(75895..76470) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073238.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(76475..77023) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 tRNA 77400..77475 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 77483..77558 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(77832..78950) product general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(78950..80605) product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 80773..82014 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 82242..82508 product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071508.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(82639..83448) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071507.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(83458..84258) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(84275..84772) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene folK CDS complement(84780..85130) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071504.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene folB CDS complement(85039..85221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 85397..86002 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071503.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene plsY CDS complement(86102..87118) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071502.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene tsaD CDS 87315..87530 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080725.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene rpsU CDS 87537..87980 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071501.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 88061..89788 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene dnaG CDS 89922..91769 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071499.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene rpoD tRNA 91950..92026 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 sequence35 source 1..113362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 733..1785 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene rsxD CDS 1804..2439 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072475.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene rsxG CDS 2436..3131 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072476.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 3141..3782 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480814.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene nth CDS 4146..4556 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene gloA CDS complement(4873..5208) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649079.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 5430..6014 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072792.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene sodB CDS 6281..8215 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072793.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 8267..9535 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 9548..11068 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(11171..11962) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(12007..12333) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(12344..13261) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene holB CDS complement(13281..13913) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene tmk CDS complement(13913..14920) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene mltG CDS complement(14917..15756) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene pabC CDS complement(15765..16346) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072565.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene dcd CDS complement(16377..16955) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072566.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene udk CDS complement(17028..18143) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene apbC CDS 18303..20333 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene metG CDS 20485..20910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(20950..21177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 21117..22091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 22088..22621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 22711..23145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 23162..26761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(26863..27009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 27204..29255 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(29549..29956) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(30054..30395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(30495..30638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(30961..31206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(31310..31891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(32297..32602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(32647..32940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(33070..33738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(33849..34706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(34776..35189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(35164..35913) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265531.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(36077..36358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(36686..37282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(37249..37446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(37546..37932) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071955.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(37949..38239) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071954.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(38258..38791) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071953.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(38811..39089) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071952.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(39286..41121) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 41201..41710 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071950.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(41804..42814) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072836.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(42944..43966) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925731.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene sohB CDS complement(44302..46023) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071884.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(46258..46563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071883.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(46844..50401) product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(50412..51302) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(51561..51737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(51883..52953) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071877.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(53114..54970) product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071876.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(54972..55958) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(56047..57096) product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(57298..58554) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 59117..59374 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071872.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(59465..60991) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071496.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(61347..61706) product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(61731..63716) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene betT CDS complement(64068..64661) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071870.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 64851..65234 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071869.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(65390..66094) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene phoU CDS complement(66125..66943) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071864.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene pstB CDS complement(66976..68631) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071863.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene pstA CDS complement(68694..70952) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071862.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 71128..71631 product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071861.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 71762..72580 product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071859.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 72719..73288 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(73368..74339) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 74736..76415 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 76415..76687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 76714..77721 product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 78037..78303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(78278..78442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(78665..78814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(78862..79065) product bacteriocin-like peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074457.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 79732..80157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 note possible pseudo, internal stop codon, frameshifted CDS 80905..81510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(81556..81984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(81978..82508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(82517..83062) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(83197..83391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(83448..83885) product DUF2787 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263376.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(83882..84376) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148675.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene radC CDS 84531..85004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(85065..85271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(85287..85739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(85823..85990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(86103..89282) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(89282..90226) product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(90223..90585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(90945..92315) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(92315..94315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 95369..98041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(98099..99904) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 100148..100918 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 100915..101217 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071888.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(101222..102589) product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(102678..103865) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene nagA CDS complement(103849..104856) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705173.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(104860..106065) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(106070..107344) product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098887.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene kbaZ CDS complement(107352..108722) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(108737..109519) product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423633.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene agaR CDS 109857..112700 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 sequence36 source 1..176909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(739..1353) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073479.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(1350..2798) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073478.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 2998..3381 product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(3433..4674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 4764..5195 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(5221..5784) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(5810..7297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(7294..7842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 8069..8374 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073474.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(8526..8888) product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(9031..9876) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073470.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(9885..10904) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073469.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(10907..11746) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073468.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(11811..12218) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073467.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(12215..12931) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050991313.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(12946..13767) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073465.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 14215..16269 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 16281..16829 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073463.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene hutX CDS 16826..17359 product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073462.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene hutZ CDS 17422..19224 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073461.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(19227..19976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(19973..20581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(20588..21808) product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 22209..22940 product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(22943..24883) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477247.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(25159..26757) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706466.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 27002..30016 product metalloprotease ImpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142775.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene impA CDS 30212..30826 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 30852..32621 product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 32621..34006 product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105551.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 33999..34427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 34447..35085 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105553.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 35082..36005 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105554.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 36105..36962 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071178.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(37012..38043) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071117.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(38155..38517) product DUF4144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071118.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(38621..40291) product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(40608..41645) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071121.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(41767..43083) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(43091..44050) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071123.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene gshB CDS complement(44094..44825) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071124.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene rsmE CDS complement(44844..45584) product endonuclease EndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene endA CDS complement(45695..46264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(46336..47484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071127.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 47751..48620 product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene blaOXA CDS complement(48725..49636) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 49758..54311 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071130.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(54701..55240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(55919..59653) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071290.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene metH CDS 59880..60620 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071291.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 60925..61866 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071292.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 61863..62933 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 62951..64015 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071294.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene cobT CDS 64015..64791 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071295.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 64788..65384 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071296.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene cobU CDS 65381..67108 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071297.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 67098..67712 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene cobO CDS 68645..69586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 69863..70135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(70422..71693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 72904..73788 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479816.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 73895..75004 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479920.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 75001..78099 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479778.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 78099..79574 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479783.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 79680..80987 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457979.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 81001..82653 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457973.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene pqiB CDS 82655..83257 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805968.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(83433..84818) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene dbpA CDS complement(84959..86458) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263049.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 86682..87728 product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073557.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 88069..89937 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073555.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene cydD CDS 89939..91684 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073554.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene cydC CDS 91864..92154 product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 92151..92726 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(92790..94088) product DUF5666 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074230.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 94520..94783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 95014..96243 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(96319..99495) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193378418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene putA CDS complement(99764..100342) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(100470..101738) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073547.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(101766..102446) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073546.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 102679..104163 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073545.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(104312..105109) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(105181..105507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(105514..106164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073542.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(106171..106860) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(106872..107285) product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(107365..109092) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073540.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(109097..109996) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(110028..110978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073538.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 111214..112440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 112502..114169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(114234..115352) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925763.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene zapE CDS 115537..115878 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070807.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 115979..116800 product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073531.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(116853..117767) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073530.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(117879..119399) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703251.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene norR CDS complement(119484..121757) product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 122272..123996 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073529.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(124048..124971) product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073528.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 125078..126508 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073527.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene hldE CDS 126508..127335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073526.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 127491..127970 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073525.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(128158..130377) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071223.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(130559..131176) product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071224.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(131341..134490) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(134490..135671) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(135986..137350) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071227.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene srmB CDS complement(137384..138115) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071228.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 138691..140100 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925629.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene brnQ CDS 140274..141188 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene xerD CDS 141376..142104 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene dsbC CDS 142191..143915 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071232.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene recJ CDS 144050..144364 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(144459..145115) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene rpiA CDS 145405..146358 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071383.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(146435..146956) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071442.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(147169..147627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(147678..148439) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071077.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(148563..148871) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene zapA CDS 149124..149717 product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071079.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 149785..151056 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071080.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene ubiH CDS 151059..152270 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071081.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 152520..153614 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071082.