COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..153243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(530..982) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene moaE CDS complement(983..1228) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene moaD CDS complement(1221..1709) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene moaC CDS complement(1723..2748) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694398.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene moaA CDS 3088..4023 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene yvcK CDS complement(4077..4733) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene folE CDS 4888..6102 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene moeA CDS 6121..6843 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene moeB CDS complement(6943..8496) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 8586..9497 product L-lysine exporter LysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene lysO CDS 9730..10218 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene ftnA CDS 10239..10739 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene ftnA CDS complement(10768..10926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 11053..11826 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene fnr CDS 11954..12877 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene uspE CDS complement(12953..13774) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene bamE CDS complement(13964..15022) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694402.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene sohB CDS 15204..15788 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(15981..16979) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(17020..17946) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene rbsK CDS complement(18118..18996) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693669.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene rbsB CDS complement(19027..19983) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene rbsC CDS complement(19995..21482) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene rbsA CDS complement(21492..21911) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene rbsD CDS 22304..23677 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 24129..24515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(24842..25174) product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene mazF CDS complement(25174..25410) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392534.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 25587..25799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 note possible pseudo, frameshifted CDS 25832..25993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 26127..26432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 26438..26584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 26642..26800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 26804..27244 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 27244..27966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 note possible pseudo, frameshifted CDS 27942..28421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 note possible pseudo, frameshifted CDS complement(28418..28714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(28711..28953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(28943..29314) product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(29317..30303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(30991..31422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 tRNA complement(31658..31744) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(31984..32901) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(32978..34045) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694193.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene lptG CDS complement(34058..35155) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene lptF CDS 35264..36748 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694194.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(36794..37897) product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q4QNZ0 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene selD CDS 38125..39129 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene gntR CDS complement(39208..40143) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene mdh CDS 40364..40831 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308670.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene argR CDS 40831..41727 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(41797..41982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 42181..42762 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694403.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene rsxA CDS 42764..43360 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene rsxB CDS 43360..46146 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene rsxC CDS 46156..47229 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694177.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene rsxD CDS 47233..47859 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694178.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene rsxG CDS 47859..48599 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 48605..49240 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene nth CDS 49249..50616 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694179.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(50683..51762) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 52059..52646 product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995886.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(52643..53635) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene cra CDS complement(53817..54902) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165590136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene aroG CDS complement(55037..56290) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene lolE CDS complement(56291..56980) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693575.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene lolD CDS complement(57057..58043) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 note possible pseudo, frameshifted CDS complement(58046..58249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 note possible pseudo, frameshifted CDS complement(58317..59258) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(59384..60355) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene cysB CDS complement(60419..61441) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene rluB CDS complement(61486..62109) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 62256..62636 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120800232.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 62633..62935 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969960.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(62986..63828) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694380.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene rsmI CDS 63904..65628 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 65630..65992 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 66008..66592 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 66632..67225 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657657.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene dolP CDS complement(67315..68292) product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene oppF CDS complement(68294..69283) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(69293..70204) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene oppC CDS complement(70218..71138) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene oppB CDS complement(71217..72857) product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene oppA CDS complement(73106..74866) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene ggt CDS complement(75176..77362) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene uvrD CDS complement(77464..78555) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869151.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene rlmM CDS complement(78548..79438) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 79926..80948 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(81004..81930) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene truB CDS complement(81923..82351) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694530.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene rbfA CDS complement(82498..85020) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene infB CDS complement(85037..86524) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691699.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene nusA CDS complement(86546..87001) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657488.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene rimP tRNA complement(87124..87200) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(87283..88008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(88035..89477) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 89893..90696 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027182.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 91255..92466 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 92922..93485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 note possible pseudo, internal stop codon CDS 93504..93791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(93884..95542) product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(95672..95893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 96229..98463 product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(98609..99235) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 99382..99717 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(99838..101778) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693993.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene thrS CDS complement(102006..102656) product GrxB family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216608.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 102809..103678 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 103675..104322 product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211848.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene hxpB CDS complement(104369..105313) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(105322..106077) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693804.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(106077..106790) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 107243..107464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(107772..115031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(115110..120047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 120377..122287 product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 122323..122844 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 122992..124389 product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212052.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 124389..125711 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 125698..126849 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172653834.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 126851..127528 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 127543..128361 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650376.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(128432..129391) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(129521..130135) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene ribE CDS 130216..131610 product sodium-coupled multidrug efflux MATE transporter HmrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693623.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene hmrM CDS 131620..132666 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 132797..134974 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(135030..135317) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene rplY CDS 135550..136158 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 136167..136442 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882652.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(136612..139083) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109063995.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene torA CDS complement(139332..140456) product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025298411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 140731..141534 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663264.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene xthA CDS 141652..142638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 142897..143760 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693846.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene tesB CDS 143769..144647 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(144682..144981) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(144991..145269) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(145344..146435) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(146462..147265) product lipooligosaccharide biosynthesis galactosyltransferase LsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995797.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene lsgF CDS complement(147265..148149) product lipooligosaccharide biosynthesis N-acetyl-glucosamine transferase LsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694185.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene lsgE CDS complement(148142..149329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(149329..150102) product lipooligosaccharide biosynthesis galactosyltransferase LsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694186.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene lsgD CDS complement(150118..151299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(151289..152281) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 152396..153178 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 sequence02 source 1..85764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..1217) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215592.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(1260..2000) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene pxpA CDS complement(1987..2919) product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(2916..3566) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene pxpB CDS complement(3746..5122) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216605.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(5272..6153) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene metF CDS 6342..8372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 8528..9898 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene yegQ CDS 10282..13722 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene putA CDS 13740..15239 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene putP CDS 15381..16472 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene queA CDS 16526..17734 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene tgt CDS 17727..18239 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 18441..18740 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene yajC CDS 18775..20625 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene secD CDS 20636..21604 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene secF CDS 21794..23986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 24036..24338 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629736.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene trpR CDS 24421..25041 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene mtgA CDS 25054..25806 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(25861..26952) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694357.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(27810..28337) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142963.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 28382..28882 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212098.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene tssB CDS 28908..30389 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene tssC CDS 30394..30843 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene tssE CDS 30853..32616 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene tssF CDS 32580..33617 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene tssG CDS 33648..34448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 note possible pseudo, frameshifted CDS 34384..35751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 note possible pseudo, frameshifted CDS 35752..37167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 37158..37421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 37994..38578 product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207608.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 38750..39094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 39024..39299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 39292..40260 product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene yclO CDS 40251..41024 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948720.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 41039..41635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 note possible pseudo, frameshifted CDS 41703..41954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 note possible pseudo, frameshifted CDS complement(42022..43122) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(43153..43986) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(43988..44743) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898777.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(44940..46289) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(46315..47415) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene ugpC CDS 47572..48288 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 48275..49342 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(49407..50894) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(51167..51901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(51960..53318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 note possible pseudo, frameshifted CDS complement(53340..53882) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene apt CDS complement(53964..54920) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene lpxM CDS complement(54931..55695) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(55711..56568) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene mepA CDS complement(56565..57647) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene aroC CDS complement(57669..60980) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene mscK CDS complement(60982..62394) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene menE CDS complement(62406..63050) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648714.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene seqA CDS 63130..63915 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653834.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 64042..64329 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene ybfE CDS 64332..64859 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648709.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene fldA CDS 64889..65329 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene fur CDS complement(66105..69122) product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(69133..70197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 70488..71291 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693174.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 71310..71858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(71913..72947) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655985.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene bioB CDS complement(72987..73640) product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene thiQ CDS complement(73717..75360) product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene thiP CDS complement(75324..76328) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene thiB CDS 76577..76816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 76783..79566 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693853.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene glnE CDS complement(79563..80819) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene pepT CDS 81022..82137 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene potA CDS 82124..82984 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene potB CDS 82984..83751 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650699.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene potC CDS 83889..84965 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 85327..85734 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 sequence03 source 1..80894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 note possible pseudo, internal stop codon CDS complement(388..1059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 note possible pseudo, internal stop codon CDS complement(1117..3153) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene uvrB tRNA 3544..3619 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 3783..4754 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(4821..5858) product zinc transporter permease subunit ZevB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene zevB CDS complement(5849..6493) product zinc transporter binding subunit ZevA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694310.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene zevA CDS 6843..8513 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650218.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene ettA CDS complement(8695..10254) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene guaA CDS complement(10286..10630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(10662..12125) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene guaB CDS 12308..13240 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene birA CDS complement(13326..14156) product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(14295..14633) product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(14871..16298) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene hldE CDS 16608..17366 product lipid A biosynthesis lauroyl acyltransferase HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693550.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene htrB CDS complement(17452..18018) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(18018..18656) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(18661..19110) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263065.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(19167..20087) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(20133..21578) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene modF CDS complement(21646..22845) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050845826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene sstT CDS 23236..23670 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032823702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 23753..24010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(24651..25364) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene arcA CDS complement(25590..25733) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208618.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene ykgO CDS complement(25743..26009) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217400.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 26260..27975 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(28089..28412) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693835.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene trxA CDS complement(28536..29531) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693834.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(29550..30659) product methionine biosynthesis PLP-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 tRNA 30983..31058 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 31070..31143 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 31174..31260 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(31751..32353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 32522..32755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 32909..33463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(33757..34287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(34291..35409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(35443..35760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(35747..37432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(37490..38524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(38902..39351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(39676..40062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(40040..40258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(40393..40743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(40740..47465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(47504..49195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 note possible pseudo, frameshifted CDS complement(49229..50956) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 51112..51336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 note possible pseudo, frameshifted CDS 51450..51923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 note possible pseudo, frameshifted CDS 52298..52603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 53133..53762 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene lolB CDS 53762..54655 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene ispE CDS 54707..55654 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(55761..57185) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene miaB CDS 57382..58554 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(58625..59455) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene cpdA CDS complement(59597..60229) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013526508.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene nudF CDS complement(60344..60751) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene psiE CDS complement(60778..61464) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(61464..62603) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693818.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene dapE CDS complement(62619..62966) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(63156..64433) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene thrC CDS complement(64436..64813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(64921..65070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(65076..66095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(66113..67057) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene thrB CDS complement(67067..69514) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene thrA CDS 69816..70520 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 70606..71013 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene gloA CDS 71108..71755 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene rnt CDS 71809..73167 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 73275..73856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(73930..75150) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene fabB CDS 75308..77338 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene mnmC CDS complement(77397..79448) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694519.