>Feature sequence01 911 1255 gene locus_tag LOCUS_00010 911 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1350 2225 gene locus_tag LOCUS_00020 1350 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229834.1 protein_id gnl|my_center|LOCUS_00020 2461 3045 gene locus_tag LOCUS_00030 2461 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227894.1 protein_id gnl|my_center|LOCUS_00030 3118 3741 gene locus_tag LOCUS_00040 3118 3741 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227895.1 protein_id gnl|my_center|LOCUS_00040 4312 3749 gene locus_tag LOCUS_00050 4312 3749 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680453.1 protein_id gnl|my_center|LOCUS_00050 5161 4511 gene locus_tag LOCUS_00060 5161 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5873 5190 gene locus_tag LOCUS_00070 5873 5190 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781894.1 protein_id gnl|my_center|LOCUS_00070 7928 6018 gene locus_tag LOCUS_00080 7928 6018 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227897.1 protein_id gnl|my_center|LOCUS_00080 8992 7982 gene locus_tag LOCUS_00090 8992 7982 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_00090 9272 12139 gene locus_tag LOCUS_00100 9272 12139 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_00100 12136 13062 gene locus_tag LOCUS_00110 12136 13062 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227901.1 protein_id gnl|my_center|LOCUS_00110 13468 13115 gene locus_tag LOCUS_00120 13468 13115 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209098.1 protein_id gnl|my_center|LOCUS_00120 13505 13894 gene locus_tag LOCUS_00130 13505 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13997 14152 gene locus_tag LOCUS_00140 13997 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14149 14715 gene locus_tag LOCUS_00150 14149 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14712 15830 gene locus_tag LOCUS_00160 14712 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17982 15823 gene locus_tag LOCUS_00170 gene uvrB 17982 15823 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958334.1 protein_id gnl|my_center|LOCUS_00170 19343 18045 gene locus_tag LOCUS_00180 19343 18045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19401 19919 gene locus_tag LOCUS_00190 19401 19919 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227910.1 protein_id gnl|my_center|LOCUS_00190 20351 20118 gene locus_tag LOCUS_00200 20351 20118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20233 20574 gene locus_tag LOCUS_00210 20233 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21725 20550 gene locus_tag LOCUS_00220 gene coaE 21725 20550 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286284.1 protein_id gnl|my_center|LOCUS_00220 22368 21754 gene locus_tag LOCUS_00230 22368 21754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24000 22504 gene locus_tag LOCUS_00240 gene rpsA 24000 22504 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227916.1 protein_id gnl|my_center|LOCUS_00240 24193 25026 gene locus_tag LOCUS_00250 24193 25026 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_00250 25037 25960 gene locus_tag LOCUS_00260 25037 25960 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227919.1 protein_id gnl|my_center|LOCUS_00260 26045 26662 gene locus_tag LOCUS_00270 26045 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26659 28554 gene locus_tag LOCUS_00280 26659 28554 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227921.1 protein_id gnl|my_center|LOCUS_00280 28551 29138 gene locus_tag LOCUS_00290 28551 29138 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227922.1 protein_id gnl|my_center|LOCUS_00290 29940 29143 gene locus_tag LOCUS_00300 29940 29143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30928 29948 gene locus_tag LOCUS_00310 30928 29948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31607 31014 gene locus_tag LOCUS_00320 31607 31014 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887413.1 protein_id gnl|my_center|LOCUS_00320 32200 31604 gene locus_tag LOCUS_00330 32200 31604 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013557.1 protein_id gnl|my_center|LOCUS_00330 33502 32210 gene locus_tag LOCUS_00340 33502 32210 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467112.1 protein_id gnl|my_center|LOCUS_00340 34881 33571 gene locus_tag LOCUS_00350 34881 33571 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887198.1 protein_id gnl|my_center|LOCUS_00350 35390 34887 gene locus_tag LOCUS_00360 35390 34887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35468 35923 gene locus_tag LOCUS_00370 35468 35923 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193539.1 protein_id gnl|my_center|LOCUS_00370 36649 36068 gene locus_tag LOCUS_00380 36649 36068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39242 36615 gene locus_tag LOCUS_00390 gene polA 39242 36615 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_00390 39342 39764 gene locus_tag LOCUS_00400 39342 39764 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227928.1 protein_id gnl|my_center|LOCUS_00400 39826 40380 gene locus_tag LOCUS_00410 39826 40380 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227936.1 protein_id gnl|my_center|LOCUS_00410 41141 40437 gene locus_tag LOCUS_00420 41141 40437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 protein_id gnl|my_center|LOCUS_00420 41907 41131 gene locus_tag LOCUS_00430 41907 41131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 protein_id gnl|my_center|LOCUS_00430 43070 41904 gene locus_tag LOCUS_00440 43070 41904 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093952556.1 protein_id gnl|my_center|LOCUS_00440 44029 43067 gene locus_tag LOCUS_00450 44029 43067 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227932.1 protein_id gnl|my_center|LOCUS_00450 45331 44156 gene locus_tag LOCUS_00460 45331 44156 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227931.1 protein_id gnl|my_center|LOCUS_00460 46215 45610 gene locus_tag LOCUS_00470 46215 45610 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_00470 47384 46422 gene locus_tag LOCUS_00480 47384 46422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 48156 47575 gene locus_tag LOCUS_00490 48156 47575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 48229 49812 gene locus_tag LOCUS_00500 48229 49812 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229603.1 protein_id gnl|my_center|LOCUS_00500 49860 50351 gene locus_tag LOCUS_00510 49860 50351 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284641.1 protein_id gnl|my_center|LOCUS_00510 50402 51472 gene locus_tag LOCUS_00520 50402 51472 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113287.1 protein_id gnl|my_center|LOCUS_00520 51532 52353 gene locus_tag LOCUS_00530 51532 52353 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029986.1 protein_id gnl|my_center|LOCUS_00530 53642 52350 gene locus_tag LOCUS_00540 53642 52350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53733 54152 gene locus_tag LOCUS_00550 53733 54152 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_00550 55349 54153 gene locus_tag LOCUS_00560 55349 54153 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182893188.1 protein_id gnl|my_center|LOCUS_00560 55803 55420 gene locus_tag LOCUS_00570 55803 55420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00570 55857 56696 gene locus_tag LOCUS_00580 55857 56696 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975579.1 protein_id gnl|my_center|LOCUS_00580 56825 58825 gene locus_tag LOCUS_00590 56825 58825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 59231 58791 gene locus_tag LOCUS_00600 59231 58791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 60089 59292 gene locus_tag LOCUS_00610 60089 59292 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_00610 61888 60086 gene locus_tag LOCUS_00620 gene recQ 61888 60086 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224869.1 protein_id gnl|my_center|LOCUS_00620 63532 61898 gene locus_tag LOCUS_00630 63532 61898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 63641 65173 gene locus_tag LOCUS_00640 63641 65173 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230428.1 protein_id gnl|my_center|LOCUS_00640 66008 65061 gene locus_tag LOCUS_00650 66008 65061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 66308 67204 gene locus_tag LOCUS_00660 66308 