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene gcvT CDS 153638..154027 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene gcvH CDS 154142..157030 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071084.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene gcvP CDS 157601..158053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 158043..158492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 159283..160392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 160819..162492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 163080..164348 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 165103..167019 product decaheme c-type cytochrome MtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071903.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene mtrF CDS complement(167016..167291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(167237..168169) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074143.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 168348..169637 product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 169697..170278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(170394..170630) product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073163.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 171109..171393 product type VI secretion system PAAR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262395.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 171490..172071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 172163..172750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 172754..173836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 174077..174412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 174478..175068 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(175132..176376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 sequence37 source 1..102942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 68..649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(826..1125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 tmRNA complement(2067..2421) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(2537..3022) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene smpB CDS 3230..3667 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 3657..3992 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071663.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(4076..4573) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071664.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene bamE CDS 5058..6827 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071668.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(7193..8479) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072025.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 8892..9287 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene sdhC CDS 9281..9628 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072027.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene sdhD CDS 9629..11395 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072028.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene sdhA CDS 11408..12115 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072029.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 12310..15132 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072030.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene sucA CDS 15163..16359 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072031.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene odhB CDS 16437..17603 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072032.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene sucC CDS 17603..18475 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647520.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene sucD CDS 18981..19394 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene rnk CDS 19486..19767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(19822..20253) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072035.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene fur CDS 20514..21248 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072036.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene cobB CDS 21248..21721 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 22080..24113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(24226..25542) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072680.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene bioA CDS complement(25606..25827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 25717..26781 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene bioB CDS 26783..27922 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072678.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 27919..28710 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072677.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene bioC CDS 28745..29437 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072676.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene bioD CDS complement(29484..30194) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072673.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene pepE CDS 30481..31344 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072672.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene htpX CDS 31652..31999 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072671.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(32097..32747) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 33082..33330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(33595..35349) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 35589..35945 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072667.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene hinT CDS 35942..36442 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072666.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 36439..36891 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 36909..37298 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072664.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 37611..39803 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 39867..40127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 40131..40781 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene pnuC CDS 40778..41896 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072657.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 41949..42794 product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072656.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 43071..43682 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 43783..44331 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072654.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(44399..45139) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(45152..45760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 46100..46723 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(46805..47692) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 47909..49165 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418817.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 49482..50096 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072768.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 50141..50596 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072767.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 50652..51056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072766.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 51109..51516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 51813..52457 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 52447..53523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 53510..54673 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095131.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 54670..55890 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 55887..57134 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 57367..59580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 59580..60098 product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706558.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 60353..63190 product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071959.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(63281..64174) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072827.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(64221..64589) product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072826.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene folX CDS 64657..65736 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 65764..66690 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(66684..66908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073826.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(67472..68542) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 68778..70691 product siderophore amonabactin TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 71055..71567 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073170.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene tadA CDS complement(71542..71661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(71803..73251) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073169.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene mltF CDS 73539..77423 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073168.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene purL CDS 78601..80175 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073167.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 80192..81331 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073166.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene cydB CDS 81519..82148 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071822.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 82649..83326 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925667.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene ompW CDS complement(83427..84191) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071824.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 84291..84704 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 84756..85700 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071826.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene metA CDS 86063..87244 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 87370..88863 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 88987..90144 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 90182..90955 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071830.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 90968..92080 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 92122..93021 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071832.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene mmsB CDS 93032..93787 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 93892..94068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 94171..94392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071834.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 94459..96516 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071835.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(96522..96920) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071836.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 97111..98385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 98382..100274 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071837.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 100559..100945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 101174..102742 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071838.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 sequence38 source 1..30279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(810..1889) product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene caiA CDS 2295..2942 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(3067..4386) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183207.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(4744..5031) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(5028..6320) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(6381..7331) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032189.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(7342..8115) product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 8649..9755 product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 9883..11403 product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787109.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene caiT CDS 11466..12608 product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene caiA CDS 12728..13954 product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene caiB CDS 14028..15584 product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene caiC CDS 15818..16603 product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene caiD CDS 16667..17257 product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene caiE CDS 17283..18224 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(18383..18844) product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071094.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene traF CDS complement(18847..21015) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071095.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(21236..21928) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925810.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene yjjG CDS 22233..23003 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(23045..24109) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(24102..25037) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070726.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(25149..26444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 26668..27291 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070724.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene gmk CDS 27351..27632 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene rpoZ CDS 27658..29766 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070723.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene spoT CDS 29789..30172 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 sequence39 source 1..67201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 note possible pseudo, internal stop codon CDS complement(791..2050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(2098..2559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 note possible pseudo, frameshifted CDS 3247..3525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 3529..3945 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 4001..4741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072727.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 4852..5202 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 5237..5581 product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 5591..5824 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072725.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(5957..7621) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072704.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene asnB CDS complement(7943..9589) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072703.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(9721..10467) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072701.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(10779..11423) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene purN CDS complement(11423..12460) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072699.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene purM CDS 12721..13347 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072698.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene upp CDS complement(13440..13769) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478614.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(13781..14170) product multidrug transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478736.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(14370..15299) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455215.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(15599..16948) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706420.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 17162..18046 product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 18166..19086 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925869.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 19227..20627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(20645..21211) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(21226..21735) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072219.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 21790..21978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 21982..22842 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 22844..24373 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(24406..24639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(24766..25164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(25189..25623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072732.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 25759..26466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925885.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(26504..26872) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 26890..27087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(27137..27493) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072730.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(27748..28644) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072724.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene cdd CDS complement(28734..29900) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene sbcB CDS complement(29845..30249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 30433..31233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072722.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 31276..32079 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene rlmA CDS 32333..32542 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(32929..33615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(33736..34347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072461.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 34454..35044 product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072460.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene smrA CDS 35156..35803 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072458.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 35814..38090 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 38101..38385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(38266..39705) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072456.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene pyk CDS complement(39892..40746) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072455.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 41062..42534 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072454.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene zwf CDS 42544..43248 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene pgl CDS 43258..45084 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene edd CDS 45104..45745 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(45770..45994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 46245..46661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(46735..46959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(46975..47712) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene kdsB CDS complement(47781..48851) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(48872..50059) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(50297..50908) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072441.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene can CDS complement(51012..51845) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072440.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(51973..52698) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072439.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(52702..53823) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072438.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene dapE CDS complement(53832..54182) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 55230..56195 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464323.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 56209..56682 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464370.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 56686..58203 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883967.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 58190..59899 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706287.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 59874..60596 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857631.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(60737..61246) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072253.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene crr CDS complement(61350..63053) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene ptsP CDS complement(63065..63322) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072255.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(63402..63797) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072256.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(64171..65805) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072257.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 66213..66818 product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072258.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 sequence40 source 1..56826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(224..299) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(309..382) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(418..502) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(511..586) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(605..680) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 CDS 914..1861 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070603.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene coaA CDS complement(1862..2821) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070602.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene birA CDS complement(2824..3714) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070601.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene murB CDS complement(4150..5583) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(5580..6908) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(7036..7326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 note possible pseudo, internal stop codon CDS complement(7519..7875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 8206..10308 product diguanylate cyclase PdgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074159.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene pdgA CDS complement(10487..10984) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(11530..12378) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 12721..13887 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925604.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(13963..14916) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074142.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 15205..15378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 15546..15866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(15898..16776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(17025..17942) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(17935..18102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 18120..20096 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074140.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 20271..21797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(21894..22238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 22553..23095 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073854.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(23092..23961) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262232.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 24154..25311 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939476.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(25522..26379) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene rpoH CDS complement(26551..27516) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074182.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene ftsX CDS complement(27520..28212) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074183.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene ftsE CDS complement(28216..30060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 30286..30873 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074185.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene rsmD CDS 30870..31172 product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074186.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(31163..31645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070674.