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene metG CDS 79640..80764 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene apbC sequence04 source 1..15852 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..413) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rpsO CDS 587..1681 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 1805..3181 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 3194..4330 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649699.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(4512..5519) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene ruvB CDS complement(5533..6147) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene ruvA CDS complement(6234..6794) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene ruvC CDS complement(6870..7610) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649034.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(8063..8506) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene nudB CDS complement(8725..9258) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(9391..11169) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene aspS CDS complement(11257..11553) product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277238.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(11554..11853) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 12036..12761 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694346.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene cmoA CDS 12761..13105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(13212..14399) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 15123..15299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 rRNA complement(15633..15743) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence05 source 1..516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence06 source 1..204684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(757..2448) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817267.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene treC CDS complement(2459..3877) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene treB CDS 4025..4192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(4398..4580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(4679..5623) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210106.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene treR CDS complement(5656..6153) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene folK CDS complement(6150..7424) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene pcnB CDS complement(7772..8209) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene dksA CDS 8594..10042 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(10079..11392) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173274.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene argA CDS complement(11517..11780) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628952.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 11976..12893 product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693559.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 13004..13543 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene ycfP CDS complement(13585..14193) product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656697.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(14252..14641) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(14646..15845) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(15835..16371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 16495..16908 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694471.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 16905..17591 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694470.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 17593..18945 product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(18960..19295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 19534..20013 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene lrp CDS 20015..22906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 23021..23641 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene lolA CDS 23767..25116 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 25236..26525 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene serS CDS 26782..27864 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032803489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene prfA CDS complement(27927..28865) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694243.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene prmB CDS complement(29131..29643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(29667..30740) product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(31020..31172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(31430..32791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(32833..34854) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(34847..34966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(35002..35337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 35528..36475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 36475..36909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(36910..37323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(37458..37967) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene purE CDS 38243..40858 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene pepN CDS 40935..41957 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene pyrD CDS 42131..42967 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 43072..44136 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 44178..45302 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene tyrA CDS 45480..46391 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene cdd CDS complement(46429..46977) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(46982..47917) product KpsF/GutQ family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012054716.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(48493..48942) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628871.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene matP CDS complement(49099..49395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(49412..49690) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 49826..51589 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826279.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 51828..52361 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene fabA CDS complement(52453..52935) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631703.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene ybaK CDS 53009..53983 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693928.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 54210..55520 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 55650..56714 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167525.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene dinB CDS 56814..57680 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005633091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene htpX CDS 57885..58421 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 58513..59430 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 59430..60197 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 60209..61057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(61078..62448) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586703.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene ppnN CDS complement(62458..63297) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene queF CDS complement(63306..64082) product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 64223..64555 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 64542..65270 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene truC CDS 65540..65968 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene rplM CDS 65985..66377 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rpsI CDS 66605..67243 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650452.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene sspA CDS 67256..67717 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650453.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 68412..68684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 68681..69106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(69243..70664) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene sbcB CDS complement(70669..71541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693980.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(71637..76184) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene mukB CDS complement(76184..76900) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693983.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene mukE CDS complement(76919..78244) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene mukF CDS 78420..78737 product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 78891..79841 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene ttcA CDS complement(79941..80447) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(80524..80820) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211830.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene ihfA CDS complement(80825..83212) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene pheT CDS complement(83246..84235) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene pheS CDS complement(84311..85009) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693879.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 85119..86507 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210648.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene cls CDS 86560..87201 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(87337..88059) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene bioD CDS complement(88125..89348) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 89555..90958 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869177.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene asnS CDS complement(91017..91394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(91387..91572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(91852..93900) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694450.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene recD CDS complement(93900..97535) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694451.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene recB CDS complement(97539..97895) product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(98063..100525) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(100659..102092) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene glgA CDS complement(102167..103474) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005706553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene glgC CDS complement(103490..105523) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene glgX CDS complement(105537..107900) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694003.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene glgB CDS complement(107910..110015) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180978722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene malQ CDS 110216..110602 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(110654..111094) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650678.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 111271..111933 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649826.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 112014..112343 product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 112421..113308 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662662.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 113298..114215 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 114212..115075 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 115062..115892 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666622.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 115905..116801 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(116820..117095) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048236.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene yccX CDS 117270..117929 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 117992..118450 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424187.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene mgsA CDS 118485..120638 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene yccS CDS complement(120720..120938) product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene cspD CDS complement(121170..121337) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628875.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 121416..122420 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(122473..123831) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene folC CDS complement(123824..124723) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene accD CDS complement(124798..125589) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693653.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene truA CDS 125700..126542 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(126586..127071) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene smrB CDS complement(127173..127748) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene ubiX CDS complement(127748..129259) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene purF CDS complement(129272..129772) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(129937..130377) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene yfbV CDS 130593..131858 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene ackA CDS 131924..134062 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694242.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene pta CDS 134433..135101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 tmRNA 135206..135572 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(135843..137501) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene glnS CDS 137733..138899 product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 138916..140850 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 140946..142316 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042593394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(142407..143855) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(143859..145397) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077417416.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 145354..145569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(145736..147160) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene lpdA CDS complement(147245..149143) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704415.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene aceF CDS complement(149195..151858) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003820.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene aceE CDS complement(152255..152755) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene crr CDS complement(152818..154545) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene ptsI CDS complement(154644..154901) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(155122..156177) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene rsgA CDS 156258..156806 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene orn tRNA 156939..157014 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 157030..157105 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(157368..159896) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene topA CDS 160076..160981 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594642.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(161082..162947) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene sppA CDS 163145..163378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 163731..164285 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693567.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(164341..165789) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene thiI CDS complement(165889..166092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 166022..166270 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene xseB CDS 166296..167186 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061724061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene ispA CDS 167397..169121 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650455.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene dxs CDS complement(169305..171248) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694468.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(171352..171666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(171666..171998) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(172074..172598) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 172877..174226 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371412.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 174353..175204 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 175271..176224 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene trxB CDS 176305..178065 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene cydD CDS 178065..179795 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene cydC CDS complement(180286..180756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(180874..181182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 note possible pseudo, frameshifted CDS complement(181154..182026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 note possible pseudo, frameshifted CDS complement(182105..183793) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene fadD CDS complement(183868..184578) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene tsaB CDS complement(184578..186524) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 186688..187176 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 187176..187490 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755879.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(187542..188714) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene nhaA CDS 189113..191383 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene nrdA CDS complement(191651..192478) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene dapD CDS complement(192592..193446) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene kdsA CDS complement(193464..194282) product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(194282..195190) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene prmC CDS complement(195342..197273) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene ftsH CDS complement(197357..197986) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene rlmE CDS 198105..198401 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene yhbY CDS complement(198434..198910) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694444.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene greA CDS 199117..200559 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene dacB CDS 200563..201357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(201434..202303) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(202372..202611) product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 202710..203591 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 203693..204643 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479617.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 sequence07 source 1..145220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..531) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647229.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene ilvN CDS complement(531..2249) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005671546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(2518..4041) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 4589..4993 product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 5064..5900 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene purU CDS complement(5941..8055) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002256351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 8203..8715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(8765..10069) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene hemA CDS complement(10217..10918) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene gloB CDS 10936..11667 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210698.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 11785..13554 product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 13689..14111 product YhcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 14274..15404 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene nrdB CDS complement(15594..15842) product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene yfaE CDS complement(16607..17419) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene dapB CDS complement(17432..18067) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(18067..18579) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(18587..19630) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694465.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene thiL CDS complement(19652..20095) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene nusB CDS complement(20095..20568) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene ribE CDS complement(20906..21820) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694104.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene nagK CDS complement(21862..22602) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 22672..23328 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene ribA CDS 23318..23506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 23493..24083 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 24235..25188 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene accA CDS 25259..26119 product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630043.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene pdxY CDS 26133..27425 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene tilS CDS 27546..31235 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene metH CDS 31327..31686 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 31688..31987 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(32030..33232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(33270..34067) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(34060..35031) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537491.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(35028..35831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(35919..37856) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(38011..38883) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene sucD CDS complement(38885..40051) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene sucC CDS complement(40175..41404) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene odhB CDS complement(41492..44287) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene sucA CDS 44633..45922 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(45972..46691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 47009..47971 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 48048..50684 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067553987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 50761..51186 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 51442..52911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 52967..54385 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(54442..55080) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694389.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(55168..55728) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170957.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(55846..57345) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(57416..59470) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene prc CDS complement(59534..60139) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650069.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene proQ CDS complement(60439..60663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 60858..62132 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667179.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 62095..64740 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 64849..66750 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene parE CDS 66781..67944 product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene nirK CDS 68004..70253 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene parC CDS 70424..71329 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650690.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene cdd CDS 71450..72994 product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 72994..73791 product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 73816..75066 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(75160..75882) product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 75988..76338 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(76322..77212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 77374..78702 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 79749..81911 product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene speF CDS 81970..83292 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene potE CDS complement(83426..84769) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 84964..86535 product AbgT family antimetabolite efflux transporter MtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene mtrF CDS complement(86598..87065) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652786.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene sixA CDS complement(87158..88492) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694655.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene glmM CDS complement(88541..89365) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene folP CDS 89496..90386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(90605..90937) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene grxD CDS complement(91021..91809) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123956445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(91802..92245) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(92258..92839) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(92935..93969) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996514.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene ompA CDS 94406..97546 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 97556..97975 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693476.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 97933..98940 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene hemH CDS complement(99027..100718) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene dld CDS complement(100837..101484) product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460838.