67204 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_00660 67329 68204 gene locus_tag LOCUS_00670 67329 68204 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173129680.1 protein_id gnl|my_center|LOCUS_00670 68630 68322 gene locus_tag LOCUS_00680 68630 68322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 68808 69095 gene locus_tag LOCUS_00690 68808 69095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 69306 69163 gene locus_tag LOCUS_00700 69306 69163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 69478 69693 gene locus_tag LOCUS_00710 69478 69693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 69747 69893 gene locus_tag LOCUS_00720 69747 69893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 69997 70173 gene locus_tag LOCUS_00730 69997 70173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 70651 70175 gene locus_tag LOCUS_00740 70651 70175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 71133 70648 gene locus_tag LOCUS_00750 71133 70648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 72518 71157 gene locus_tag LOCUS_00760 72518 71157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 72817 72518 gene locus_tag LOCUS_00770 72817 72518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 73429 72947 gene locus_tag LOCUS_00780 73429 72947 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_00780 73523 74266 gene locus_tag LOCUS_00790 73523 74266 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804160.1 protein_id gnl|my_center|LOCUS_00790 76478 74316 gene locus_tag LOCUS_00800 76478 74316 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224133.1 protein_id gnl|my_center|LOCUS_00800 77065 76484 gene locus_tag LOCUS_00810 77065 76484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 77502 77149 gene locus_tag LOCUS_00820 77502 77149 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225795.1 protein_id gnl|my_center|LOCUS_00820 77620 78207 gene locus_tag LOCUS_00830 77620 78207 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242591.1 protein_id gnl|my_center|LOCUS_00830 78241 78561 gene locus_tag LOCUS_00840 78241 78561 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035726.1 protein_id gnl|my_center|LOCUS_00840 78603 78977 gene locus_tag LOCUS_00850 gene sugE2 78603 78977 CDS product quaternary ammonium compound efflux SMR transporter SugE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724784.1 protein_id gnl|my_center|LOCUS_00850 79996 79130 gene locus_tag LOCUS_00860 79996 79130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 80328 80254 gene locus_tag LOCUS_t00010 80328 80254 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 80678 80397 gene locus_tag LOCUS_00870 80678 80397 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401147.1 protein_id gnl|my_center|LOCUS_00870 80952 81293 gene locus_tag LOCUS_00880 80952 81293 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_00880 83389 81359 gene locus_tag LOCUS_00890 gene pabB 83389 81359 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_00890 84431 83502 gene locus_tag LOCUS_00900 84431 83502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 84931 84428 gene locus_tag LOCUS_00910 84931 84428 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_00910 85077 86264 gene locus_tag LOCUS_00920 85077 86264 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_00920 86402 87559 gene locus_tag LOCUS_00930 86402 87559 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226976.1 protein_id gnl|my_center|LOCUS_00930 87615 88028 gene locus_tag LOCUS_00940 gene speD 87615 88028 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226975.1 protein_id gnl|my_center|LOCUS_00940 88025 88867 gene locus_tag LOCUS_00950 88025 88867 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226974.1 protein_id gnl|my_center|LOCUS_00950 91074 89011 gene locus_tag LOCUS_00960 91074 89011 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_00960 91246 91908 gene locus_tag LOCUS_00970 91246 91908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 92583 91978 gene locus_tag LOCUS_00980 92583 91978 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973928.1 protein_id gnl|my_center|LOCUS_00980 93928 92663 gene locus_tag LOCUS_00990 93928 92663 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_00990 95044 93944 gene locus_tag LOCUS_01000 gene gcvT 95044 93944 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 protein_id gnl|my_center|LOCUS_01000 95722 95420 gene locus_tag LOCUS_01010 95722 95420 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224358.1 protein_id gnl|my_center|LOCUS_01010 96121 95738 gene locus_tag LOCUS_01020 96121 95738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742169.1 protein_id gnl|my_center|LOCUS_01020 96722 96234 gene locus_tag LOCUS_01030 96722 96234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224355.1 protein_id gnl|my_center|LOCUS_01030 97085 96924 gene locus_tag LOCUS_01040 97085 96924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 98619 97495 gene locus_tag LOCUS_01050 98619 97495 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224352.1 protein_id gnl|my_center|LOCUS_01050 99745 98621 gene locus_tag LOCUS_01060 99745 98621 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 protein_id gnl|my_center|LOCUS_01060 99876 100328 gene locus_tag LOCUS_01070 99876 100328 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728798.1 protein_id gnl|my_center|LOCUS_01070 100385 101587 gene locus_tag LOCUS_01080 100385 101587 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_01080 101587 103650 gene locus_tag LOCUS_01090 101587 103650 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_01090 105885 103813 gene locus_tag LOCUS_01100 105885 103813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01100 107186 105870 gene locus_tag LOCUS_01110 107186 105870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 108296 107304 gene locus_tag LOCUS_01120 108296 107304 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_01120 109097 108546 gene locus_tag LOCUS_01130 109097 108546 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_01130 109222 109617 gene locus_tag LOCUS_01140 109222 109617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 109620 110111 gene locus_tag LOCUS_01150 109620 110111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 110117 110269 gene locus_tag LOCUS_01160 110117 110269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 110342 110725 gene locus_tag LOCUS_01170 110342 110725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 110803 111894 gene locus_tag LOCUS_01180 110803 111894 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224208.1 protein_id gnl|my_center|LOCUS_01180 111923 112963 gene locus_tag LOCUS_01190 111923 112963 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086675089.1 protein_id gnl|my_center|LOCUS_01190 113222 113025 gene locus_tag LOCUS_01200 113222 113025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 114534 113215 gene locus_tag LOCUS_01210 114534 113215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 116231 114813 gene locus_tag LOCUS_01220 116231 114813 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229854.1 protein_id gnl|my_center|LOCUS_01220 117064 116240 gene locus_tag LOCUS_01230 117064 116240 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229855.1 protein_id gnl|my_center|LOCUS_01230 118050 117070 gene locus_tag LOCUS_01240 118050 117070 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229856.1 protein_id gnl|my_center|LOCUS_01240 119321 118047 gene locus_tag LOCUS_01250 119321 118047 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229857.1 protein_id gnl|my_center|LOCUS_01250 122237 119715 gene locus_tag LOCUS_01260 122237 119715 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_01260 122994 122242 gene locus_tag LOCUS_01270 122994 122242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_01270 123791 123402 gene locus_tag LOCUS_01280 123791 123402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 124087 125076 gene locus_tag LOCUS_01290 124087 125076 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112461.1 protein_id gnl|my_center|LOCUS_01290 125245 126402 gene locus_tag LOCUS_01300 125245 126402 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_01300 126571 126978 gene locus_tag LOCUS_01310 126571 126978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 