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(31693..32028) product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(32047..32751) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074088.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 32899..33687 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 33703..33933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 34069..34809 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 34809..36116 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477098.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(36327..37535) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 37649..38608 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074162.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(38633..40507) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707132.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 40798..41097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(41094..42506) product DUF4145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074165.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(42554..43252) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074166.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 43440..43970 product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074167.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 44140..44595 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(44644..45861) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074171.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene yjeH CDS 46051..46476 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074172.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(46671..46961) product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072671.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(46984..47925) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074173.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene nrfD CDS complement(47922..48605) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene nrfC CDS complement(48618..49037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(49154..49618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 50020..50979 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071812.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 51119..52840 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074176.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene menD CDS 52885..53628 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074177.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene menH CDS 53628..54671 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074178.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene menC CDS 54725..56152 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074179.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene menE CDS complement(56135..56761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 sequence41 source 1..96822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 459..608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(696..1607) product hydrogen peroxide-inducible genes transcriptional activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071537.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene oxyR CDS complement(1864..2229) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071536.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(2378..3298) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071535.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 3800..8248 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071534.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene gltB CDS 8255..9661 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071533.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 9872..10564 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071532.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 10585..11574 product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071531.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 11633..12019 product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 12019..12642 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071529.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 12639..13118 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071528.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 13213..13644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(13748..14944) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene tyrS CDS 15069..16469 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 16484..17593 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071524.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 17743..18120 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 18179..18598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925841.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(18661..19011) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071517.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene erpA CDS complement(19004..19807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071516.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 19938..21590 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 21715..22734 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 22764..24047 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071513.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene hemL CDS 24525..25775 product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147723.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene nhaD CDS complement(26132..27424) product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(27638..28783) product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(28875..30020) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073344.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene nagA CDS complement(30070..31068) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073345.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(31065..32012) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073346.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(32461..35163) product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073347.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 35787..36473 product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073348.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(36640..37995) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071463.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 38348..38500 product trimethylamine N-oxide reductase system protein TorE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071462.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene torE CDS 38519..39697 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071461.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene torC CDS 39710..42199 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071460.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene torA CDS 42231..42860 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071459.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene torD CDS complement(43091..45961) product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071458.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene torS CDS 46065..47171 product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071457.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene torT CDS complement(47161..47871) product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071456.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene torR CDS 48019..48387 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(48469..49809) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071454.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene radA CDS 50001..52415 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071453.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(52382..53197) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071452.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(53394..54371) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene serB CDS 54453..55511 product AhpA/YtjB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071450.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(55620..56330) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071449.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene deoD CDS complement(56407..57624) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071448.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(57626..58966) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071447.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene deoA CDS complement(59110..59883) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071446.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene deoC CDS complement(60273..61136) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071445.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(61420..62703) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071444.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(62892..63692) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925838.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(63918..65501) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456063.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene prfC CDS complement(65601..66500) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071440.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene nlpI CDS complement(66654..68756) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071439.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene pnp CDS 68960..71014 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071438.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(71142..71411) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071437.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene rpsO CDS complement(71512..72459) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071436.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene truB CDS complement(72459..72872) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071435.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene rbfA CDS complement(72930..75587) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071434.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene infB CDS complement(75612..77111) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071433.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene nusA CDS complement(77139..77564) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071432.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene rimP tRNA complement(77769..77845) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(77928..78014) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 CDS complement(78025..78330) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071431.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene secG CDS complement(78332..79114) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene tpiA CDS complement(79297..80628) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071429.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene glmM CDS complement(80733..81569) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071428.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene folP CDS complement(81683..83638) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925641.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene ftsH CDS complement(83692..84321) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071426.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene rlmE CDS 84412..84711 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071425.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene yhbY CDS complement(84828..85715) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071424.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene secF CDS complement(85729..87564) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071423.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene secD CDS complement(87684..88250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925837.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(88358..88834) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071421.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene greA CDS complement(89079..92003) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131708.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(92179..95400) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071375.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene carB CDS complement(95424..96467) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071374.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene carA sequence42 source 1..16872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(7..94) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA complement(142..218) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(267..343) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 CDS 718..2847 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071965.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene rlmKL CDS 2840..3070 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071966.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 3072..4985 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071967.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 5014..6855 product DUF3466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071968.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 7038..7214 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071969.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene rmf CDS complement(7311..7826) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071970.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene fabA CDS complement(7903..9507) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071971.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 tRNA 9713..9803 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 CDS 11250..12443 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072337.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(12523..13425) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 13574..14401 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 14379..15008 product DUF2987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072340.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(15167..15652) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(15693..16163) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704430.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 16597..16824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 sequence43 source 1..91161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(637..2325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(2347..2625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 2899..3195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 4656..5834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(6525..8477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(8474..9754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(10138..11715) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073171.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene guaA CDS complement(11819..13285) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073172.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene guaB CDS 13403..14746 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073173.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene xseA CDS complement(14933..16399) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073184.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene der CDS complement(16479..17666) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073185.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene bamB CDS complement(17676..18302) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073186.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(18315..19592) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073187.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene hisS CDS complement(19711..20823) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073188.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene ispG CDS complement(20887..21804) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene rodZ CDS complement(21804..22577) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene pilW CDS complement(22622..23743) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073191.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 23946..25022 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073192.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 25122..26942 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073193.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(26889..27038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(27101..27994) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 28133..28576 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 28701..29393 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(29468..29977) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073196.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(29974..30507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(30634..30933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073198.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(31027..31242) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(31469..31933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 32602..33345 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073201.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 33305..33709 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925745.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(33706..33876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 33888..34712 product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 34823..35365 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073206.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(35345..36790) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073207.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(37027..38349) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071671.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene aceA CDS complement(38422..40032) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071670.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene aceB CDS 40766..43192 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071669.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 43687..44742 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 44764..48012 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 48009..51080 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072022.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 51194..52093 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 52157..53524 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113486.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 53566..54330 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461015.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 54714..57008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106396.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(57111..60056) product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480358.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(60522..61247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662421.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(61523..61702) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072733.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(61707..62720) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072734.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene lpxK CDS complement(62721..64520) product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072735.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene msbA CDS complement(64554..66542) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 67010..67489 product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(67656..68915) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072271.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene lolE CDS complement(68912..69607) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925702.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene lolD CDS complement(69621..70853) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072269.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 70950..71546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072268.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 71600..75064 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072267.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene mfd CDS 75064..76194 product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072266.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(76195..76467) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072265.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(76771..77331) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072264.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene ycfP CDS complement(77414..78457) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072263.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene nagZ CDS 78727..80103 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072262.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(80302..81174) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261023.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene rfbA CDS complement(81174..82271) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481408.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene rfbB CDS complement(82431..83315) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene galU CDS complement(83378..84853) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(84847..85413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(85806..86972) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(86997..87551) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261052.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(87561..88466) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950643.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(88520..89659) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073061.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(89649..90653) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481622.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(90686..91126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 sequence44 source 1..85939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..1474) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074321.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene ccoG CDS 1724..2077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074322.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 2188..3090 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074323.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 3223..3426 product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074324.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(3484..5313) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074325.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene glmS CDS complement(5338..6108) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(6339..8429) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074327.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(8611..9975) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074328.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene glmU CDS complement(10129..10557) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074329.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(10594..11982) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074330.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene atpD CDS complement(12018..12878) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074331.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene atpG CDS complement(12929..14470) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074332.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene atpA CDS complement(14485..15018) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074333.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene atpH CDS complement(15034..15504) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074334.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene atpF CDS complement(15542..15793) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083840.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene atpE CDS complement(15860..16654) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene atpB CDS complement(16667..17050) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074336.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(17276..18157) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074337.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(18168..19007) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(19043..19666) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074339.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene rsmG CDS complement(19767..21656) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074340.