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene ompW CDS 101933..102568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648352.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 102568..103113 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655641.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 103123..103581 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655643.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene yciA CDS 103595..103891 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 104006..106612 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209333.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene acnB CDS 107040..108092 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 108174..109289 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 109292..110341 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(110402..111595) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene metC CDS 111754..112356 product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 112737..113741 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660510.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene purR CDS 113972..116611 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693644.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene ppc CDS 116720..117043 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(117110..118498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(118663..120309) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene pgi CDS complement(120733..121818) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693598.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene alr CDS complement(121824..123227) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(123417..124409) product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(124419..125399) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(125396..126124) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(126308..126769) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(126812..127387) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302537.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 127476..129209 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693602.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene argS CDS complement(129649..130362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(130374..131360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 131567..131980 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688532.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(132071..133903) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693865.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene uvrC CDS complement(133974..134741) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene kdsB CDS complement(134741..134950) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072733.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(135021..135911) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693863.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene lpxK CDS complement(136092..137840) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene msbA CDS complement(137901..140345) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693861.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(140507..141007) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694080.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 141572..142372 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826244.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene thiM CDS 142382..143200 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693748.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene thiD CDS 143193..143855 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene thiE sequence08 source 1..42710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3231..4604) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene radA CDS complement(4597..5727) product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 5887..6567 product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 6607..7869 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 7982..8584 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 8602..9849 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 9852..10499 product DUF1919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(10561..11163) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene yfbR CDS complement(11164..12183) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648024.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene degS CDS complement(12251..13381) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene ribD CDS complement(13383..13832) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene nrdR CDS 14066..14788 product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene tehB note possible pseudo, frameshifted CDS 14748..14930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 note possible pseudo, frameshifted CDS complement(15004..15696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(15683..16405) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene modB CDS complement(16420..17184) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene modA CDS complement(17664..17828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(17952..18374) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 18557..18706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 note possible pseudo, internal stop codon CDS 18722..19330 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694183.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 note possible pseudo, internal stop codon CDS 19447..20376 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694223.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 20369..21106 product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene azlC CDS 21106..21435 product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(21469..23811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(24037..25374) product lipooligosaccharide phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene lpt3 note possible pseudo, frameshifted CDS complement(25415..25621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 25869..28142 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene metE CDS complement(28197..29162) product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(29625..30287) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694521.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(30448..31887) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene pyk tRNA 32094..32170 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(32210..32815) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene recR CDS complement(32899..33228) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629464.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 33347..35260 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693718.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 35422..35760 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene secG tRNA 35776..35861 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 36067..36711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 37190..37687 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115308544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(38613..42521) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene hrpA sequence09 source 1..23101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(456..809) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene rplT CDS complement(875..1072) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene rpmI CDS complement(1290..1754) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene infC CDS complement(2097..3236) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene dnaJ CDS complement(3305..5203) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene dnaK CDS 5658..7418 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429263.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 7423..8811 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 8808..9641 product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 9812..10360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 10353..10850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 10948..14145 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(14297..15523) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(15892..18603) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(18675..18866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 19062..19355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(19417..20202) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene znuB CDS complement(20212..21009) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666536.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene znuC CDS 21266..22708 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693760.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene mepM sequence10 source 1..20445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 167..2443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(2686..4161) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339760.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene ubiD CDS 4291..4773 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647965.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene smpB CDS complement(4867..5322) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693397.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(5442..7676) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene copA CDS complement(7721..7933) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(7991..8839) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene fdhD CDS 9112..12168 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602782.1 transl_table 11 codon_start 1 transl_except (pos:9697..9699,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_06810 gene fdnG CDS 12170..13093 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693893.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene fdxH CDS 13086..13772 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 13860..14768 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene fdhE CDS 15224..15922 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631770.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene can CDS 15989..17086 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene purK CDS 17258..18448 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 18594..18785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 19098..19640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 note possible pseudo, frameshifted CDS complement(19664..20371) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 sequence11 source 1..386831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 513..3161 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694321.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene gyrA CDS 3264..3611 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 3851..4354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(4390..5775) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene qseC CDS complement(5777..6442) product two-component system response regulator QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(6462..7112) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene tenA CDS complement(7239..7769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 7869..8987 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 9015..10316 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815452.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(10364..10684) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663537.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene yciH CDS complement(10686..11381) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene pyrF CDS complement(11399..12589) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694286.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene lapB CDS complement(12589..12885) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(12954..13238) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene ihfB CDS complement(13305..14948) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene rpsA CDS complement(15059..15736) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042611231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene cmk CDS 16064..17068 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651072.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 17088..18017 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene arcC CDS 18093..19616 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 19756..20223 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(20274..21146) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(21248..22588) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223213.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene argG CDS complement(22680..23519) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365825.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(23602..24462) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 24650..26239 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene prfC repeat_region 26373..26722 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcacggccatctg repeat_region 26741..29242 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcacggccatctgggagatggccg CDS complement(29432..29725) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene cas2 CDS complement(29735..30748) product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene cas1c CDS complement(30807..31418) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935545.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene cas4 CDS complement(31422..32285) product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene cas7c CDS complement(32289..34091) product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene cas8c CDS complement(34088..34765) product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene cas5c CDS complement(34804..37023) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 tRNA complement(37246..37332) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(37335..37410) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(37674..38222) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694415.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene pgsA CDS complement(38341..41205) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene valS CDS complement(41226..41843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(41833..42009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(42027..42461) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(42461..42904) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 43147..44541 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene fumC CDS 44741..46285 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693976.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene trpE CDS 46295..46876 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 46887..47273 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 47328..48332 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene trpD CDS 48348..48530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 48491..49771 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene trpCF CDS 49793..50989 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene trpB CDS 50989..51795 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene trpA CDS complement(53043..54596) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693773.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene xseA CDS complement(54599..55795) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(55788..56198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(56198..56629) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 56730..57146 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 57197..57781 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene pth CDS 57806..58426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 58449..59540 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene ychF CDS 59899..61209 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(61273..62349) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(62382..63785) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 63842..65548 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 65545..66510 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 66500..67387 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 67396..68454 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 68464..69264 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670537.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(69399..70664) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693240.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(70777..72084) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene purD CDS complement(72105..73709) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693238.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene purH CDS complement(73941..74237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 note possible pseudo, internal stop codon CDS complement(74507..75094) product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(75095..76744) product phosphoethanolamine transferase Lpt6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene lpt6 CDS complement(76752..77492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(77489..78052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(78043..78729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 78962..80842 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 80867..82063 product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 82065..82751 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 82933..83943 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 84221..84787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 note possible pseudo, frameshifted CDS 84829..85344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 85328..86728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 86718..87341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 87338..87778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(88586..90037) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene pntB CDS complement(90050..91579) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene pntA CDS 91866..92582 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996442.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene sfsA CDS complement(92750..93703) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037507.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 93812..94666 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 94899..95090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(95210..95896) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(96054..96389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 note possible pseudo, frameshifted CDS complement(96367..96750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 note possible pseudo, frameshifted CDS 96744..96917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(97035..98663) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 99010..100209 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene tyrS CDS 100385..101314 product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 101333..102784 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896953.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 102841..103089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 103086..103427 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 103522..103998 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene tsaE CDS 104050..105381 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 105390..107363 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene mutL CDS 107363..108289 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693854.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene miaA CDS 108393..108686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 108689..110080 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460360.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene hflX CDS complement(110102..111046) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 111238..112002 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 112012..112878 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707922.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 112872..114785 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene fhuB CDS 114873..115667 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 115728..117746 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 117840..119093 product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490535.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(119151..120020) product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene malM CDS complement(120232..121503) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(121655..122773) product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene malK CDS 123128..124318 product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene malE CDS 124517..125956 product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817306.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene malF CDS 125965..126855 product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene malG CDS complement(127045..129723) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene malT CDS 129899..132295 product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817356.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene malP CDS 132572..134422 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene malQ CDS complement(134466..134786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 note possible pseudo, frameshifted CDS complement(134792..135028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 note possible pseudo, frameshifted CDS 135199..135528 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 135751..137127 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene uhpT CDS 137269..137871 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene uhpA CDS 137873..139384 product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene uhpB CDS 139384..140658 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480243.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(140725..141417) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(141414..142082) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(142092..143813) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene recJ CDS complement(144188..144874) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647404.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene dsbC CDS 145039..146133 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111697003.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene prfB CDS 146176..147684 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050838325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene lysS CDS 147748..148503 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 148620..149408 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649928.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 149478..151457 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694220.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene rnb CDS complement(151536..152624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(153090..154061) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648321.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene epmA CDS 154356..156155 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene frdA CDS 156148..156918 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005639269.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 156931..157326 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648336.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene frdC CDS 157338..157682 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648338.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene frdD CDS complement(157783..159927) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097266.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene rlmKL CDS complement(160060..161079) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene znuA CDS complement(161180..161953) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162627419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene tcdA CDS complement(161953..163071) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112089645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene mltA tRNA 163308..163384 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(163514..163723) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422769.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(163904..165268) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene mpl CDS 165417..166418 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene fbp CDS 166629..168287 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816863.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene ushA CDS complement(168383..169660) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693405.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene murA CDS complement(169677..169934) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(169934..170296) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693407.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(170300..170938) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693408.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene mlaC CDS complement(170967..171470) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693409.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene mlaD CDS complement(171550..172335) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene mlaE CDS complement(172325..173125) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene mlaF CDS 173357..173929 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647563.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene lptC CDS 173913..174425 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene lptA CDS 174435..175160 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene lptB CDS 175164..175733 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene ptsN CDS 175759..176604 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene rapZ CDS complement(176700..178058) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene lysC CDS complement(178245..179501) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene proA CDS complement(179523..180194) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 180340..181152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(181189..182361) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene cgtA CDS complement(182370..183290) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(183479..183736) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene rpmA CDS complement(183757..184068) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626416.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene rplU CDS 184307..185278 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693233.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene ispB CDS 185303..186046 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651413.