129953 126963 gene locus_tag LOCUS_01320 129953 126963 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224347.1 protein_id gnl|my_center|LOCUS_01320 130153 129965 gene locus_tag LOCUS_01330 130153 129965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 132650 130335 gene locus_tag LOCUS_01340 132650 130335 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027789.1 protein_id gnl|my_center|LOCUS_01340 135627 132772 gene locus_tag LOCUS_01350 135627 132772 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_01350 136657 136010 gene locus_tag LOCUS_01360 136657 136010 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224042.1 protein_id gnl|my_center|LOCUS_01360 136998 136807 gene locus_tag LOCUS_01370 136998 136807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 137863 137015 gene locus_tag LOCUS_01380 137863 137015 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_01380 138032 138355 gene locus_tag LOCUS_01390 138032 138355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 140789 138591 gene locus_tag LOCUS_01400 140789 138591 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224095.1 protein_id gnl|my_center|LOCUS_01400 141726 141109 gene locus_tag LOCUS_01410 141726 141109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 143196 141751 gene locus_tag LOCUS_01420 gene gndA 143196 141751 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 protein_id gnl|my_center|LOCUS_01420 143314 144321 gene locus_tag LOCUS_01430 143314 144321 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026991.1 protein_id gnl|my_center|LOCUS_01430 144639 144403 gene locus_tag LOCUS_01440 144639 144403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 144530 146362 gene locus_tag LOCUS_01450 144530 146362 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_01450 146439 147821 gene locus_tag LOCUS_01460 146439 147821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 149679 147907 gene locus_tag LOCUS_01470 149679 147907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 150350 149748 gene locus_tag LOCUS_01480 150350 149748 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230026.1 protein_id gnl|my_center|LOCUS_01480 150410 150916 gene locus_tag LOCUS_01490 150410 150916 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_01490 150943 152331 gene locus_tag LOCUS_01500 150943 152331 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_01500 152361 152660 gene locus_tag LOCUS_01510 152361 152660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 152657 153046 gene locus_tag LOCUS_01520 152657 153046 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_01520 153627 153067 gene locus_tag LOCUS_01530 153627 153067 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230158.1 protein_id gnl|my_center|LOCUS_01530 154408 153848 gene locus_tag LOCUS_01540 154408 153848 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230158.1 protein_id gnl|my_center|LOCUS_01540 155385 154462 gene locus_tag LOCUS_01550 155385 154462 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_01550 156788 155394 gene locus_tag LOCUS_01560 gene pyk 156788 155394 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466825.1 protein_id gnl|my_center|LOCUS_01560 156901 157251 gene locus_tag LOCUS_01570 156901 157251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 158376 157696 gene locus_tag LOCUS_01580 158376 157696 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_01580 158425 160410 gene locus_tag LOCUS_01590 158425 160410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 160830 160465 gene locus_tag LOCUS_01600 160830 160465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 161848 160913 gene locus_tag LOCUS_01610 gene mpr 161848 160913 CDS product extracellular metalloprotease Mpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246370.1 protein_id gnl|my_center|LOCUS_01610 163626 162121 gene locus_tag LOCUS_01620 163626 162121 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224181.1 protein_id gnl|my_center|LOCUS_01620 168157 163619 gene locus_tag LOCUS_01630 gene gltB 168157 163619 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224180.1 protein_id gnl|my_center|LOCUS_01630 169892 168522 gene locus_tag LOCUS_01640 169892 168522 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766635.1 protein_id gnl|my_center|LOCUS_01640 170034 170978 gene locus_tag LOCUS_01650 170034 170978 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_01650 172339 170975 gene locus_tag LOCUS_01660 172339 170975 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_01660 172409 172945 gene locus_tag LOCUS_01670 172409 172945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803693.1 protein_id gnl|my_center|LOCUS_01670 173618 172953 gene locus_tag LOCUS_01680 173618 172953 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_01680 174664 173624 gene locus_tag LOCUS_01690 gene lgt 174664 173624 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466801.1 protein_id gnl|my_center|LOCUS_01690 175281 174697 gene locus_tag LOCUS_01700 175281 174697 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224171.1 protein_id gnl|my_center|LOCUS_01700 176217 175432 gene locus_tag LOCUS_01710 gene trpA 176217 175432 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224169.1 protein_id gnl|my_center|LOCUS_01710 177437 176214 gene locus_tag LOCUS_01720 gene trpB 177437 176214 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_01720 178267 177458 gene locus_tag LOCUS_01730 gene trpC 178267 177458 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_01730 178957 178478 gene locus_tag LOCUS_01740 178957 178478 CDS product Trp biosynthesis-associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224166.1 protein_id gnl|my_center|LOCUS_01740 180491 178950 gene locus_tag LOCUS_01750 180491 178950 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_01750 180586 181200 gene locus_tag LOCUS_01760 180586 181200 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224164.1 protein_id gnl|my_center|LOCUS_01760 181560 181207 gene locus_tag LOCUS_01770 gene hisI 181560 181207 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407963.1 protein_id gnl|my_center|LOCUS_01770 181934 181557 gene locus_tag LOCUS_01780 181934 181557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 182707 181934 gene locus_tag LOCUS_01790 gene hisF 182707 181934 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_01790 183038 183241 gene locus_tag LOCUS_01800 183038 183241 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_01800 183313 183687 gene locus_tag LOCUS_01810 183313 183687 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 protein_id gnl|my_center|LOCUS_01810 183737 184462 gene locus_tag LOCUS_01820 183737 184462 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222330.1 protein_id gnl|my_center|LOCUS_01820 185159 184425 gene locus_tag LOCUS_01830 gene priA 185159 184425 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466797.1 protein_id gnl|my_center|LOCUS_01830 185814 185179 gene locus_tag LOCUS_01840 gene hisH 185814 185179 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224143.1 protein_id gnl|my_center|LOCUS_01840 186337 185867 gene locus_tag LOCUS_01850 186337 185867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 187246 186347 gene locus_tag LOCUS_01860 187246 186347 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_01860 187929 187243 gene locus_tag LOCUS_01870 187929 187243 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222581.1 protein_id gnl|my_center|LOCUS_01870 188010 188453 gene locus_tag LOCUS_01880 gene soxR 188010 188453 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_01880 188488 189021 gene locus_tag LOCUS_01890 188488 189021 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466793.1 protein_id gnl|my_center|LOCUS_01890 189583 188993 gene locus_tag LOCUS_01900 189583 188993 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_01900 189911 189756 gene locus_tag LOCUS_01910 189911 189756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 190511 189912 gene locus_tag LOCUS_01920 gene hisB 190511 189912 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224129.1 protein_id gnl|my_center|LOCUS_01920 191611 190508 gene locus_tag LOCUS_01930 191611 190508 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_01930 192924 191608 gene locus_tag LOCUS_01940 gene hisD 192924 191608 