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene mnmG CDS complement(22107..22547) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070417.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene mioC CDS 22696..23547 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747834.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(23719..25284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(25703..26098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 note possible pseudo, frameshifted CDS complement(26095..26535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(27411..28298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(28310..29017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(29054..29536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(29539..29880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(29881..30756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(30762..31616) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(31613..33331) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(33341..34645) product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064054.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(34657..35589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(35601..35852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(35852..36508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(36508..37407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(37404..39044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(39192..39782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(39870..40148) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812728.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(40271..40873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 41013..42458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(42945..44288) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070419.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene mnmE CDS complement(44387..46012) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070420.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene yidC CDS complement(46237..46593) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070422.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene rnpA CDS complement(46612..46749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 47285..48577 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070424.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene dnaA CDS 48593..49693 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070425.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene dnaN CDS 49713..50795 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070426.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene recF CDS 50887..53229 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070427.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene gyrB CDS 53360..54412 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070429.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(54467..56536) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070430.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene glyS CDS complement(56547..57452) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene glyQ CDS 57562..58125 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070432.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 58118..58474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(58528..61704) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(61805..62275) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(62299..62544) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070435.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene tusA CDS complement(62878..64041) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070436.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene fadA CDS complement(64063..66213) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070437.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene fadB CDS 66453..67772 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070438.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene pepQ CDS 67765..68379 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070439.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 68432..69901 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 69901..70428 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070441.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene hemG CDS complement(70696..71001) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070442.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 71230..71769 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene hemG CDS 71918..72451 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422431.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene speG CDS complement(72458..73900) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070444.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(73911..75320) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070445.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene trkA CDS complement(75330..76628) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070446.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene rsmB CDS complement(76625..77578) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070447.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene fmt CDS complement(77606..78115) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070448.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene def CDS 78242..79342 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070449.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 79663..80442 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925584.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene dprA CDS 80445..80921 product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070451.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 81380..81943 product topoisomerase DNA-binding C4 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070452.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 82026..82589 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070453.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 82615..83529 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070454.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene hemF CDS complement(83563..84096) product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 84119..84940 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070456.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene aroE CDS 84937..85209 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704275.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(85215..85766) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 sequence45 source 1..167959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(157..495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(1082..1696) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070594.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene fabR CDS 1840..2946 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 3079..4122 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070592.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene selD CDS 4119..5234 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070591.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene mnmH CDS complement(5321..7192) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(7183..7797) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070589.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(8046..9401) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074290.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene gorA CDS complement(9530..10006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074289.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(10147..10854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 11217..13256 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene prlC CDS 13332..13901 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(13910..14563) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074285.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 14949..15638 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074284.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(16335..18443) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(18446..19876) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 20109..20921 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 20918..21625 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074306.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 21634..22341 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074307.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 22325..22918 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene mobA CDS 22928..24733 product bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074309.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 24742..25728 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074310.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene moaA CDS 25783..26241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074311.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 26258..27073 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074312.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene mutM CDS complement(27081..28802) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(28802..29449) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074279.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(29478..30278) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074278.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(30408..31901) product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074275.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(31907..32398) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene coaD CDS 32713..33747 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868996.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 33799..34752 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene rfaD CDS 34778..35638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 35656..36432 product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707882.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 36441..37586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(37768..38868) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074270.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(38861..39970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(40089..41135) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074269.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 41221..41937 product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074268.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(41923..43194) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074267.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene waaA CDS 43314..43958 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074266.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 44155..45348 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 45372..46397 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene tdh CDS 46521..46778 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074263.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene glpE CDS 46782..47615 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene glpG CDS complement(47728..48381) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074261.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene elbB CDS 48800..51535 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene polA CDS complement(52189..52872) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074259.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene yihA CDS 53009..53629 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 54028..54282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 54390..55076 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074313.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 55124..55648 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074314.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene yihI CDS 55660..56127 product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074315.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 56516..57856 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074316.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene hemN CDS complement(57920..58915) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074317.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene add CDS 59114..60892 product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 60960..61973 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074319.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(61888..64221) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074320.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(64670..66856) product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071092.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 67225..68415 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704625.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene hmpA CDS complement(68437..69348) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707642.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(69390..69794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(69992..71590) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 72231..72788 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074256.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 72810..73844 product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074255.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 73874..74668 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074254.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 74694..75125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(75289..76146) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074253.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene rlmJ CDS 76278..77036 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074252.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 77172..77696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 77778..78251 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074234.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(78259..80184) product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074229.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(80265..81581) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074228.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene envZ CDS complement(81578..82303) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene ompR CDS complement(82439..83527) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073623.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene modC CDS complement(83521..84219) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073622.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene modB CDS complement(84230..84997) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073621.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene modA CDS 85158..85943 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073620.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 86071..86565 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074226.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene greB CDS 86695..87000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 87010..87240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(87280..87519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 87805..88779 product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074196.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(88786..89583) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074197.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 tRNA complement(90172..90245) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 CDS complement(90344..91591) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074198.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene mtr CDS complement(91591..93960) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene plsB CDS complement(93989..94183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 94280..94900 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074200.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene lexA CDS 94897..95388 product SulA-like leucine-rich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074201.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 95859..96989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 96999..98609 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene ctaD CDS 98611..99174 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 99171..100046 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(100043..100261) product DUF2909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074206.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 100233..100979 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074207.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 101031..101573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074208.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 101573..102556 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 102570..103475 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene cyoE CDS 103479..104126 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074211.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 104231..104548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 104526..104888 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 104910..107000 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 107013..107564 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene cheW CDS 107583..110168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 110179..111051 product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337486.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 111048..112073 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(112063..112971) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 113138..114478 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074213.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(114537..115115) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074215.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene nfuA CDS complement(115310..115705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 116073..116852 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074222.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene bioH CDS 116890..117390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074223.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(117342..119339) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074224.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(119675..122017) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074225.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 122317..124467 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(124651..125667) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070467.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene gpsA CDS complement(125675..126160) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070466.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene secB CDS complement(126366..126800) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070465.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 127030..128571 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070464.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene gpmM CDS 128582..129718 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 129751..130956 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070462.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 131109..131720 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(131721..132173) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070460.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(132183..132437) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070459.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 135387..135929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(136170..136352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 136973..139000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(139014..139883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(139880..141058) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211738.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(141068..141280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 141426..141665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(141766..143583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(143583..145907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(145894..147219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(147392..150703) product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104752311.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(150713..152128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(152140..152634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(152832..153506) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210395.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(153577..153756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(153944..155749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(155864..156121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(156332..156676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(156892..157878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(158002..158907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 note possible pseudo, frameshifted CDS complement(158904..159443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 note possible pseudo, frameshifted CDS complement(159502..160668) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(160665..161894) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 note possible pseudo, frameshifted CDS complement(161891..162217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 note possible pseudo, frameshifted CDS complement(162214..162525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(162564..163466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(163503..163934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 note possible pseudo, internal stop codon, frameshifted CDS complement(164061..166010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 note possible pseudo, internal stop codon CDS complement(166075..167577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 tRNA complement(167881..167957) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 sequence46 source 1..25926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..1138) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071624.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(1153..1524) product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071617.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(1535..3145) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 3325..5079 product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 5054..5665 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071620.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(5670..6038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(6207..7727) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070714.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(7874..8374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(8362..9183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 9494..10312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 10515..10763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 11038..11919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 11916..13706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(13715..14539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 14694..16025 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074008.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(16011..16241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(16267..17139) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074007.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene ilvY CDS 17288..18769 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074006.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene ilvC CDS 19182..20858 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925791.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene ilvG CDS 20855..21112 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074003.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene ilvM CDS 21149..23005 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074002.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene ilvD CDS 23007..24560 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074001.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene ilvA CDS 24688..25818 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 sequence47 source 1..75574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(188..916) product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070759.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(913..2940) product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070758.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(3006..3671) product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070757.