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(186102..186440) product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 186662..187744 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene serC CDS 187829..188929 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene hisC CDS 188937..190229 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693605.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene aroA CDS complement(190355..191731) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(191753..192769) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829995.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 193013..194311 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene purA CDS complement(194357..195088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(195137..195628) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(195831..196781) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene lacD CDS complement(196815..197975) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene nagA CDS complement(197989..198762) product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene agaR CDS complement(198894..199706) product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(199757..201379) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263807.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(201397..202593) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(202717..203355) product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(203391..204440) product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(204473..204910) product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene agaF CDS complement(204993..205859) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(205849..206619) product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene agaW CDS complement(206639..207127) product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene agaV CDS complement(207142..208302) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(208318..209601) product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263816.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene kbaZ CDS 209864..211432 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 211481..213001 product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263806.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(213067..213855) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene kdgR CDS 214027..214968 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 214979..215614 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693874.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 215802..216077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 216093..216584 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(216544..217368) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 217590..218663 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 218660..219529 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211226.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 219526..220368 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 220408..221493 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981408.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 221678..222988 product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815914.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene agp CDS 223088..224182 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211222.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(224320..224805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(224792..224989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 225264..225449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(225494..226060) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene efp CDS 226095..227108 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene epmB CDS 227202..228404 product opacity-associated protein OapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene oapA CDS complement(228477..229382) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene rdgC CDS 229453..230268 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene proC CDS 230268..231431 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 231452..232345 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694355.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene xerD CDS complement(232872..234101) product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(234127..236157) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224756.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(236159..237151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(237328..238941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(238987..240729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(241093..244110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(244136..245407) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099275.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene wecC CDS complement(245418..246560) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene wecB CDS 246841..247992 product capsule polysaccharide export outer membrane protein CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene ctrA CDS 248004..249137 product capsule polysaccharide export protein CtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene ctrB CDS 249137..249934 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215286.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 249931..250578 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(250638..251279) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(251279..251701) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene queD CDS complement(251694..252377) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene queC CDS complement(252530..252850) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene raiA CDS complement(253203..254570) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(255078..255344) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(255384..255587) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene yacG CDS complement(255580..256209) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869082.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene coaE CDS complement(256954..258183) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 258567..259550 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170493.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene manX CDS 259563..260366 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 260381..261217 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293411.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene manZ CDS 261312..261866 product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 261869..263080 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene manA CDS complement(263139..263603) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene rnhA CDS 263685..264452 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene dnaQ tRNA 264540..264616 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 264636..264712 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(265518..266399) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694428.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene nanA CDS complement(266419..267288) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(267310..267780) product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene nanQ CDS complement(267799..268686) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648623.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(268705..269394) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 269741..271588 product sialic acid TRAP transporter substrate-binding protein SiaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene siaT CDS 271974..272957 product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene siaP CDS 273011..274156 product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 274413..274691 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661211.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene ftsB CDS 274704..275411 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene ispD CDS complement(275462..276835) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene argH CDS complement(276920..277693) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene argB CDS complement(277706..278713) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene argC CDS 278814..279956 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene argE CDS 280066..280305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(280327..281505) product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693305.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene rlmC CDS complement(281506..282549) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene nagZ CDS complement(282558..282926) product DUF1425 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647993.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(282926..283276) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene hinT CDS 283542..284396 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene focA CDS 284645..286783 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene pflB CDS 286907..287248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 287563..287928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 288032..288847 product lipoprotein e(P4) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061724415.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene hel CDS 288981..289721 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694108.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene pflA CDS 289835..290161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(290183..291079) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(291089..291532) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene rimI CDS complement(291532..292023) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene holD CDS complement(292080..292676) product opacity family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(292695..293234) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 293300..293647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 note possible pseudo, frameshifted CDS complement(293613..293795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(293997..294530) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693737.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene dsbB CDS complement(294543..296084) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene nhaB CDS 296217..296942 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene fadR CDS 297016..298563 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 298560..299543 product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 299540..299902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 299874..300422 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 300441..301034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 301043..302566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 302749..305664 product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003754849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(305716..306930) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 307137..308411 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061720832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 308443..310149 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene menD CDS 310165..310920 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene menH CDS complement(311002..312039) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene holA CDS complement(312039..312539) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene lptE CDS complement(312589..315171) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene leuS CDS complement(315318..315695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 315849..316079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(316116..316676) product glucose-6-phosphate 1-dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(316749..317570) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene apaH CDS complement(317575..318426) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene rsmA CDS complement(318511..319464) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162877157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(319552..320094) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene pyrR CDS complement(320237..320875) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693938.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene purN CDS complement(320875..321912) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693936.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene purM CDS 322146..322613 product surface-adhesin protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694109.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(322723..323448) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(323519..324097) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene mutH CDS complement(324218..324706) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828387.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(324909..326255) product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(326506..328164) product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 328375..330171 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668011.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(330233..331009) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686676.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(331010..331396) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694050.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene exbD CDS complement(331406..331852) product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene exbB CDS complement(332018..334069) product TonB-dependent siderophore receptor FetA/FrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene fetA CDS complement(334341..335621) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828395.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(335664..336473) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 336643..338028 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene ffh CDS complement(338101..338502) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(338611..340074) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(340166..342037) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(342170..342388) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene infA CDS 342568..343116 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 343130..344338 product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 344453..345760 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107237.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene pepB CDS 345770..346195 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene ndk CDS complement(346266..347231) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene pfkA CDS complement(347345..348259) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene fieF CDS complement(348259..348852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(348854..349630) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene yaaA CDS complement(349652..350320) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene ung CDS 350602..350985 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene grcA CDS complement(351124..351807) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene artM CDS complement(351807..352478) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene artQ CDS complement(352484..353206) product lysine/arginine/ornithine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(353218..353955) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene artP CDS 354144..355133 product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene dcm CDS 355126..355431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(355412..356200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(356204..357184) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611440.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(357416..358483) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 358557..358907 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene arsC CDS 358988..359299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 359271..359564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(359637..361055) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene glnA CDS 361371..363221 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693211.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene typA CDS complement(363417..364118) product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 note possible pseudo, frameshifted CDS complement(364118..365530) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(365532..366263) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102097.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(366339..367934) product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080316864.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 368226..369755 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene der CDS complement(369827..371017) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694422.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(371075..372385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694421.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(372389..372973) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene dcd CDS complement(372982..373623) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene udk CDS 373894..374934 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 374961..375989 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 376011..378068 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 378081..379130 product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene fbpC CDS complement(379225..380217) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene rsmC CDS complement(380365..380871) product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(380864..381772) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 381926..382261 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(382308..383756) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene tldD CDS complement(383888..385363) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rng CDS 385497..386462 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene cmoB sequence12 source 1..390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence13 source 1..45522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(324..1052) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694044.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1146..2192 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115608061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 2350..4188 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(4246..5532) product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(5642..6289) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene fucA CDS complement(6316..6783) product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene fucU CDS complement(6777..8240) product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene fucK CDS complement(8303..10069) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene fucI CDS complement(10398..11147) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661551.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(11190..11879) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693439.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene deoC CDS 12016..12939 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632797.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene rfaD CDS 13795..14850 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene waaF CDS 14864..15814 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094906.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene rfaC CDS complement(15811..16728) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693153.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene murQ CDS complement(17047..18180) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 18257..19627 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694502.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene glmU CDS 19822..20733 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene mscS CDS complement(20814..21206) product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(21220..22767) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene ppx CDS complement(22777..26799) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(26809..28572) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(28677..30248) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene murJ CDS 30526..30789 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene rpsT CDS complement(30844..31461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 31647..32606 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene serB CDS 32609..32902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 note possible pseudo, frameshifted CDS 32791..33099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 note possible pseudo, frameshifted CDS complement(33139..33858) product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482923.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(33855..35723) product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 35878..36387 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene def CDS complement(36464..37084) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629669.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene fabR CDS complement(37094..37993) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649559.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene oxyR CDS 38132..38866 product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694168.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(38947..39168) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 39298..40017 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene fkpA CDS 40092..40757 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 40757..41137 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694173.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene tusD CDS 41134..41496 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene tusC CDS 41530..41841 product DsrH/TusB family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649577.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 41999..42373 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543325.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene rpsL CDS 42501..42971 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene rpsG CDS 43077..45179 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869011.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene fusA sequence14 source 1..79784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(317..751) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene dtd CDS complement(751..1614) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1590..2087) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694029.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 2262..3761 product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(3858..4130) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(4127..4420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(4479..5597) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647785.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(6015..6773) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene udp CDS complement(6806..7258) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene asnC CDS 7419..8411 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene asnA CDS complement(8775..9269) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760813.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(9287..10027) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 10339..11454 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene carA CDS 11547..12293 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 12358..15552 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene carB CDS complement(15656..16450) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 16684..17682 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene yiaK CDS 17711..18175 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094953.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 18184..18666 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 18663..19943 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647842.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 19965..20954 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647844.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 21016..22467 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985358.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 22513..23373 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693360.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 23367..24062 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669745.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene araD CDS 24222..26219 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene tkt CDS 26480..28420 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268320.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene iolD CDS 28448..29344 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene iolE CDS 29346..30356 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene iolG CDS complement(30403..30765) product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(30821..31105) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005636074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(31210..32664) product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene gnd CDS complement(32710..33069) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077426930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(33071..33379) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(33372..33806) product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693848.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(33856..34554) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132500362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene pgl CDS complement(34603..36111) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694154.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene zwf CDS complement(36167..36973) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694155.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene cysQ CDS complement(37119..39140) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 39283..39702 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene hslR CDS 39848..40717 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene hslO CDS complement(40674..40868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 40918..42534 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene pckA CDS 42718..43035 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631186.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene metJ CDS 43280..43591 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene rpsJ CDS 43608..44237 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632753.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene rplC CDS 44253..44855 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene rplD CDS 44852..45154 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene rplW CDS 45176..45997 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene rplB CDS 46026..46301 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539416.