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 protein_id gnl|my_center|LOCUS_01940 193078 194391 gene locus_tag LOCUS_01950 193078 194391 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_01950 195502 194372 gene locus_tag LOCUS_01960 195502 194372 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975381.1 protein_id gnl|my_center|LOCUS_01960 197111 195567 gene locus_tag LOCUS_01970 197111 195567 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_01970 197141 197917 gene locus_tag LOCUS_01980 197141 197917 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224126.1 protein_id gnl|my_center|LOCUS_01980 198030 198956 gene locus_tag LOCUS_01990 198030 198956 CDS product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 protein_id gnl|my_center|LOCUS_01990 199886 199056 gene locus_tag LOCUS_02000 gene nadC 199886 199056 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224104.1 protein_id gnl|my_center|LOCUS_02000 201505 199883 gene locus_tag LOCUS_02010 201505 199883 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831489.1 protein_id gnl|my_center|LOCUS_02010 202521 201502 gene locus_tag LOCUS_02020 gene nadA 202521 201502 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224102.1 protein_id gnl|my_center|LOCUS_02020 202607 203275 gene locus_tag LOCUS_02030 202607 203275 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224101.1 protein_id gnl|my_center|LOCUS_02030 203481 203572 gene locus_tag LOCUS_t00020 203481 203572 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 203972 204715 gene locus_tag LOCUS_02040 gene aroD 203972 204715 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876205.1 protein_id gnl|my_center|LOCUS_02040 204971 206233 gene locus_tag LOCUS_02050 204971 206233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230109.1 protein_id gnl|my_center|LOCUS_02050 206230 206991 gene locus_tag LOCUS_02060 206230 206991 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027775.1 protein_id gnl|my_center|LOCUS_02060 207594 206998 gene locus_tag LOCUS_02070 207594 206998 CDS product DUF2567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224098.1 protein_id gnl|my_center|LOCUS_02070 207843 207634 gene locus_tag LOCUS_02080 207843 207634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908205.1 protein_id gnl|my_center|LOCUS_02080 208856 207840 gene locus_tag LOCUS_02090 gene bioB 208856 207840 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307266.1 protein_id gnl|my_center|LOCUS_02090 209680 208958 gene locus_tag LOCUS_02100 gene bioD 209680 208958 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742103.1 protein_id gnl|my_center|LOCUS_02100 209735 209974 gene locus_tag LOCUS_02110 209735 209974 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994234.1 protein_id gnl|my_center|LOCUS_02110 209976 210617 gene locus_tag LOCUS_02120 209976 210617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 211865 210597 gene locus_tag LOCUS_02130 211865 210597 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_02130 213081 211852 gene locus_tag LOCUS_02140 213081 211852 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_02140 216703 213170 gene locus_tag LOCUS_02150 gene dnaE 216703 213170 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_02150 216917 217828 gene locus_tag LOCUS_02160 216917 217828 CDS product AsnC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224837.1 protein_id gnl|my_center|LOCUS_02160 219131 217917 gene locus_tag LOCUS_02170 219131 217917 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_02170 220176 219241 gene locus_tag LOCUS_02180 220176 219241 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 protein_id gnl|my_center|LOCUS_02180 220760 220173 gene locus_tag LOCUS_02190 gene lspA 220760 220173 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947675.1 protein_id gnl|my_center|LOCUS_02190 222103 220784 gene locus_tag LOCUS_02200 222103 220784 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_02200 223798 222317 gene locus_tag LOCUS_02210 223798 222317 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224832.1 protein_id gnl|my_center|LOCUS_02210 224250 223969 gene locus_tag LOCUS_02220 224250 223969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 224791 224243 gene locus_tag LOCUS_02230 224791 224243 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_02230 224850 225311 gene locus_tag LOCUS_02240 224850 225311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 225380 225940 gene locus_tag LOCUS_02250 225380 225940 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229904.1 protein_id gnl|my_center|LOCUS_02250 225937 226605 gene locus_tag LOCUS_02260 225937 226605 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222253.1 protein_id gnl|my_center|LOCUS_02260 229779 226672 gene locus_tag LOCUS_02270 gene ileS 229779 226672 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224829.1 protein_id gnl|my_center|LOCUS_02270 230579 230049 gene locus_tag LOCUS_02280 230579 230049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224826.1 protein_id gnl|my_center|LOCUS_02280 231423 230608 gene locus_tag LOCUS_02290 231423 230608 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224825.1 protein_id gnl|my_center|LOCUS_02290 231765 231475 gene locus_tag LOCUS_02300 231765 231475 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224824.1 protein_id gnl|my_center|LOCUS_02300 232403 231786 gene locus_tag LOCUS_02310 gene sepF 232403 231786 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224823.1 protein_id gnl|my_center|LOCUS_02310 233173 232475 gene locus_tag LOCUS_02320 233173 232475 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_02320 233874 233170 gene locus_tag LOCUS_02330 gene pgeF 233874 233170 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224821.1 protein_id gnl|my_center|LOCUS_02330 235487 234147 gene locus_tag LOCUS_02340 gene ftsZ 235487 234147 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224820.1 protein_id gnl|my_center|LOCUS_02340 236209 235697 gene locus_tag LOCUS_02350 236209 235697 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224813.1 protein_id gnl|my_center|LOCUS_02350 237052 236294 gene locus_tag LOCUS_02360 237052 236294 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 protein_id gnl|my_center|LOCUS_02360 238446 237049 gene locus_tag LOCUS_02370 gene murC 238446 237049 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_02370 239546 238443 gene locus_tag LOCUS_02380 gene murG 239546 238443 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228037.1 protein_id gnl|my_center|LOCUS_02380 241042 239591 gene locus_tag LOCUS_02390 gene ftsW 241042 239591 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228038.1 protein_id gnl|my_center|LOCUS_02390 241281 241535 gene locus_tag LOCUS_02400 241281 241535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 242884 241520 gene locus_tag LOCUS_02410 gene murD 242884 241520 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228039.1 protein_id gnl|my_center|LOCUS_02410 243975 242887 gene locus_tag LOCUS_02420 gene mraY 243975 242887 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_02420 245432 243972 gene locus_tag LOCUS_02430 245432 243972 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228041.1 protein_id gnl|my_center|LOCUS_02430 246958 245429 gene locus_tag LOCUS_02440 246958 245429 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228042.1 protein_id gnl|my_center|LOCUS_02440 249035 247128 gene locus_tag LOCUS_02450 249035 247128 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467433.1 protein_id gnl|my_center|LOCUS_02450 249716 249075 gene locus_tag LOCUS_02460 249716 249075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 250660 249713 gene locus_tag LOCUS_02470 gene rsmH 250660 249713 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_02470 251262 250831 gene locus_tag LOCUS_02480 gene mraZ 251262 250831 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_02480 251723 252850 gene locus_tag LOCUS_02490 251723 252850 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_02490 252852 254117 gene locus_tag LOCUS_02500 252852 254117 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228053.1 protein_id gnl|my_center|LOCUS_02500 254118 256556 gene locus_tag LOCUS_02510 254118 256556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 257282 256899 gene locus_tag LOCUS_02520 257282 256899 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228055.1 