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(3802..4569) product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070756.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 4879..5760 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070755.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene prmA CDS 5913..6884 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene dusB CDS 6899..7204 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene fis CDS complement(7452..7907) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032472658.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(7904..8512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 note possible pseudo, frameshifted CDS complement(8484..8693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 9191..9469 product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925808.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(9466..9813) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070702.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 10016..10219 product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070700.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(10222..10434) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(10786..11397) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070698.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(11545..12546) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070697.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(12543..12836) product DUF3630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925591.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(12853..14325) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070695.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(14331..14663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925590.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(14782..15147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 note possible pseudo, frameshifted CDS 15106..15579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 15967..16326 product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 16466..16852 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 16910..17767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070690.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 17836..19896 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868463.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(19893..20090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 20089..20667 product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(20716..21285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925589.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 21621..22583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 22616..22783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(23661..23969) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 24157..24666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 24725..26044 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070681.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene potE CDS 26121..27275 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070680.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 27545..30253 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073740.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(30346..32706) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070679.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(32882..33286) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 33502..34722 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 34879..36528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 36597..36824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 37325..38779 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151129351.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(38871..39221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(39299..39586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(39567..39941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(40554..41816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(42427..43269) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070673.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene rsmI CDS 43358..45187 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070672.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 45196..45522 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070671.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 45619..46212 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070670.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 46209..46778 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070669.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene dolP CDS complement(46814..47689) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070668.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 47812..48702 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925588.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(48760..49773) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070666.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene trpS CDS complement(49773..50459) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070665.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(50463..51131) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070664.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene rpe CDS 51324..51674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070663.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 51759..51947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(51969..52808) product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070661.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(52857..54326) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070660.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(54343..55419) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070659.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene aroB CDS complement(55428..55943) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070658.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene aroK CDS complement(56275..58329) product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070657.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(58351..58869) product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070656.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(58866..59486) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070655.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(59483..60070) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070654.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(60058..61137) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070653.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 61320..63854 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070652.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(63939..65306) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070651.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene argH CDS complement(65372..66595) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070650.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(66630..67535) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070649.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(67547..68329) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070648.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene argB CDS complement(68363..69343) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene argC CDS 69608..70759 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene argE CDS 70904..73540 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070646.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene ppc CDS 73537..74076 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070645.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(74163..75437) product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070644.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 sequence48 source 1..64393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(941..1618) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489362.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(1681..2412) product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073958.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(2412..3140) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463710.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene pnuC CDS 3457..4428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 4665..6014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 6030..6704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(6801..8582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(8579..9688) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292758.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(9673..11883) product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084336.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(11871..12923) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(12990..16667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 17235..17786 product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 17872..18441 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390815.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(18443..19366) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(19540..22746) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(22757..23899) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(23896..25164) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 25247..25435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(25436..25861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925815.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(25931..26107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(26187..26552) product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070857.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 26723..27139 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070856.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene arfB CDS 27299..27742 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125573.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene aroQ CDS 27778..28164 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214627.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene accB CDS complement(28180..28620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(28730..29380) product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071633.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(29431..30111) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071632.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene dmsB CDS complement(30126..32498) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(32671..34665) product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071630.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(34681..35430) product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(36467..36679) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073821.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene rpmE CDS complement(36805..37644) product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 37867..40062 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene priA CDS complement(40117..40794) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463688.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 41086..42831 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073824.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene argS CDS 42835..43404 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073825.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 43631..44155 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073856.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene hslV CDS 44177..45502 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073857.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene hslU CDS complement(45573..49028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(49319..51487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(51540..52256) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766623.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 52546..53118 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070825.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(53258..53686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(53826..54866) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(55017..55877) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070820.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene ubiA CDS complement(55980..58145) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070819.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene uvrD CDS 58485..60128 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705497.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 60203..60427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070795.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(60480..61283) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(61310..63907) product cyclic di-GMP phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070793.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene pdeB sequence49 source 1..162572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..1048) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072841.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene rluB CDS complement(1049..1639) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072919.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene scpB CDS complement(1651..2442) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072920.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(2520..3140) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072921.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(3137..3979) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072922.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 4353..5912 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072924.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 5909..6511 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072925.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 6504..7580 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072926.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene trpD CDS 7577..8965 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072927.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene trpCF CDS 9024..10253 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072928.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene trpB CDS 10250..11053 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072929.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene trpA CDS 11418..12389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 12386..12706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 12703..13062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 13059..13703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 13967..14131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(14122..14421) product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071089.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(14760..17003) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071036.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene katG CDS complement(17307..17753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 18080..18553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(18633..19634) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074276.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(19676..20731) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene ugd CDS complement(21147..22121) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072595.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene cysB CDS 22349..23128 product flagellar motor control protein ZomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072596.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene zomB CDS complement(23367..26006) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072651.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene topA CDS 26344..27678 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072652.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene astB CDS complement(28025..32422) product lipoprotein metalloprotease SslE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034469.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene sslE CDS complement(33301..34560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(34872..35180) product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071934.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 35559..36953 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462594.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(37002..38195) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene megL CDS complement(38325..39458) product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071932.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(39462..40898) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071931.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(40953..41342) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene pspC CDS complement(41335..41568) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene pspB CDS complement(41589..42272) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene pspA CDS 42452..43531 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene pspF CDS 43737..45362 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071926.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 45359..46393 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071925.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 46380..47270 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071924.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 47273..48280 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071923.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 48261..49046 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071922.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 49163..50365 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071921.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 50595..50807 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071920.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 50873..51151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(51269..53128) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene ppiD CDS complement(53337..53642) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene hupB CDS complement(53867..56224) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071918.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene lon CDS complement(56354..57634) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071917.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene clpX CDS complement(57723..58334) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071916.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene clpP CDS complement(58423..59727) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071915.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene tig tRNA complement(59974..60049) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA complement(60059..60135) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 tRNA complement(60203..60279) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 CDS 60518..61372 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071914.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene folD CDS complement(61475..62854) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071913.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene cysS CDS 62999..63493 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 63504..64241 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071911.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(64397..65161) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071910.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 65349..65945 product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071909.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(66009..67679) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071908.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene glnS CDS complement(67843..70137) product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071907.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene feoB CDS complement(70130..70369) product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071906.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 70798..71781 product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 71792..73903 product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071904.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 73923..75854 product decaheme c-type cytochrome MtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071903.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene mtrF CDS 75766..75975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 75953..78136 product decaheme c-type cytochrome OmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071902.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene omcA CDS 78478..80580 product decaheme c-type cytochrome MtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071903.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene mtrF CDS 80891..82870 product decaheme c-type cytochrome MtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071901.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene mtrC CDS 82938..83927 product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene mtrA CDS 83940..86027 product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071899.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 86219..87307 product M35 family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818083.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 87508..88086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 88151..88771 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071898.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 88988..90136 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071897.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 90292..91650 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071896.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 91705..92868 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071895.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 93009..94655 product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071894.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene panP CDS complement(95052..95687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(95946..98402) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073787.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 98608..99960 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(100070..101374) product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072104.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(101524..102528) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene hemH CDS complement(102641..103285) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072102.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene adk CDS complement(103473..104318) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072101.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(104389..106209) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072100.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene htpG CDS 106545..107006 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 107292..107798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(107834..108433) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072099.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene recR CDS complement(108447..108776) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072098.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(108908..111823) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072097.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene dnaX CDS complement(111945..112496) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072096.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene apt CDS 112444..112605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(112592..112987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(113075..113449) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072095.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(114202..114990) product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072093.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(114990..115826) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(115885..116307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072091.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 116564..117553 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072090.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 117743..118021 product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072089.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(118151..120802) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458992.