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene rpsS CDS 46312..46644 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625897.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene rplV CDS 46663..47367 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene rpsC CDS 47381..47791 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919759.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene rplP CDS 47791..47982 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene rpmC CDS 47982..48236 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene rpsQ CDS complement(48313..48900) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061281560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene msrQ CDS complement(48900..49859) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050115893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene msrP CDS 50163..51080 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 51161..51484 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287745.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(51530..52483) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene tal CDS 52659..53216 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 53286..55628 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene lptD CDS 56262..56504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 note possible pseudo, internal stop codon, frameshifted CDS complement(56657..57502) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694033.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene rpoH CDS complement(57713..58027) product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(58059..59093) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene murB CDS complement(59109..60821) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694037.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene narQ CDS 60949..61608 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene napF CDS 61611..61898 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 61925..64405 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778047.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene napA CDS 64468..65220 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene napG CDS 65220..66083 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene napH CDS 66085..66516 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 66519..67118 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene napC CDS 67394..69529 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139988996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene pnp CDS 69629..70528 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694062.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene nlpI CDS 70670..72484 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(72578..73333) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(73516..74097) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(74123..74356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(74399..75430) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene tsaD CDS 75674..75889 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene rpsU CDS 76037..77800 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649498.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene dnaG CDS 77875..79752 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene rpoD sequence15 source 1..138746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 96..172 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(343..1131) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694110.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1228..2202 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene rluD CDS 2204..2938 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene pgeF CDS complement(2970..3812) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(3827..4690) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 4804..5523 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene rph CDS 5536..6177 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene pyrE CDS 6268..7131 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene djlA CDS 7234..8172 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694032.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene dusC CDS complement(8730..9719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(10020..11765) product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693193.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(11770..11991) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693192.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 12110..13120 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene yejK CDS 13191..13604 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693190.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene bamE CDS 13652..14353 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033719.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene cpxR CDS 14365..15750 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene cpxA CDS complement(15963..16592) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(16604..19096) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 19276..20205 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene hemC CDS 20238..20990 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene hemD CDS 21010..22641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 22653..23945 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694537.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 23990..24454 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 24736..26100 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 26178..27710 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(27784..28677) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(28674..29030) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene folB CDS 29130..29732 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene plsY CDS complement(29746..30144) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688532.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 30283..30765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 30786..31394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 31405..31866 product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050789038.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(32216..32986) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(32968..34062) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693197.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene trmA CDS complement(34138..34467) product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(34541..35173) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(35185..35451) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693195.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(35521..36642) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 36867..37646 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 37735..39339 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 39432..40388 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 40452..41951 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 41961..42896 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 42918..43193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 43321..43938 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene mobA CDS 44021..44545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686915.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 44745..46277 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene fruB CDS 46301..47242 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene fruK CDS 47247..48935 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693715.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 49065..49313 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 49415..49990 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658683.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene rpoE CDS 50037..50612 product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 50686..51645 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694646.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene rseB CDS 51646..52080 product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670174.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(52216..53541) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene glpT CDS 53670..54170 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene mobB CDS 54198..55592 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995514.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 55602..56237 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene pdxH CDS complement(56234..56878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(56884..57942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(57945..58229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(58229..59473) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(59473..60189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(60194..61297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(61333..62283) product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(62568..63005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(62992..63552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(63565..63888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(63914..64306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(64293..65456) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(65459..66385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(66523..66948) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 67097..67510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 67517..68269 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 68254..69015 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222117.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 69021..69278 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222118.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 69278..69565 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222119.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 69558..71219 product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 71224..71787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180320626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 71777..73102 product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 73095..73835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 note possible pseudo, frameshifted CDS 73832..74764 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105312.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 74761..75207 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 75226..75810 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 75826..78156 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 78183..79418 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 79553..80101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 80110..81330 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 81323..81778 product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 81775..82503 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene fabG CDS 82514..83752 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(84104..85567) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene katA CDS complement(85768..86601) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174807.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene iolB CDS 86842..88350 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368538.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 88411..89547 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(89620..90300) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557779.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene pnuC CDS 90547..93441 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene rapA CDS 93441..94100 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene rluA CDS 94194..94760 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene yihI CDS 94764..95198 product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 95209..96576 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene hemN CDS 96762..97544 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 97534..98250 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213985.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 98260..99009 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980846.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(99160..99474) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651583.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene fis CDS complement(99455..100453) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869101.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene dusB CDS complement(100668..101549) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene prmA CDS complement(101567..102994) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene panF CDS complement(103008..103271) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 103306..103518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(103560..104906) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene accC CDS complement(104964..105425) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369456.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene accB CDS complement(105592..106044) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene aroQ CDS complement(106134..107126) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene menC CDS complement(107137..107595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(107658..108515) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693314.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene menB CDS complement(108665..111238) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112130572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene clpB CDS 111467..112291 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene dapF CDS 112351..113241 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692390.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene xerC CDS complement(113275..113691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 note possible pseudo, frameshifted CDS complement(113649..113849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(114141..114443) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 114579..115133 product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693181.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 115145..116458 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene pepP CDS 116485..117708 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209951.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene ubiH CDS 117947..119128 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(119173..120447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 note possible pseudo, internal stop codon, frameshifted CDS complement(120477..120848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 note possible pseudo, internal stop codon, frameshifted CDS 121293..122228 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 122332..123264 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964660.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 123297..124805 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 124847..125830 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 126035..129928 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828325.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene purL CDS 130076..130612 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 130642..131541 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(131998..132300) product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011191945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene ybgE CDS complement(132415..133551) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656051.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene cydB CDS complement(133566..135128) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 135545..135859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(135919..136461) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693468.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene hpt CDS complement(136706..138055) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693467.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene pmbA CDS 138174..138707 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651852.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene yjgA sequence16 source 1..6708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 408..737 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049049137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 788..1198 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene arsC CDS 1200..2213 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene arsB CDS complement(2299..2652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 2983..3381 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene cueR CDS 3529..4179 product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025459692.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 4357..4812 product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 4823..6370 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene cueO sequence17 source 1..17183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(433..1317) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660876.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene hflC CDS complement(1317..2540) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene hflK CDS complement(2636..3370) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(3401..3664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(3738..5618) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene htpG CDS complement(5767..7107) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460955.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(7271..7501) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene acpP CDS complement(7813..8541) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene fabG CDS complement(8565..9509) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene fabD CDS complement(9557..10507) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(10538..11572) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene plsX CDS complement(11598..11768) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544470.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene rpmF CDS complement(11786..12253) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868949.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene yceD CDS complement(12394..13041) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429216.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene bioD CDS complement(13056..13814) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene bioC CDS complement(13814..14503) product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(14494..15678) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693580.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene bioF CDS complement(15671..16960) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693582.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene bioA sequence18 source 1..62062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 365..1258 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826367.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene asd CDS 1303..1935 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156348.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(2051..4624) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118806713.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 4783..5583 product competence protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 5573..6097 product competence protein ComB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene comB CDS 6081..6617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 6614..6973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 6983..8386 product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 8544..9071 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene aroK CDS 9092..10180 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694088.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene aroB CDS 10186..11055 product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(11039..11353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 11460..11771 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene secM CDS 11857..14574 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene secA CDS 14696..15097 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869085.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene mutT CDS complement(15374..16786) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene mltF CDS complement(16899..17483) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene lpcA CDS complement(17570..21007) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694314.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene mfd tRNA 21240..21329 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 21559..22785 product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(23255..23752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(23755..24084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(24087..24305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(24322..24555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(24586..24909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(25153..25401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(25398..26015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(26012..26791) product phage recombination protein Bet inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100847.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene bet CDS complement(26802..27752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(27753..27923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(27933..28154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(28147..28419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(29461..30276) product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071369.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(30273..31010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(31042..31263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(31284..31964) product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119885.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 32086..32292 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 32313..32594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 32639..32881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 32881..33594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 33594..34271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 34271..34498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 34488..34913 product recombination protein NinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814621.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(35024..35260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(35325..35975) product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164027538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(36253..36657) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(36679..36855) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 36964..37563 product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 37554..37958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 38109..38354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 38351..38872 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 38845..39186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 39155..39364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 39361..39684 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 39783..40247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 40247..41758 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936861.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 41755..42999 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 42983..43642 product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193633.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 43644..44843 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 44896..45210 product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 45211..45534 product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 45527..46006 product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 46003..46347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 46351..47004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 47065..47478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 47523..47759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 47834..48043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 48118..48513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 48841..49674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 49728..50033 product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693956.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 50087..50293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 50356..53856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 53856..54182 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(54183..54377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 54524..55237 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 55241..55984 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 55927..56535 product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113183.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 56545..61857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 61883..62044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 sequence19 source 1..157636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 39..368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 417..641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(852..1802) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693427.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene cysK CDS complement(1922..2770) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693426.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene cysZ CDS 2932..3933 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693425.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene zipA CDS 4061..6082 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene ligA CDS complement(6157..7488) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene hslU CDS complement(7533..7853) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(7868..8392) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649427.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene hslV CDS complement(8558..9424) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene ubiA CDS 9552..9887 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene glpE CDS complement(10008..11339) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene brnQ CDS complement(11352..13670) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 13825..14085 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 14094..14513 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 14547..15023 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene greB CDS complement(15026..15460) product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948818.