protein_id gnl|my_center|LOCUS_02520 259398 258457 gene locus_tag LOCUS_02530 259398 258457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223143.1 protein_id gnl|my_center|LOCUS_02530 259847 259587 gene locus_tag LOCUS_02540 259847 259587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 260573 259932 gene locus_tag LOCUS_02550 260573 259932 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225956012.1 protein_id gnl|my_center|LOCUS_02550 261943 260642 gene locus_tag LOCUS_02560 gene dinB 261943 260642 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_02560 263061 261982 gene locus_tag LOCUS_02570 263061 261982 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224176.1 protein_id gnl|my_center|LOCUS_02570 263119 264450 gene locus_tag LOCUS_02580 263119 264450 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284314.1 protein_id gnl|my_center|LOCUS_02580 265080 264469 gene locus_tag LOCUS_02590 265080 264469 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468912.1 protein_id gnl|my_center|LOCUS_02590 265881 265291 gene locus_tag LOCUS_02600 265881 265291 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468912.1 protein_id gnl|my_center|LOCUS_02600 266658 265960 gene locus_tag LOCUS_02610 266658 265960 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228057.1 protein_id gnl|my_center|LOCUS_02610 266681 267553 gene locus_tag LOCUS_02620 266681 267553 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_02620 267563 268357 gene locus_tag LOCUS_02630 267563 268357 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228059.1 protein_id gnl|my_center|LOCUS_02630 268368 269390 gene locus_tag LOCUS_02640 268368 269390 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_02640 270695 269451 gene locus_tag LOCUS_02650 270695 269451 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 protein_id gnl|my_center|LOCUS_02650 271692 270916 gene locus_tag LOCUS_02660 271692 270916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 272572 271709 gene locus_tag LOCUS_02670 272572 271709 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228065.1 protein_id gnl|my_center|LOCUS_02670 273282 272857 gene locus_tag LOCUS_02680 273282 272857 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467438.1 protein_id gnl|my_center|LOCUS_02680 273930 273439 gene locus_tag LOCUS_02690 273930 273439 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 protein_id gnl|my_center|LOCUS_02690 274511 273927 gene locus_tag LOCUS_02700 gene pgsA 274511 273927 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_02700 275917 274508 gene locus_tag LOCUS_02710 gene rimO 275917 274508 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 protein_id gnl|my_center|LOCUS_02710 276259 275981 gene locus_tag LOCUS_02720 276259 275981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 276599 276222 gene locus_tag LOCUS_02730 276599 276222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 276964 277464 gene locus_tag LOCUS_02740 276964 277464 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894076.1 protein_id gnl|my_center|LOCUS_02740 277528 278382 gene locus_tag LOCUS_02750 277528 278382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 278379 278756 gene locus_tag LOCUS_02760 278379 278756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 278753 279010 gene locus_tag LOCUS_02770 278753 279010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 279402 279839 gene locus_tag LOCUS_02780 279402 279839 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228071.1 protein_id gnl|my_center|LOCUS_02780 280584 279907 gene locus_tag LOCUS_02790 280584 279907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224938.1 protein_id gnl|my_center|LOCUS_02790 283242 280801 gene locus_tag LOCUS_02800 283242 280801 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228076.1 protein_id gnl|my_center|LOCUS_02800 283508 283284 gene locus_tag LOCUS_02810 283508 283284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 283398 284162 gene locus_tag LOCUS_02820 283398 284162 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655759.1 protein_id gnl|my_center|LOCUS_02820 286099 284417 gene locus_tag LOCUS_02830 286099 284417 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454980.1 protein_id gnl|my_center|LOCUS_02830 286947 286096 gene locus_tag LOCUS_02840 gene dapA 286947 286096 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878175.1 protein_id gnl|my_center|LOCUS_02840 287651 287031 gene locus_tag LOCUS_02850 287651 287031 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230583.1 protein_id gnl|my_center|LOCUS_02850 289076 287661 gene locus_tag LOCUS_02860 289076 287661 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228086.1 protein_id gnl|my_center|LOCUS_02860 289577 289188 gene locus_tag LOCUS_02870 289577 289188 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228089.1 protein_id gnl|my_center|LOCUS_02870 290335 289583 gene locus_tag LOCUS_02880 gene thyX 290335 289583 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228090.1 protein_id gnl|my_center|LOCUS_02880 290511 291032 gene locus_tag LOCUS_02890 290511 291032 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228091.1 protein_id gnl|my_center|LOCUS_02890 291042 291929 gene locus_tag LOCUS_02900 291042 291929 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228092.1 protein_id gnl|my_center|LOCUS_02900 292593 292009 gene locus_tag LOCUS_02910 292593 292009 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173393.1 protein_id gnl|my_center|LOCUS_02910 293677 292664 gene locus_tag LOCUS_02920 293677 292664 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_02920 294962 293742 gene locus_tag LOCUS_02930 294962 293742 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228093.1 protein_id gnl|my_center|LOCUS_02930 295824 294943 gene locus_tag LOCUS_02940 gene yedA 295824 294943 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_02940 295937 296488 gene locus_tag LOCUS_02950 295937 296488 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228094.1 protein_id gnl|my_center|LOCUS_02950 296510 297010 gene locus_tag LOCUS_02960 296510 297010 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228095.1 protein_id gnl|my_center|LOCUS_02960 297320 296958 gene locus_tag LOCUS_02970 297320 296958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 298177 297398 gene locus_tag LOCUS_02980 298177 297398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 298863 298405 gene locus_tag LOCUS_02990 298863 298405 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285688.1 protein_id gnl|my_center|LOCUS_02990 299593 298886 gene locus_tag LOCUS_03000 gene dapB 299593 298886 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228101.1 protein_id gnl|my_center|LOCUS_03000 301047 299641 gene locus_tag LOCUS_03010 301047 299641 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228102.1 protein_id gnl|my_center|LOCUS_03010 303287 301044 gene locus_tag LOCUS_03020 303287 301044 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228103.1 protein_id gnl|my_center|LOCUS_03020 303778 303509 gene locus_tag LOCUS_03030 gene rpsO 303778 303509 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084034.1 protein_id gnl|my_center|LOCUS_03030 304355 303903 gene locus_tag LOCUS_03040 gene thpR 304355 303903 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228104.1 protein_id gnl|my_center|LOCUS_03040 304934 304386 gene locus_tag LOCUS_03050 304934 304386 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228105.1 protein_id gnl|my_center|LOCUS_03050 305907 304966 gene locus_tag LOCUS_03060 305907 304966 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 protein_id gnl|my_center|LOCUS_03060 306344 305955 gene locus_tag LOCUS_03070 306344 305955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 307234 306377 gene locus_tag LOCUS_03080 gene truB 307234 306377 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_03080 308775 307453 gene locus_tag LOCUS_03090 308775 307453 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228110.1 protein_id gnl|my_center|LOCUS_03090 310174 308876 gene locus_tag LOCUS_03100 310174 308876 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228111.1 protein_id gnl|my_center|LOCUS_03100 309020 308931 gene locus_tag LOCUS_t00030 309020 308931 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 311308 310268 gene