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(121253..123922) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072436.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(124312..124743) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072285.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene ndk CDS complement(124870..125037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(125143..125340) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072283.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene iscX CDS complement(125432..126331) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072282.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene rimK CDS complement(126547..126882) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072281.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene fdx CDS complement(126891..128753) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072280.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene hscA CDS complement(128837..129361) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene hscB CDS complement(129385..129708) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072278.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene iscA CDS complement(129723..130106) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072277.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene iscU CDS complement(130139..131353) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072276.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(131435..131959) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene iscR CDS complement(132094..132915) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene cysE CDS complement(132930..133658) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072273.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene trmJ CDS 133809..134609 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072272.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene suhB CDS 134906..136108 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 136194..136598 product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 136869..137171 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072740.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 137244..137912 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 137899..138249 product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072742.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(138243..138485) product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349130.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 138607..140283 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072746.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 140280..140990 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072747.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene btsR CDS 141125..142567 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(142656..143204) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(143259..144170) product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073004.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(144170..144529) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705627.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(144560..144877) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073005.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(145127..146074) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073006.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene secF CDS complement(146086..147903) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073007.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene secD CDS complement(147954..148286) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073008.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene yajC CDS complement(148315..149439) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073009.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene tgt CDS complement(149589..150626) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073010.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene queA CDS complement(150685..150846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 150991..151584 product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073012.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 151683..152336 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073014.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(152435..152845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073015.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(153236..154456) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073018.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene sstT CDS complement(154598..155494) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073019.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(155570..157087) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479787.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(157172..157645) product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073020.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(157733..158302) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073022.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(158416..159687) product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073023.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 160260..162101 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073024.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 tRNA complement(162492..162567) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 sequence50 source 1..129838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 330..2279 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269419.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(2426..4150) product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(4184..4594) product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(4610..5473) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(5592..6227) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 6527..8563 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072959.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(8574..8765) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300391.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 9272..10450 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072958.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 10586..11353 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074217.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(11514..13037) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 13205..14764 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 14791..16428 product aromatic amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072955.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 16473..16856 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072954.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(17061..18347) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072953.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(18507..18689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 18654..19187 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 19389..19892 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072946.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 19949..21364 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209484.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(21537..22343) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072940.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene xthA CDS complement(22343..22642) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(22642..23187) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072938.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(23283..23750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072822.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(24234..26375) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072821.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene pta CDS complement(26469..27668) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072820.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene ackA CDS 27827..28270 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072819.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene yfbV CDS complement(28272..29012) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072818.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene pflA CDS complement(29070..31352) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072817.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene pflB CDS complement(31382..32263) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211331.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene focA CDS 33206..33418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 33415..34863 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707115.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene panF CDS complement(34946..37594) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072815.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(37899..40793) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(41220..42224) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072814.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(42316..43386) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(43608..44576) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072812.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene cysK CDS 44789..45925 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072811.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 45937..47061 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072810.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(47142..47912) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072808.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene cysZ CDS 48155..51580 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072807.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene smc CDS 51602..52573 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072806.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene zipA CDS 52648..54654 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072805.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene ligA CDS 55012..55497 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072780.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 55789..56997 product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072779.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 57115..57936 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754737.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 57971..58591 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072777.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 59005..59271 product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072776.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 59283..61016 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072775.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 61234..63081 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072774.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 63083..63754 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072773.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(63923..64627) product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072994.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(64620..65183) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072993.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(65497..67116) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072992.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(67110..69158) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(69155..70144) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(70138..70641) product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072989.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(70638..71411) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072988.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 71322..71558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(71582..72538) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072987.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 72782..74092 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072986.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene fadI CDS 74093..76237 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene fadJ CDS complement(76762..77163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(77692..78546) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072937.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene fhuF CDS complement(78537..79412) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013338.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(79409..80470) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211880.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(80467..81516) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211881.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(81513..82637) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211882.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(82703..84871) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925735.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(84894..86786) product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072935.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(86783..87400) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072934.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(87400..88572) product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072933.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 note possible pseudo, frameshifted CDS complement(88557..88745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 note possible pseudo, frameshifted CDS complement(88756..90324) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211877.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 90884..91717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 91714..92658 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071849.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 92655..93650 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 93664..94770 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071851.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(94781..95143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(95439..96290) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261980.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(96440..96898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(96902..97681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(97809..98027) product DUF6500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029304506.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(98060..98422) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477789.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(98514..98858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(98999..99190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(99249..99788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(100109..100624) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072759.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(100629..101066) product DUF3010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072758.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(101114..102469) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072757.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 102701..103648 product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072756.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene rssA CDS 103826..104575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 104785..106902 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072754.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene nrdD CDS 106986..107471 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072753.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene nrdG CDS 107623..107979 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072752.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 108148..108765 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072751.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene ribA CDS 108776..109228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 109173..109700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(109707..110165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(110300..110653) product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072748.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(110832..113201) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073002.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(113745..114128) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073001.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(114138..114353) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(114355..117600) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(117610..118635) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(118861..119577) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(119798..121084) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072995.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(121437..122888) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440098.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene putP CDS 123055..123252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 123269..123862 product lecithin retinol acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072772.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 123928..124557 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072078.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 124724..125662 product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072079.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(125663..126301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072080.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(126373..126732) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072081.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 126942..128153 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925859.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 128290..129174 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 129245..129727 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 sequence51 source 1..37380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2583..2909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(3817..5166) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(5166..5855) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074241.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(5869..6453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 6720..7562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(7669..8799) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071341.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 9059..9625 product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071342.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 9701..10000 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071343.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 10125..10634 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071345.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene luxS CDS 10766..12811 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071346.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 13151..14515 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071347.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 14512..15711 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071348.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 15704..16492 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071349.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 16492..17124 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 17130..17738 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071351.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene nqrE CDS 17784..19040 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071352.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene nqrF CDS 19103..20134 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071353.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 20151..20375 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071354.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene nqrM CDS 20480..21466 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998604.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 21629..22102 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene bfr CDS 22113..22580 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene bfr CDS 22810..24816 product methyl-accepting chemotaxis protein PctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148124.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene pctC CDS 24971..26047 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071357.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene dinB CDS complement(26284..27186) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071366.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 27491..29404 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071367.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene dnaK CDS 29495..30625 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071368.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene dnaJ CDS complement(30809..31204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(31381..33504) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113160.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(33506..34381) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003038884.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(34378..34578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 34825..35619 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071371.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 35781..36398 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071372.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 36503..37276 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071373.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene dapB sequence52 source 1..382256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..837 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_095835446.1:IS110 family transposase locus_tag LOCUS_34570 CDS complement(845..1678) product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267865.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(3858..5690) product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(5717..6349) product YqiJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071585.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 6776..8266 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925648.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 8333..8818 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071583.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 8822..9172 product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071582.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 9199..9450 product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071581.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 9476..9985 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071580.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(10198..11256) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene lptG CDS complement(11253..12365) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene lptF CDS 12604..14112 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene pepA CDS 14579..15205 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478295.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 15298..16335 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 16828..17301 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073281.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 17317..20196 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073282.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 20529..21485 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706425.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 21747..22841 product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071267.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(22842..23375) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707675.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(23386..24561) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 24883..25638 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073410.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 25695..26063 product DUF3019 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925905.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 26063..26776 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073412.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 26796..28073 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073413.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(28060..28371) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073414.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 28522..29049 product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073415.