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene agaF CDS complement(15532..16374) product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298314.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene agaE CDS complement(16364..17140) product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene agaW CDS complement(17159..17632) product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295547.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene agaV CDS complement(17842..18786) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647895.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene ispH CDS complement(18783..19280) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651632.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene lspA CDS complement(19425..22244) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene ileS CDS complement(22430..23377) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene ribF CDS complement(23563..24969) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693343.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene mnmE CDS complement(25015..26628) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene yidC CDS complement(26628..26888) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene yidD CDS complement(26852..27211) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene rnpA CDS complement(27226..27360) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539760.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene rpmH CDS 27715..29076 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene dnaA CDS 29087..30187 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene dnaN CDS 30191..31267 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene recF CDS 31520..32212 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693208.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 32249..33553 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(33616..34035) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(34086..35417) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene rimO CDS complement(35539..36831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(36843..37562) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995241.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene pepE CDS complement(37768..38376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(38437..39132) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(39280..39690) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995269.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene rraB CDS complement(39805..40203) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene mscL CDS complement(40293..41669) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694644.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene trkA CDS complement(42138..42293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(42290..42769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(42849..44204) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694643.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene rsmB CDS complement(44204..45163) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene fmt CDS complement(45373..47286) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050164505.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene iolC CDS 47537..48382 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(48441..48791) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene rplS CDS complement(48857..49609) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661387.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene trmD CDS complement(49672..50199) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653863.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene rimM CDS complement(50231..50482) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene rpsP CDS complement(50644..51672) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(51689..52450) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(52535..53185) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692076.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 53427..54689 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 54904..56142 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene deoB CDS 56160..56876 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694122.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene deoD CDS 57030..58436 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 58436..59434 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694659.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene dusA CDS complement(59651..59974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 note possible pseudo, internal stop codon, frameshifted CDS complement(60332..60523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 60727..61230 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene mprA CDS 61243..62409 product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 62411..63925 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(64001..64645) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene crp CDS complement(64664..64891) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586568.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(64910..65608) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648000.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene slmA CDS complement(65616..66071) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene dut CDS complement(66091..67302) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene coaBC CDS 67476..68132 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene radC CDS 68359..68595 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005542826.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene rpmB CDS 68607..68777 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613503.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene rpmG CDS 68941..69756 product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693293.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene mutM CDS complement(69842..70339) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648125.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene folA CDS complement(70372..70836) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(70833..71621) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 71780..72883 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene proB CDS complement(72940..73287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 note possible pseudo, frameshifted CDS complement(73305..74006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 note possible pseudo, frameshifted CDS complement(74153..75181) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693182.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene galM CDS complement(75175..76332) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene galK CDS complement(76353..77396) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene galT CDS 77616..78617 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663077.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 78763..79755 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene mglB CDS 79808..81325 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652432.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene mglA CDS 81344..82354 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene mglC CDS complement(83768..84037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(84566..85354) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693839.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(85366..85983) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935569.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(86083..86598) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693842.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 86707..88083 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene cysS CDS complement(88335..89534) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063898.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene hmpA CDS 89673..90101 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207752.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(90221..92389) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene glyS CDS complement(92713..93045) product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(93066..93488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(93521..94558) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(94601..94867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(94894..95802) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628151.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene glyQ CDS complement(96083..101674) product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052728129.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(102370..102951) product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(102951..103946) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 104005..104574 product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 104693..105172 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(105285..107909) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836312.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene adhE CDS 108206..108700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 note possible pseudo, frameshifted CDS 108763..108939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 109139..109858 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(109966..110796) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 110986..111429 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene lysM CDS 111624..112922 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869039.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene tig CDS 113093..113695 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene clpP CDS 113699..114931 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene clpX CDS complement(115002..115988) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene rluC CDS 116420..119260 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene rne tRNA 119425..119514 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(120050..121477) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene aspA CDS complement(121637..122428) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649894.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 122668..123642 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150523.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene manX CDS 123659..124456 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 124472..125302 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 125376..125753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(125936..128212) product bifunctional glutamate--cysteine ligase/glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene gshAB CDS complement(128404..128742) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656373.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene fdx CDS complement(128748..130613) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene hscA CDS complement(130625..131143) product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene hscB CDS complement(131155..131478) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301571.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene iscA CDS complement(131541..131924) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654861.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene iscU CDS complement(131946..133160) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868979.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(133281..133751) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene iscR CDS complement(133810..134559) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene trmJ CDS 134732..135538 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene suhB CDS complement(135682..136308) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene sodA CDS complement(136449..138719) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 138971..139666 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694303.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene rsuA CDS 139677..140870 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(140865..141263) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654127.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene cueR CDS 141371..142996 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216735.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(143073..143540) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene bcp CDS 143679..144575 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525505.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene dapA CDS 144688..145692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 145815..146660 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 146778..148133 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene gorA CDS 148415..150829 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693703.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene lon CDS 150963..152822 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059358191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 153098..153826 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene rpsB CDS 153958..154803 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693261.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene tsf CDS 154960..156162 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(156214..157476) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene rho sequence20 source 1..61146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(232..3816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 note possible pseudo, frameshifted CDS complement(3834..4268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 note possible pseudo, frameshifted CDS complement(4163..5536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 note possible pseudo, frameshifted CDS 5702..7675 product heme/hemopexin-binding protein HxuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694042.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene hxuC CDS 7606..7836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 note possible pseudo, frameshifted CDS 7852..8358 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene hutX CDS 8352..8870 product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene hutZ CDS complement(8999..9961) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652627.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene lipA CDS complement(9979..10632) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691065.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene lipB CDS complement(10659..10961) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649857.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene ybeD CDS complement(11056..12243) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(12273..13109) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668014.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(13168..14283) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649852.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene rodA CDS complement(14283..16220) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649850.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene mrdA CDS complement(16224..16691) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649848.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene rlmH CDS complement(16692..17003) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005635481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene rsfS CDS complement(17012..17269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(17166..18485) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene rhlB CDS 18889..20382 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005690769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene nrfA CDS 20491..21114 product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647730.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene nrfB CDS 21111..21788 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647733.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene nrfC CDS 21785..22747 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene nrfD CDS 22998..24923 product heme lyase NrfEFG subunit NrfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693283.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene nrfE CDS 24916..25512 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693282.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 25509..25979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 25976..26848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 26845..28044 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 28165..31641 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene dnaE CDS complement(31699..33063) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(33128..34369) product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666700.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(34752..35579) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647819.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(35700..37109) product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene ftsP CDS complement(37111..37854) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005689023.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 37975..38745 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene lpxH CDS complement(38675..40267) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 40413..41129 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene pyrH CDS 41158..41715 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632773.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene frr CDS 41842..43041 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene ispC CDS 43186..43914 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655860.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene uppS CDS 43918..44781 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 44794..46125 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene rseP CDS 46155..48533 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693264.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene bamA CDS 48645..49229 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693263.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 49229..50260 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693262.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene lpxD CDS 50374..50823 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035660215.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene fabZ CDS 50852..51640 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651701.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene lpxA CDS 51747..52919 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869121.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene lpxB CDS 52919..53509 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene rnhB CDS complement(54573..54842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 54735..56444 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 56454..57185 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 57175..57804 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113327.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 57806..58735 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 58754..59338 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647046.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene mog CDS 59358..59696 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene glnB CDS 59696..60730 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 sequence21 source 1..70121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1715..2884 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172454032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 2915..3466 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene pilW CDS 3695..4759 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 4791..5897 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene ispG CDS 5908..7176 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene hisS CDS 7189..7800 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(8119..9042) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene era CDS complement(9039..9725) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene rnc CDS complement(9744..10775) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693886.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene lepB CDS complement(10788..12581) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene lepA CDS 12917..14782 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065250839.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 14919..15821 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene corC CDS 15818..17356 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene lnt CDS 17491..18645 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627231.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene metK CDS complement(19007..19555) product DUF5358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693313.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(19558..20298) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655733.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene rlmB CDS complement(20387..22708) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429007.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene rnr CDS complement(22979..23428) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene rplI CDS complement(23446..23670) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005598105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene rpsR CDS complement(23683..24009) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene priB CDS complement(23996..24373) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene rpsF CDS complement(24790..25425) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene lexA CDS 25650..28082 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene plsB CDS complement(28390..30066) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693852.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene recN CDS complement(30144..31061) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 31264..31875 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146104764.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene grpE CDS complement(31922..32443) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene tadA CDS complement(32558..33409) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(33422..34222) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene lgt CDS complement(34232..35023) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693253.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(35023..35640) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene rppH CDS 36328..36921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(37001..37555) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694366.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene ampD CDS 37698..38132 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 38145..39560 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(39607..44484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 44757..45872 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 45869..46336 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene ybeY CDS 46339..48339 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 48388..48549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 48809..49267 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686427.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene mraZ CDS 49379..50344 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene rsmH CDS 50347..50667 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647600.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene ftsL CDS 50690..52492 product peptidoglycan synthase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 52513..53988 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene murE CDS 53985..55367 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996536.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene murF CDS 55361..56443 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene mraY CDS 56462..57772 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693450.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene murD CDS 57783..58961 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene ftsW CDS 59006..60034 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693451.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene murG CDS 60058..61488 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene murC CDS 61500..62426 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693454.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 62426..63196 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693455.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 63221..64498 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene ftsA CDS 64528..64797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 64791..65129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 65304..66611 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139990268.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene ftsZ CDS 66636..67571 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene lpxC CDS complement(67632..68552) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175305.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 68694..69560 product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112486.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene hchA sequence22 source 1..7402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 327..956 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 967..1974 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992236.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 2208..3371 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene pheA CDS complement(3464..4777) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 4970..5986 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene galE CDS 6059..7327 product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 sequence23 source 1..11691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..933 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207989.1:bile acid:sodium symporter family protein locus_tag LOCUS_17010 CDS 1066..1710 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene adk CDS complement(1765..2583) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 2802..3950 product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 4160..4963 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237050.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene nagB CDS 4987..6132 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694427.