locus_tag LOCUS_03110 311308 310268 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228112.1 protein_id gnl|my_center|LOCUS_03110 311768 311319 gene locus_tag LOCUS_03120 gene rbfA 311768 311319 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228119.1 protein_id gnl|my_center|LOCUS_03120 312115 311819 gene locus_tag LOCUS_03130 312115 311819 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_03130 315292 312188 gene locus_tag LOCUS_03140 315292 312188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 315650 315381 gene locus_tag LOCUS_03150 315650 315381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 316770 315748 gene locus_tag LOCUS_03160 gene nusA 316770 315748 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228123.1 protein_id gnl|my_center|LOCUS_03160 317291 316767 gene locus_tag LOCUS_03170 gene rimP 317291 316767 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_03170 317549 317412 gene locus_tag LOCUS_03180 317549 317412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 317506 317916 gene locus_tag LOCUS_03190 317506 317916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03190 317913 318347 gene locus_tag LOCUS_03200 317913 318347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03200 319106 318348 gene locus_tag LOCUS_03210 319106 318348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033262539.1 protein_id gnl|my_center|LOCUS_03210 320133 319132 gene locus_tag LOCUS_03220 320133 319132 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228127.1 protein_id gnl|my_center|LOCUS_03220 320620 320141 gene locus_tag LOCUS_03230 320620 320141 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_03230 321427 320651 gene locus_tag LOCUS_03240 gene fabG 321427 320651 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_03240 321485 321892 gene locus_tag LOCUS_03250 321485 321892 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_03250 322819 321788 gene locus_tag LOCUS_03260 322819 321788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742186.1 protein_id gnl|my_center|LOCUS_03260 322946 323854 gene locus_tag LOCUS_03270 322946 323854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 323851 324546 gene locus_tag LOCUS_03280 323851 324546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 324543 325223 gene locus_tag LOCUS_03290 324543 325223 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223969.1 protein_id gnl|my_center|LOCUS_03290 327005 325260 gene locus_tag LOCUS_03300 327005 325260 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_03300 327132 327482 gene locus_tag LOCUS_03310 327132 327482 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 protein_id gnl|my_center|LOCUS_03310 327613 328350 gene locus_tag LOCUS_03320 gene yaaA 327613 328350 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223956.1 protein_id gnl|my_center|LOCUS_03320 328604 328362 gene locus_tag LOCUS_03330 328604 328362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 328691 329641 gene locus_tag LOCUS_03340 328691 329641 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092179.1 protein_id gnl|my_center|LOCUS_03340 329709 330221 gene locus_tag LOCUS_03350 329709 330221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 330446 331423 gene locus_tag LOCUS_03360 330446 331423 CDS product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 protein_id gnl|my_center|LOCUS_03360 331842 333332 gene locus_tag LOCUS_03370 331842 333332 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223946.1 protein_id gnl|my_center|LOCUS_03370 333577 334416 gene locus_tag LOCUS_03380 333577 334416 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878192.1 protein_id gnl|my_center|LOCUS_03380 335420 334536 gene locus_tag LOCUS_03390 335420 334536 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_03390 335509 336450 gene locus_tag LOCUS_03400 335509 336450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 protein_id gnl|my_center|LOCUS_03400 337612 336395 gene locus_tag LOCUS_03410 gene cobA 337612 336395 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226827.1 protein_id gnl|my_center|LOCUS_03410 337938 337672 gene locus_tag LOCUS_03420 337938 337672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 338801 338010 gene locus_tag LOCUS_03430 338801 338010 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_03430 340163 338904 gene locus_tag LOCUS_03440 340163 338904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 341017 340160 gene locus_tag LOCUS_03450 341017 340160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 342092 341019 gene locus_tag LOCUS_03460 342092 341019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 343534 342158 gene locus_tag LOCUS_03470 343534 342158 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899509.1 protein_id gnl|my_center|LOCUS_03470 344142 343528 gene locus_tag LOCUS_03480 gene cobO 344142 343528 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228816.1 protein_id gnl|my_center|LOCUS_03480 346246 344153 gene locus_tag LOCUS_03490 346246 344153 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228817.1 protein_id gnl|my_center|LOCUS_03490 347551 346343 gene locus_tag LOCUS_03500 347551 346343 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013726.1 protein_id gnl|my_center|LOCUS_03500 347612 348766 gene locus_tag LOCUS_03510 347612 348766 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223945.1 protein_id gnl|my_center|LOCUS_03510 349178 348720 gene locus_tag LOCUS_03520 349178 348720 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728473.1 protein_id gnl|my_center|LOCUS_03520 349918 349199 gene locus_tag LOCUS_03530 349918 349199 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_03530 350096 350701 gene locus_tag LOCUS_03540 350096 350701 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229511.1 protein_id gnl|my_center|LOCUS_03540 351517 350765 gene locus_tag LOCUS_03550 351517 350765 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_03550 352612 351590 gene locus_tag LOCUS_03560 352612 351590 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224099.1 protein_id gnl|my_center|LOCUS_03560 352668 353615 gene locus_tag LOCUS_03570 352668 353615 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081672.1 protein_id gnl|my_center|LOCUS_03570 355626 353713 gene locus_tag LOCUS_03580 355626 353713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 356693 355791 gene locus_tag LOCUS_03590 356693 355791 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228724.1 protein_id gnl|my_center|LOCUS_03590 356802 357743 gene locus_tag LOCUS_03600 356802 357743 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029226.1 protein_id gnl|my_center|LOCUS_03600 357740 358576 gene locus_tag LOCUS_03610 357740 358576 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029227.1 protein_id gnl|my_center|LOCUS_03610 359373 358573 gene locus_tag LOCUS_03620 359373 358573 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_03620 359526 361901 gene locus_tag LOCUS_03630 gene lon 359526 361901 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222513.1 protein_id gnl|my_center|LOCUS_03630 363811 362174 gene locus_tag LOCUS_03640 363811 362174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 364408 363923 gene locus_tag LOCUS_03650 364408 363923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227878.1 protein_id gnl|my_center|LOCUS_03650 365294 364476 gene locus_tag LOCUS_03660 365294 364476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 365503 366030 gene locus_tag LOCUS_03670 365503 366030 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_03670 366143 367519 gene locus_tag LOCUS_03680 366143 367519 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_03680 368859 367723 gene locus_tag LOCUS_03690 368859 367723 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877490.1 protein_id gnl|my_center|LOCUS_03690 369117 369734 gene locus_tag LOCUS_03700 369117 369734 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223939.1 protein_id gnl|my_center|LOCUS_03700 369798 370049 gene locus_tag LOCUS_03710 369798 370049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 371147 370239 gene locus_tag LOCUS_03720 371147 370239 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028565.1 protein_id gnl|my_center|LOCUS_03720 371221 372174 gene locus_tag LOCUS_03730 371221 372174 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 