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(29040..30506) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073422.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 30691..31866 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073423.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene purT CDS 31878..32438 product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706246.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene cyaB CDS complement(32440..33393) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073434.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(33415..34029) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073435.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(34088..34861) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene djlA CDS complement(34948..35631) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073437.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(35628..36686) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 36847..39159 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073439.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene lptD CDS 39274..40578 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073440.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene surA CDS 40584..41570 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073441.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene pdxA CDS 41586..42392 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073442.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene rsmA CDS 42452..42832 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073443.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene apaG CDS 42846..43667 product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073444.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 43765..45786 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073445.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 46088..47128 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071182.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 47208..48422 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073561.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 48426..48878 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 tRNA 48991..49067 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 CDS complement(49142..49702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 50075..51076 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704089.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene trpS CDS 51233..51646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(51671..51928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 52265..53800 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 53938..55020 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071377.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(55036..55749) product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073403.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(55739..56377) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073404.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 56516..57118 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073405.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 57170..57589 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(57656..58264) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073626.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(58270..58890) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073627.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 59225..61003 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 61047..61805 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073629.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 62122..62934 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481319.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 63059..63946 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029912.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene uspE CDS complement(63948..64655) product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071075.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene folM CDS complement(64771..64938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 64937..65407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 65394..65957 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(66042..68045) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640133.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(68154..68963) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(69004..69744) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173318.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(69741..70748) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261262.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(70745..71689) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060146.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(72254..72922) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925909.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene ung CDS 73255..73581 product DUF3144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073455.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 73771..74670 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092132.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(74659..75276) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073456.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(75263..75487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 75468..76010 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073457.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 76095..77516 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073458.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 77701..79107 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073459.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene ccoG CDS complement(79157..79726) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844781.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 79949..81565 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073460.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(81629..82153) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073508.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(82166..82708) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073509.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene hemG CDS 83072..84220 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 84286..85116 product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073510.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(85131..85769) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073511.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene cysC CDS complement(85779..87515) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(87517..88932) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707308.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene cysN CDS complement(88932..89840) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene cysD CDS complement(89859..90680) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073514.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene cobA CDS 91064..91975 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478421.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 92047..93519 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073515.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(94067..94828) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073519.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(94821..96527) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073520.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene cysI CDS complement(96560..98323) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073521.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 98809..100335 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707743.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene pntA CDS 100347..101831 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene pntB CDS complement(102052..102180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 102318..103025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(103089..103325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(103448..105637) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070960.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene mrcB CDS complement(105790..108345) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070959.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene hrpB CDS complement(108410..110581) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070957.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 110804..111286 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070956.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene thpR CDS complement(111288..111746) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925827.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(111838..113115) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071165.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene pepB CDS 113280..113984 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071164.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene sfsA CDS 114153..114596 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644947.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene dksA CDS 114623..115534 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925826.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene gluQRS CDS 115648..117033 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024044.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 117035..117523 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071161.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene folK CDS 117601..118395 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene panB CDS 118415..119260 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene panC CDS complement(119252..119419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 119419..119925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071158.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(119927..120697) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073573.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(120694..121632) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073574.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(121759..122289) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073575.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene hpt CDS complement(122297..122938) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073576.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(122935..124317) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073577.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene mpl CDS 124570..127659 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071340.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS 127746..128207 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098815.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(128246..129523) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(129656..130270) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073626.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(130281..130895) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073627.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(130944..132677) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459855.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(132720..133394) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261438.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 133692..134402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 134635..135972 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071333.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 136072..136746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 136773..137519 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071331.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(137795..139405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071222.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(139531..140040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071221.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(140033..140779) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071220.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 141206..142027 product cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925828.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 142038..142580 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071218.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(142584..143189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(143182..143970) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071220.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(144081..145487) product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene nhaD CDS complement(145756..146493) product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(146799..147266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 147366..147791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(147955..149022) product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071213.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene fba CDS complement(149137..150312) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(150400..151416) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071211.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene epd CDS complement(151548..153542) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482487.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene tkt CDS 153988..155139 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071209.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene metK CDS complement(155204..155533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071207.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(155560..156096) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925627.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 156226..157179 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071205.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 157300..158166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(158221..158388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 158519..158938 product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071203.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(159000..160322) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS 160620..161069 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(161072..162367) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705996.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(162383..163696) product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071199.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(164115..166676) product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071198.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 166909..167445 product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071197.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene yjjX CDS complement(167372..167617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 167637..168638 product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071196.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(168644..169033) product DUF3718 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073446.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(169167..169649) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene folA CDS complement(169673..170143) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073448.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(170140..170901) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073449.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(170925..172091) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073450.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene cgtA CDS complement(172226..172480) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007650346.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene rpmA CDS complement(172495..172806) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073451.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene rplU CDS 173080..174051 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene ispB CDS complement(174163..176736) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073398.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene clpB CDS complement(176833..177546) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073399.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene pgeF CDS complement(177548..178522) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073400.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene rluD CDS 178645..179406 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073401.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 tRNA 179672..179747 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 tRNA 179800..179886 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA 179927..180013 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA 180054..180140 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA 180181..180267 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 tRNA 180308..180394 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA 180427..180513 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 tRNA 180546..180632 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 CDS 180798..182420 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073402.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(182629..184491) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073602.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 185072..185629 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 185626..186147 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073604.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS 186144..187082 product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073605.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(187130..187822) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene rsuA CDS 188111..190210 product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 190341..191135 product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073608.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 191204..191608 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073609.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 191669..192172 product DUF4447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073610.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(192219..192845) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(193072..195567) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072815.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 195821..196639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 196649..197812 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071194.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 197917..198381 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 198607..200295 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073614.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(200347..200784) product DUF3069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073615.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 201085..202905 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073617.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(202928..203632) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073618.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 203908..205053 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073619.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene queG CDS complement(205062..205265) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 205398..205724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(205799..208069) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071112.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene metE CDS 208235..209137 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071111.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(209187..209909) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071110.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(210054..210674) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(210828..212777) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(213212..213559) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(213812..215068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 215216..216154 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071106.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene rihA CDS 216158..217063 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071105.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene rbsK CDS complement(217131..217652) product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120754.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 217861..218328 product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071104.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene azu CDS complement(218581..220737) product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(220874..222067) product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925832.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 222761..223318 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071325.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(223383..224846) product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071324.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene katB CDS complement(225179..225466) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071323.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(225477..225947) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545799.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(225986..226423) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071322.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(226542..229133) product extracellular exonuclease ExeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071320.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene exeM CDS complement(229554..232055) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071157.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 232468..232896 product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071156.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 232915..234351 product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(235587..236252) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071154.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(236464..237069) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 237228..238457 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071152.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene serA CDS 238566..239528 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071151.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene ygfZ CDS complement(239587..240618) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(240707..246010) product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071149.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 246500..247408 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(247393..248760) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071148.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(248788..249012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 249334..249999 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071147.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 249992..252565 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071146.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 252565..253755 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925824.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 254013..254312 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071139.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 254309..256792 product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071138.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene napA CDS 256803..257546 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071137.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene napG CDS 257543..258475 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925622.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene napH CDS 258472..258912 product nitrate reductase cytochrome c-type subunit NapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071135.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene napB CDS complement(259020..259655) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549852.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS complement(259996..262668) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208374.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene acnA CDS 262839..263099 product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(263176..263316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 263412..264293 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071133.