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene nagA CDS 6289..7512 product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 tRNA 7658..7734 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 7739..7823 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 7851..7925 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 7970..8044 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 8176..9435 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(9492..11528) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene prlC sequence24 source 1..22513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(224..1642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(1699..4251) product transferrin-binding protein Tbp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene tbp1 CDS complement(4264..6060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(6248..8290) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene prlC CDS 8414..8776 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 8819..10402 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694085.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(10700..13078) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene mrcB CDS complement(13112..13471) product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(13485..13826) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649956.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene erpA CDS 13964..14767 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene map CDS 15210..17807 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694204.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene glnD CDS complement(17863..18723) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(18754..20043) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene hemL CDS 20192..21262 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694200.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene wecA CDS 21272..22084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 tRNA 22253..22329 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 22352..22427 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 22436..22512 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence25 source 1..641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence26 source 1..12200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(227..1021) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995756.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene murI CDS complement(1089..3170) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene recG CDS complement(3170..5293) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene spoT CDS complement(5369..5635) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693900.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene rpoZ CDS complement(5702..6328) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693898.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene gmk CDS 6610..7614 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005646416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene gap CDS 7924..9720 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 10022..12148 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene nrdD sequence27 source 1..19587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 803..1273 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693470.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene nrdG CDS complement(1374..2276) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 2385..3527 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 3596..4573 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101364.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 4625..4981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 4982..5842 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(5935..6777) product ABC transporter six-transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(6762..7211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 7480..9258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(9436..9675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 note possible pseudo, frameshifted CDS complement(9677..10117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 10394..10693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(10813..11193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(11258..12007) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(12149..12436) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(12449..13006) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 13114..14019 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 14151..14540 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630808.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(14597..15208) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 15362..16036 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene rpe CDS 16036..16710 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694158.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 16734..17735 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene trpS CDS 17877..18509 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 sequence28 source 1..1768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence29 source 1..42943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..1541) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene glpK CDS 1943..2680 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(2748..3464) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene tsaA CDS 3559..4473 product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene menA CDS 4523..5023 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669389.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene rraA CDS 5249..6634 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 6756..7598 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227959.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene ubiE CDS 7610..8239 product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene ubiJ CDS 8244..9881 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187559.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene ubiB CDS 10013..10237 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene tatA CDS 10241..10807 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694100.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene tatB CDS 10817..11602 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene tatC CDS 11681..12703 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene hemB CDS complement(12982..13662) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(13686..14159) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523578.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(14216..15994) product PTS ascorbate-specific subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395341.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 16311..17402 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene ulaG CDS 17479..18225 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene ulaR CDS 18274..19134 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 19128..19823 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669745.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene araD CDS 19848..20666 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210759.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(20701..24105) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene recC CDS complement(24117..24422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(24403..25080) product DUF2572 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869091.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(25077..25799) product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(25844..26323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 tRNA complement(26549..26624) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(26649..26724) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(26753..26828) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(27010..27474) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652235.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene pal CDS complement(27485..28792) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693786.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene tolB CDS complement(28820..30034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(30051..30473) product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649190.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene tolR CDS complement(30523..31206) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene tolQ CDS complement(31252..31650) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene ybgC CDS complement(31790..32800) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225852.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 32941..34734 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225623.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 sequence30 source 1..2684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..1005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 sequence31 source 1..116374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1105..1482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1466..1690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1694..1924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 2254..2616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 2674..3045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 3086..3442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 3506..3838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 4027..4503 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene ispF CDS 4505..5527 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene truD CDS 5536..6276 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene surE CDS 6310..6885 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694589.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 6900..7088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 7102..8319 product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694590.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene nlpD CDS 8321..8713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(9010..9546) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694052.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 9985..12813 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene uvrA CDS 12961..14007 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 14078..15124 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687477.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene mreC CDS 15124..15612 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657800.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene mreD tRNA complement(15765..15840) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(15909..15984) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(16024..16099) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 16276..16758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 note possible pseudo, frameshifted CDS 16725..17717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 note possible pseudo, frameshifted tRNA 17812..17887 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(18670..18987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(19393..19608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(19609..20154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(20157..22361) product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213863.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(22676..23713) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277486.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(23716..25290) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(25429..26439) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 26375..26578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 26785..27075 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687043.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 27154..28797 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649509.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene groL tRNA complement(29061..29137) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(29167..29243) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 29408..30268 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654480.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene folD CDS complement(30336..31097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 note possible pseudo, frameshifted CDS complement(31054..31575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(31679..32281) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene leuD CDS complement(32291..33700) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693329.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene leuC CDS complement(33986..35062) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene leuB CDS complement(35074..36627) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene leuA CDS 37159..37809 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693414.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene ccmA CDS 37853..38518 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005637214.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene ccmB CDS 38558..39301 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 39386..39589 product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693416.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene ccmD CDS 39586..40101 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693417.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene ccmE CDS 40101..42059 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 42070..42615 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657352.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 42615..43097 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 43101..44000 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693419.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene ccmI CDS 44042..44224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 44410..44805 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 44822..45379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(45422..46111) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene hda CDS complement(46218..47471) product NCS2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694289.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(47570..48196) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene upp CDS complement(48336..48839) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602638.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene ubiC CDS complement(48849..49466) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene hisIE CDS complement(49450..50034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(50034..50807) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693688.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene hisF CDS complement(50789..51538) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene hisA CDS complement(51562..52059) product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171857.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(52059..52652) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693689.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene hisH CDS complement(52668..53681) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(53711..54652) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693690.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene hisB CDS complement(54652..54804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 note possible pseudo, frameshifted CDS complement(54853..55908) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene hisC CDS complement(55950..56939) product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene rhuM CDS complement(56985..58283) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669329.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene hisD CDS complement(58331..59230) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656529.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene hisG CDS complement(59487..60230) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(60307..61557) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694021.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene mtr CDS 61718..62245 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene ppa CDS 62317..63087 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037586615.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 64455..64946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 64947..65126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 65192..65449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(65827..66264) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476113.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 66423..69287 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene polA CDS complement(69362..71146) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(71256..73283) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667119.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 73727..74077 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647571.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 74238..75368 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene dprA CDS complement(75376..75987) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693161.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene rsmD CDS 76146..77705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(77769..78866) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694613.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene glpQ CDS complement(78960..80405) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene glpT CDS 80690..82381 product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694610.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene glpA CDS 82371..83693 product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694609.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene glpB CDS 83693..84961 product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694608.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene glpC CDS complement(85006..85764) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661561.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(85792..86655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 86690..87019 product DUF5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665148.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(87174..88355) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene purT CDS complement(88382..88888) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693682.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene luxS CDS complement(89266..89721) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(89714..90091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 note possible pseudo, frameshifted CDS complement(90322..90924) product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652027.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 91081..91452 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 tRNA complement(91531..91607) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(91670..91746) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(91757..91846) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(91958..93970) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869028.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene rep CDS complement(93967..94212) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005672404.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(94304..95152) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(95152..95571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(95685..95834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 95840..96004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 95988..97358 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(97436..98737) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene eno CDS 98948..99712 product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104614758.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(99901..101529) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene pyrG CDS complement(101763..104861) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769342.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(104876..106102) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(106132..106698) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693244.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(106873..107676) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995557.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(107894..110080) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694336.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene priA CDS 110281..110493 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene rpmE CDS complement(110619..111908) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429435.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(111975..112502) product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652096.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(112531..113313) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116972861.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(113323..114327) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868989.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(114333..114962) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828392.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene tmk CDS complement(114964..115944) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene mltG sequence32 source 1..10456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..5044 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102960.1:DEAD/DEAH box helicase family protein locus_tag LOCUS_19090 CDS complement(5158..6390) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene serA CDS complement(6414..7073) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene rpiA CDS complement(7176..8336) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene hemW CDS complement(8336..8950) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694045.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene rdgB CDS complement(9100..9471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 tRNA complement(10119..10194) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(10203..10279) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 rRNA complement(10294..10404) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence33 source 1..446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence34 source 1..472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence35 source 1..377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence36 source 1..454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence37 source 1..448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence38 source 1..446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence39 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 62..295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 note possible pseudo, frameshifted sequence40 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence41 source 1..434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence42 source 1..433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence43 source 1..431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence44 source 1..426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence45 source 1..399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence46 source 1..708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 320..448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 sequence47 source 1..381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence48 source 1..381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 70..240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 sequence49 source 1..370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence50 source 1..374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence51 source 1..373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence52 source 1..81311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 1536..2483 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 2559..3437 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene ilvY CDS 3473..4357 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655039.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene rarD CDS complement(4510..6423) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694483.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 6612..6866 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 6891..8723 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene oadA CDS 8737..10041 product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704360.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(10095..11222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 12346..13275 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 13337..14074 product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015145.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene nadE CDS complement(14455..14643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(14730..15152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(15307..16557) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693130.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene lysA CDS complement(16589..16708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 16858..17166 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655473.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene cyaY CDS 17228..19072 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene recQ CDS 19415..19642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 19642..19860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 19878..20099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 20420..20650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 20895..22148 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 22169..24247 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704147.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 24547..25725 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 25734..26489 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(26529..27353) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(27402..27866) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650775.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene gpt CDS 27988..29442 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694602.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(29506..30855) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013649894.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(30868..31662) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703373.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(31840..32268) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649396.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(32308..33681) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene atpD CDS complement(33698..34567) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693686.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene atpG CDS complement(34590..36131) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene atpA CDS complement(36144..36692) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642563.