protein_id gnl|my_center|LOCUS_03730 372401 373330 gene locus_tag LOCUS_03740 372401 373330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 375189 373666 gene locus_tag LOCUS_03750 375189 373666 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093851.1 protein_id gnl|my_center|LOCUS_03750 375232 375930 gene locus_tag LOCUS_03760 375232 375930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 376774 375917 gene locus_tag LOCUS_03770 gene map 376774 375917 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223934.1 protein_id gnl|my_center|LOCUS_03770 377007 376840 gene locus_tag LOCUS_03780 377007 376840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 378863 377031 gene locus_tag LOCUS_03790 378863 377031 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 protein_id gnl|my_center|LOCUS_03790 379730 378876 gene locus_tag LOCUS_03800 379730 378876 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466751.1 protein_id gnl|my_center|LOCUS_03800 380959 379802 gene locus_tag LOCUS_03810 gene ispG 380959 379802 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_03810 382178 380982 gene locus_tag LOCUS_03820 382178 380982 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893934.1 protein_id gnl|my_center|LOCUS_03820 383400 382180 gene locus_tag LOCUS_03830 gene dxr 383400 382180 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284246.1 protein_id gnl|my_center|LOCUS_03830 383555 383821 gene locus_tag LOCUS_03840 383555 383821 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_03840 384508 383894 gene locus_tag LOCUS_03850 384508 383894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031847.1 protein_id gnl|my_center|LOCUS_03850 386208 384547 gene locus_tag LOCUS_03860 386208 384547 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223179.1 protein_id gnl|my_center|LOCUS_03860 385051 384977 gene locus_tag LOCUS_t00040 385051 384977 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 387074 386229 gene locus_tag LOCUS_03870 387074 386229 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037481.1 protein_id gnl|my_center|LOCUS_03870 387916 387071 gene locus_tag LOCUS_03880 387916 387071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257554.1 protein_id gnl|my_center|LOCUS_03880 389067 387913 gene locus_tag LOCUS_03890 389067 387913 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920973.1 protein_id gnl|my_center|LOCUS_03890 390235 389060 gene locus_tag LOCUS_03900 390235 389060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_03900 390444 390701 gene locus_tag LOCUS_03910 390444 390701 CDS product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223923.1 protein_id gnl|my_center|LOCUS_03910 391829 390846 gene locus_tag LOCUS_03920 391829 390846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 392221 391946 gene locus_tag LOCUS_03930 gene relE 392221 391946 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898789.1 protein_id gnl|my_center|LOCUS_03930 392496 392218 gene locus_tag LOCUS_03940 392496 392218 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406322.1 protein_id gnl|my_center|LOCUS_03940 393638 392532 gene locus_tag LOCUS_03950 gene rlmN 393638 392532 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223876.1 protein_id gnl|my_center|LOCUS_03950 393771 394430 gene locus_tag LOCUS_03960 393771 394430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 395415 394432 gene locus_tag LOCUS_03970 395415 394432 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_03970 396185 395439 gene locus_tag LOCUS_03980 396185 395439 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_03980 396241 397059 gene locus_tag LOCUS_03990 396241 397059 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223867.1 protein_id gnl|my_center|LOCUS_03990 397907 397056 gene locus_tag LOCUS_04000 397907 397056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 398548 397991 gene locus_tag LOCUS_04010 gene frr 398548 397991 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_04010 399377 398595 gene locus_tag LOCUS_04020 gene pyrH 399377 398595 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_04020 400260 399445 gene locus_tag LOCUS_04030 gene tsf 400260 399445 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899527.1 protein_id gnl|my_center|LOCUS_04030 401280 400423 gene locus_tag LOCUS_04040 gene rpsB 401280 400423 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223862.1 protein_id gnl|my_center|LOCUS_04040 401631 402254 gene locus_tag LOCUS_04050 401631 402254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 403521 402523 gene locus_tag LOCUS_04060 403521 402523 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_04060 404473 403496 gene locus_tag LOCUS_04070 404473 403496 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_04070 405655 404507 gene locus_tag LOCUS_04080 gene dprA 405655 404507 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742183.1 protein_id gnl|my_center|LOCUS_04080 407348 405837 gene locus_tag LOCUS_04090 407348 405837 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189256709.1 protein_id gnl|my_center|LOCUS_04090 407701 407348 gene locus_tag LOCUS_04100 407701 407348 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223856.1 protein_id gnl|my_center|LOCUS_04100 408243 407920 gene locus_tag LOCUS_04110 408243 407920 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_04110 409037 408243 gene locus_tag LOCUS_04120 409037 408243 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223855.1 protein_id gnl|my_center|LOCUS_04120 409949 409047 gene locus_tag LOCUS_04130 gene lepB 409949 409047 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227333.1 protein_id gnl|my_center|LOCUS_04130 410856 409966 gene locus_tag LOCUS_04140 gene lepB 410856 409966 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223854.1 protein_id gnl|my_center|LOCUS_04140 411262 410903 gene locus_tag LOCUS_04150 gene rplS 411262 410903 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_04150 412175 411432 gene locus_tag LOCUS_04160 gene trmD 412175 411432 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 protein_id gnl|my_center|LOCUS_04160 412683 412165 gene locus_tag LOCUS_04170 gene rimM 412683 412165 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_04170 412931 412692 gene locus_tag LOCUS_04180 412931 412692 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103110.1 protein_id gnl|my_center|LOCUS_04180 413380 412928 gene locus_tag LOCUS_04190 gene rpsP 413380 412928 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223849.1 protein_id gnl|my_center|LOCUS_04190 414301 413534 gene locus_tag LOCUS_04200 414301 413534 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027118.1 protein_id gnl|my_center|LOCUS_04200 415005 414298 gene locus_tag LOCUS_04210 415005 414298 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223848.1 protein_id gnl|my_center|LOCUS_04210 415800 415090 gene locus_tag LOCUS_04220 415800 415090 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223847.1 protein_id gnl|my_center|LOCUS_04220 417019 415943 gene locus_tag LOCUS_04230 417019 415943 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223846.1 protein_id gnl|my_center|LOCUS_04230 418563 417016 gene locus_tag LOCUS_04240 gene ffh 418563 417016 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223845.1 protein_id gnl|my_center|LOCUS_04240 419161 418619 gene locus_tag LOCUS_04250 419161 418619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 421799 419415 gene locus_tag LOCUS_04260 421799 419415 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223834.1 protein_id gnl|my_center|LOCUS_04260 422153 421815 gene locus_tag LOCUS_04270 422153 421815 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_04270 423493 422150 gene locus_tag LOCUS_04280 423493 422150 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_04280 424975 423968 gene locus_tag LOCUS_04290 gene alc 424975 423968 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223823.1 protein_id gnl|my_center|LOCUS_04290 426203 425001 gene locus_tag LOCUS_04300 gene allB 426203 425001 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_04300 426117 426467 gene locus_tag LOCUS_04310 426117 426467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 426615 427100 gene locus_tag LOCUS_04320 gene uraD 426615 427100 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223820.1 protein_id gnl|my_center|LOCUS_04320 