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(264306..265175) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene uspE CDS 265283..266479 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(266539..268761) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 268960..269949 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073720.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 270157..270684 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056163.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene ppa CDS 271083..271529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(271745..272995) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073727.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(273722..274411) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071306.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(274416..274775) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071305.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 274983..275873 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071304.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 276241..277446 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072133.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(277547..277984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 278258..279160 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895438.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(279236..279775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 279912..280841 product diguanylate cyclase PdgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071093.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene pdgB CDS complement(280919..282421) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071261.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene lysS CDS complement(282439..283497) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925631.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene prfB CDS 284239..288486 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071257.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene fdhF CDS complement(288573..290156) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071256.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(290334..291482) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071255.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene chrA CDS 292100..292951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 292959..293333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 293330..294040 product response regulator transcription factor ParR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098126.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene parR CDS 294037..295230 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082362.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(295242..296315) product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071254.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene rlmC CDS complement(296449..297636) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(297650..298081) product hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071252.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene ohrR CDS 298195..298611 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071251.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 299208..299627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(299747..301639) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071312.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 301929..303329 product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071250.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 303495..303695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071249.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(303769..305328) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071236.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene ahpF CDS complement(305433..306002) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 gene ahpC CDS complement(306192..307730) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071238.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(307820..308563) product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071239.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 308657..309202 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071240.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(309199..309936) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(310119..311108) product lactate dehydrogenase LdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071244.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene ldhA CDS 311064..311300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(311307..313109) product fumarate reductase flavoprotein subunit FccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071245.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene fccA CDS 313504..313899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071246.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 313896..314414 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 314448..314738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071248.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(314943..315134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(315319..317427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 317636..318313 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073570.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene rluA CDS 318389..318883 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073571.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene asnC CDS complement(319045..322767) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072016.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(323103..324209) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073716.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(324199..325566) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073717.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene lysC CDS complement(325963..326397) product DUF3293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073718.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 326958..327674 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644695.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene arcA CDS complement(328012..330102) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261294.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene fusA CDS complement(330364..331797) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925621.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(331849..332034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 332362..334269 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071174.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 334314..334766 product DUF2390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071173.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(334726..336339) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(336359..336865) product TAT leader-containing periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071170.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 336976..337965 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 337949..338206 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071168.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 338310..339197 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071167.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(339531..340334) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070955.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 340670..341305 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070954.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene crp CDS 341360..341737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070953.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 341718..342392 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070952.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 342392..343723 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070951.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(343816..347274) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070764.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(347298..348083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070763.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(348214..348567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(348935..349735) product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(349819..351279) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070949.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene astD CDS complement(351290..352327) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070948.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene astA CDS complement(352411..353628) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070947.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(353934..354839) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070946.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(354877..356040) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070945.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(356157..358637) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070944.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(358816..359388) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070943.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(359634..360533) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(360759..360950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 360928..361986 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705164.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 362076..362522 product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463932.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 362527..363030 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298503.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 363132..363791 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066621.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 363799..364890 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528508.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 364949..365587 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831317.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 365710..366840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(366885..367337) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070942.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(367337..367966) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene sspA CDS complement(368062..368796) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(368793..370010) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070939.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(370010..370600) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070938.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene petA CDS complement(370979..371902) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070937.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene hflC CDS complement(371906..373045) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070936.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene hflK CDS complement(373081..374388) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070935.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene hflX CDS complement(374409..374684) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070934.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene hfq CDS complement(374771..375697) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070933.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene miaA CDS complement(375690..377552) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070932.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene mutL CDS complement(377560..378885) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070931.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(378872..379354) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene tsaE CDS complement(379393..380877) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070929.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 380992..381165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(381298..381753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070928.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 tRNA complement(381952..382027) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 tRNA complement(382074..382149) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00890 sequence53 source 1..99443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(94..169) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00900 tRNA complement(202..277) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00910 tRNA complement(330..405) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00920 tRNA complement(458..533) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00930 tRNA complement(586..661) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00940 CDS 1552..3564 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072469.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene uvrB CDS complement(3700..4242) product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene rrtA CDS complement(4272..5042) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072467.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene queC CDS 5199..5867 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072466.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene queE CDS complement(5930..6994) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 tRNA complement(7174..7258) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00950 tRNA complement(7291..7375) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00960 tRNA complement(7408..7492) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00970 tRNA complement(7525..7609) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00980 tRNA complement(7642..7726) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00990 tRNA complement(7759..7843) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01000 tRNA complement(7876..7960) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01010 tRNA complement(7993..8077) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01020 tRNA complement(8116..8200) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01030 tRNA complement(8239..8323) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01040 CDS 8449..8937 product VC2046/SO_2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072465.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 9007..9297 product DUF406 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072464.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 9524..11674 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072463.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(11738..12112) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072462.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 12827..13402 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 13544..13894 product DUF3802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072801.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 13919..14284 product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072800.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 14368..15249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 15766..16131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 16230..17177 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072039.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene corA CDS complement(17205..17516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(17640..18899) product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072040.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 18982..19713 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072041.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(19717..21066) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072042.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(21057..21731) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072043.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(21967..22335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072044.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(22454..23206) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071069.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(23313..24137) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071070.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 24262..25092 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072105.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene nadE CDS complement(25138..25614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072106.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 25705..27165 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072107.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(27131..29299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(29586..30614) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072213.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene yejK CDS 30694..30906 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072212.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 31009..32790 product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072211.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 tRNA 32949..33025 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01050 CDS complement(33617..34180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(34347..34562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 note possible pseudo, internal stop codon CDS complement(34788..35441) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071606.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(35486..36760) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705514.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(36757..37092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 37217..38413 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819714.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(38533..39618) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262583.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(39847..42684) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(43342..46176) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 46747..46944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(46997..48175) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(48289..50460) product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene pdsS CDS complement(50457..51149) product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene pdsR CDS 51368..52135 product sortase-associated OmpA-like protein PdsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072226.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene pdsO CDS 52150..54477 product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072227.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 54474..55118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(55110..56135) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072229.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 56298..57887 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925698.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(57976..58827) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202744.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(59138..60031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925870.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(60317..61264) product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072232.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(61285..61719) product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072233.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 61830..62675 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene hdfR CDS complement(62769..63140) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072235.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 63575..64564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 64566..65090 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462468.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(65219..66160) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene ylqF CDS complement(66237..67076) product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072539.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 67295..68212 product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072538.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(68271..69830) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(69970..73461) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072719.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene rne CDS 74050..75015 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072718.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene rluC CDS 75037..75681 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706097.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(75777..76775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS complement(76991..77638) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 77914..78438 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072716.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene yceD CDS 78455..78625 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072715.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene rpmF CDS 78641..79669 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072714.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene plsX CDS 79679..80638 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072713.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 80768..81694 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072712.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 gene fabD CDS 81705..82451 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene fabG CDS 82615..82848 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081231.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene acpP CDS 83041..84279 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072710.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene fabF CDS 84438..84806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072709.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 84877..85356 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072708.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS 85567..86445 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072707.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(86526..89834) product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072729.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(90114..90500) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072728.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 91059..91583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490290.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 91838..92482 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071972.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene uvrY CDS 92573..94402 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071973.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene uvrC CDS 94591..94998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 tRNA 95162..95237 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01060 tRNA 95360..95433 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01070 CDS complement(95644..95910) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071975.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 96042..97592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 98055..98354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(98242..98745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 99043..99330 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072175.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene rplY sequence54 source 1..8323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 522..971 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070600.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(977..1780) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070599.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene murI CDS 1946..3046 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070598.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene trmA CDS complement(3829..4119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 note possible pseudo, frameshifted tRNA complement(5058..5134) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01080 rRNA complement(5175..5285) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA complement(5560..7401) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 56 percent of the 23S ribosomal RNA locus_tag LOCUS_r00030 sequence55 source 1..4982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 382..1107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 1550..2779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 2883..3206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 3243..3563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 3806..4234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 4485..4907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940