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene atpH CDS complement(36706..37176) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene atpF CDS complement(37250..37504) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene atpE CDS complement(37581..38369) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene atpB CDS complement(38904..39539) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652031.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene rsmG CDS complement(39539..41428) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694554.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene mnmG CDS complement(41896..42339) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene mioC CDS complement(42400..42618) product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650820.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene zapB CDS 42774..43787 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene glpX CDS 44010..46442 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene gyrB CDS complement(46544..47977) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209412.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(48387..49907) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693140.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(50236..51066) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene aroE CDS complement(51078..51641) product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694486.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(51634..52197) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(52190..52813) product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687482.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 52969..54588 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649434.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 54668..55204 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649445.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(55239..57821) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040035576.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene mutS CDS 58099..59208 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene recA CDS 59296..59754 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694572.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene recX CDS complement(60081..60989) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263940.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 61086..61775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(61804..63033) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(63026..63427) product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(63438..64859) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093933.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(64852..66372) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865648.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene fdrA CDS complement(66381..67046) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(67325..68170) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470719.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(68276..69796) product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(69809..71227) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083439.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(71230..71556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 note possible pseudo, frameshifted CDS complement(71688..72776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 note possible pseudo, frameshifted CDS complement(72791..73378) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098408.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(73398..74309) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470719.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 74680..75753 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene recA CDS 75839..76297 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694572.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene recX CDS 76446..78161 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene proS CDS 78349..79095 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 79263..80015 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694335.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene trmB CDS 80046..80384 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694334.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 sequence53 source 1..76792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 428..1909 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654301.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene ilvC CDS 2070..2714 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224851.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(2885..3670) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693705.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene mazG CDS 3894..4319 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648375.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene uspA CDS 4500..7124 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995486.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene alaS CDS 7274..7456 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632782.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene csrA CDS 7479..8843 product phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208588.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene cpsG CDS 8985..9872 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene galU CDS 10137..11438 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694065.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene brnQ CDS 11556..12038 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652354.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene trmL CDS complement(12083..12667) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693730.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene nfuA CDS 13609..14421 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010360614.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 14434..15276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 15322..16239 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(16277..16990) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828382.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 17073..18392 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693742.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene srmB CDS 18561..19616 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829995.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 19644..19865 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581076.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 20215..21162 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651675.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene corA CDS 21180..21743 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651676.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 21779..22033 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene yggU CDS complement(22070..25474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 25806..26468 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 26471..27139 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418066.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 27152..27916 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130360.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 27900..28742 product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(28823..29203) product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(29253..29687) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655034.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 29855..30622 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661219.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene tpiA CDS 30808..31773 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(31840..33321) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(33308..33451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(33461..34924) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(35106..36194) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373195.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(36285..38258) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694555.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene cpdB CDS 38535..40406 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479240.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(40454..41761) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(41894..42304) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458360.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 42585..43196 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170635.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene hflD CDS 43209..44576 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene purB CDS 44727..45845 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693157.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene mutY CDS 45845..46123 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648477.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 46120..47196 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene mltC tRNA 47352..47427 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 47432..47507 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 47671..47747 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 47960..49168 product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815743.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 49931..50128 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 50548..51228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 51374..52474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 52721..53710 product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 53763..53948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 53945..54169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 54166..54375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 54468..55019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 55012..55539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 55536..55787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 55784..57685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(58498..59094) product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 59268..59522 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene bolA note possible pseudo, frameshifted CDS 59899..61239 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694115.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 61242..62480 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 62473..63249 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689271.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 63249..63872 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221365.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 63874..64470 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631374.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene nqrE CDS 64485..65708 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene nqrF CDS 65794..66837 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668096.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 66848..67096 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene nqrM CDS 67138..68292 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100066294.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene mnmA CDS 68417..69673 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694491.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene waaA CDS 69721..70215 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene coaD CDS complement(70278..72383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(72403..73119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 note possible pseudo, internal stop codon CDS complement(73123..73302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 73577..74785 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693557.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene gltS CDS complement(74852..75805) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene coaA tRNA 76020..76095 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 76130..76214 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 76256..76330 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 76335..76410 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 sequence54 source 1..39785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 259..684 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene secE CDS 686..1237 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648601.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene nusG CDS 1463..1891 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene rplK CDS 1895..2584 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene rplA CDS 2952..3443 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626605.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene rplJ CDS 3495..3866 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene rplL CDS 4222..8250 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666423.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene rpoB CDS 8349..12611 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693659.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene rpoC CDS 12947..13504 product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 13677..14501 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene nudC CDS 14513..15577 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene hemE CDS 15587..16177 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693732.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 16336..16608 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 16764..17546 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339356.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 17588..19420 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112119346.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene glmS CDS 19591..20820 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 20970..21620 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632750.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene ftsE CDS 21900..22814 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660149.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene ftsX CDS 23139..24254 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694497.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene asd CDS 24595..25527 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694498.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(25487..25870) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene crcB CDS complement(25890..26708) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694570.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 27061..28707 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene ilvG CDS 28721..28963 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene ilvM CDS 29091..29606 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 29645..31486 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693142.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene ilvD CDS 31580..32257 product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 32268..33815 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696111.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene ilvA CDS complement(33982..35331) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664327.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene gdhA CDS complement(35576..36202) product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367071.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(36370..36810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 note possible pseudo, frameshifted CDS complement(36807..37199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 note possible pseudo, frameshifted CDS complement(37238..37927) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(37917..38954) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648552.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene metN CDS 39124..39678 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene gmhB sequence55 source 1..935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..906 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005667564.1:elongation factor Tu locus_tag LOCUS_21010 sequence56 source 1..697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence57 source 1..1710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence58 source 1..1261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence59 source 1..1163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 note possible pseudo, frameshifted sequence60 source 1..55703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(153..1322) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(1672..2181) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176268.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene hemG CDS complement(2181..3644) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(3656..4264) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828482.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 4340..4579 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene tusA CDS complement(4630..5313) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693156.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 5570..6769 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693155.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene envC CDS 6769..7659 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869050.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(8584..10821) product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786266.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(10805..11227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(11224..11574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(11567..11764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(11757..11996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(11989..12369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(12362..12526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(13037..13303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(13481..13774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(13829..14569) product antA/AntB antirepressor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776709.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(14566..14838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(14838..15086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(15083..15772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(15769..16155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(16160..16402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(16417..16596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(16833..17867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(18229..18441) product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(18438..18725) product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(19058..20308) product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071660.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 tRNA complement(20617..20711) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 20878..22263 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene selA CDS 22260..24119 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694594.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene selB CDS complement(24199..24996) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene cysE CDS complement(24998..26011) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694541.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene gpsA CDS 26216..26545 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006027262.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 26523..26846 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(26888..27394) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630575.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene secB CDS complement(27413..27859) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693147.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 28137..29450 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655513.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 29580..30248 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185732.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 30345..30806 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(31267..32628) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693739.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene pssA CDS 32802..33848 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693740.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(33853..34113) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649491.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 34186..34926 product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 35085..36254 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene pgk CDS 36335..37414 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694127.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene fbaA CDS 37680..39032 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 39038..40948 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(41223..41579) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694338.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(41687..43915) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694339.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(43932..45245) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694340.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene rlmD CDS complement(45249..45896) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene recO CDS 46162..46746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 46756..50007 product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775680.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 50023..50865 product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene dinD CDS 50881..51759 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145171390.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 51752..52756 product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 52753..53976 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 54012..55610 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775679.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 sequence61 source 1..1115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..1056 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028462.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 sequence62 source 1..25064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..858 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694361.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene rsmE CDS 883..1440 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694360.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 1440..1859 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648994.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene ruvX CDS 2096..2701 product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019923.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(2773..3228) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(3221..3862) product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116956690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 4045..5301 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170624.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene icd CDS 5320..6192 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029986.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 6418..7179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(7244..7930) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693159.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(7939..9210) product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene nadR CDS complement(9298..9552) product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001357687.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene ubiK CDS 9909..10550 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene ribB CDS complement(10841..11437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 note possible pseudo, frameshifted CDS complement(11467..12117) product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 12271..12609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 12910..13542 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651790.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene yihA CDS 13753..15288 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(16228..16617) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648400.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene rplQ CDS complement(16657..17646) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648402.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene rpoA CDS complement(17679..18299) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693170.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene rpsD CDS complement(18328..18717) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543603.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene rpsK CDS complement(18733..19089) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene rpsM CDS complement(19370..20695) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652382.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene secY CDS complement(20703..21137) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648410.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene rplO CDS complement(21142..21321) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693169.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene rpmD CDS complement(21328..21828) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625871.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene rpsE CDS complement(21844..22197) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene rplR CDS complement(22211..22744) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene rplF CDS complement(22763..23155) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625877.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene rpsH CDS complement(23192..23497) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625879.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene rpsN CDS complement(23510..24049) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene rplE CDS complement(24070..24381) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005635734.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene rplX CDS complement(24395..24766) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005548786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene rplN sequence63 source 1..414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence64 source 1..567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(305..380) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(404..480) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 sequence65 source 1..521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence66 source 1..3639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 300..593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 991..1980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 misc_feature complement(2350..>3639) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106726897.1:Ti-type conjugative transfer relaxase TraA locus_tag LOCUS_21980