427097 427390 gene locus_tag LOCUS_04330 gene uraH 427097 427390 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223819.1 protein_id gnl|my_center|LOCUS_04330 427394 428299 gene locus_tag LOCUS_04340 gene pucL 427394 428299 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_04340 428794 428336 gene locus_tag LOCUS_04350 428794 428336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 430084 428888 gene locus_tag LOCUS_04360 430084 428888 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_04360 431588 430086 gene locus_tag LOCUS_04370 gene aceB 431588 430086 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223803.1 protein_id gnl|my_center|LOCUS_04370 431704 432456 gene locus_tag LOCUS_04380 431704 432456 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223802.1 protein_id gnl|my_center|LOCUS_04380 433957 432584 gene locus_tag LOCUS_04390 gene ftsY 433957 432584 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223799.1 protein_id gnl|my_center|LOCUS_04390 434078 435238 gene locus_tag LOCUS_04400 434078 435238 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223798.1 protein_id gnl|my_center|LOCUS_04400 435225 436781 gene locus_tag LOCUS_04410 435225 436781 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223797.1 protein_id gnl|my_center|LOCUS_04410 437719 436787 gene locus_tag LOCUS_04420 437719 436787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 437887 439056 gene locus_tag LOCUS_04430 437887 439056 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_04430 439102 439437 gene locus_tag LOCUS_04440 439102 439437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230128.1 protein_id gnl|my_center|LOCUS_04440 439453 440151 gene locus_tag LOCUS_04450 439453 440151 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_04450 440213 440686 gene locus_tag LOCUS_04460 440213 440686 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976947.1 protein_id gnl|my_center|LOCUS_04460 444444 440683 gene locus_tag LOCUS_04470 gene smc 444444 440683 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223795.1 protein_id gnl|my_center|LOCUS_04470 445132 444476 gene locus_tag LOCUS_04480 445132 444476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 445635 445129 gene locus_tag LOCUS_04490 445635 445129 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_04490 445935 445669 gene locus_tag LOCUS_04500 445935 445669 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_04500 446003 446731 gene locus_tag LOCUS_04510 446003 446731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 446763 447254 gene locus_tag LOCUS_04520 446763 447254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 447388 447864 gene locus_tag LOCUS_04530 447388 447864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 448395 447865 gene locus_tag LOCUS_04540 448395 447865 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065204181.1 protein_id gnl|my_center|LOCUS_04540 448464 449573 gene locus_tag LOCUS_04550 448464 449573 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_04550 450170 449577 gene locus_tag LOCUS_04560 450170 449577 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265774.1 protein_id gnl|my_center|LOCUS_04560 450869 450207 gene locus_tag LOCUS_04570 450869 450207 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223789.1 protein_id gnl|my_center|LOCUS_04570 451138 451572 gene locus_tag LOCUS_04580 451138 451572 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230986.1 protein_id gnl|my_center|LOCUS_04580 452434 451577 gene locus_tag LOCUS_04590 gene mutM 452434 451577 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_04590 452675 452445 gene locus_tag LOCUS_04600 452675 452445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 453504 452683 gene locus_tag LOCUS_04610 gene rnc 453504 452683 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_04610 453717 453535 gene locus_tag LOCUS_04620 gene rpmF 453717 453535 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223689.1 protein_id gnl|my_center|LOCUS_04620 454196 453720 gene locus_tag LOCUS_04630 454196 453720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 455129 454413 gene locus_tag LOCUS_04640 455129 454413 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223687.1 protein_id gnl|my_center|LOCUS_04640 455642 455217 gene locus_tag LOCUS_04650 455642 455217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 456208 455708 gene locus_tag LOCUS_04660 gene coaD 456208 455708 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_04660 456811 456245 gene locus_tag LOCUS_04670 gene rsmD 456811 456245 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_04670 457706 456816 gene locus_tag LOCUS_04680 457706 456816 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_04680 461696 458319 gene locus_tag LOCUS_04690 461696 458319 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223655.1 protein_id gnl|my_center|LOCUS_04690 462070 463440 gene locus_tag LOCUS_04700 462070 463440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 464279 463470 gene locus_tag LOCUS_04710 464279 463470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 466521 464329 gene locus_tag LOCUS_04720 gene recG 466521 464329 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_04720 468173 466536 gene locus_tag LOCUS_04730 468173 466536 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223646.1 protein_id gnl|my_center|LOCUS_04730 468276 468467 gene locus_tag LOCUS_04740 gene rpmB 468276 468467 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091970.1 protein_id gnl|my_center|LOCUS_04740 468759 468550 gene locus_tag LOCUS_04750 468759 468550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 469527 468877 gene locus_tag LOCUS_04760 469527 468877 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_04760 470087 469566 gene locus_tag LOCUS_04770 470087 469566 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_04770 470541 470110 gene locus_tag LOCUS_04780 470541 470110 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_04780 471560 470595 gene locus_tag LOCUS_04790 471560 470595 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 protein_id gnl|my_center|LOCUS_04790 471658 471891 gene locus_tag LOCUS_04800 471658 471891 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_04800 471912 472475 gene locus_tag LOCUS_04810 471912 472475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 473546 472479 gene locus_tag LOCUS_04820 473546 472479 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223638.1 protein_id gnl|my_center|LOCUS_04820 475109 473715 gene locus_tag LOCUS_04830 475109 473715 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223637.1 protein_id gnl|my_center|LOCUS_04830 475177 475824 gene locus_tag LOCUS_04840 475177 475824 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_04840 476275 475808 gene locus_tag LOCUS_04850 476275 475808 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223628.1 protein_id gnl|my_center|LOCUS_04850 477533 476475 gene locus_tag LOCUS_04860 477533 476475 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728313.1 protein_id gnl|my_center|LOCUS_04860 478534 477530 gene locus_tag LOCUS_04870 478534 477530 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223627.1 protein_id gnl|my_center|LOCUS_04870 479243 478536 gene locus_tag LOCUS_04880 479243 478536 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223626.1 protein_id gnl|my_center|LOCUS_04880 479347 479955 gene locus_tag LOCUS_04890 gene cofC 479347 479955 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 protein_id gnl|my_center|LOCUS_04890 481501 479978 gene locus_tag LOCUS_04900 481501 479978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228691.1 protein_id gnl|my_center|LOCUS_04900 481613 481825 gene locus_tag LOCUS_04910 481613 481825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 482164 484176 gene locus_tag LOCUS_04920 482164 484176 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742242.1 protein_id gnl|my_center|LOCUS_04920 484181 485095 gene locus_tag LOCUS_04930 484181 485095 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223623.1 protein_id gnl|my_center|LOCUS_04930 485976 485290 gene locus_tag LOCUS_04940 485976 485290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 486788 486186 gene locus_tag LOCUS_04950 gene leuD 486788 486186 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_04950 488207 486804 gene locus_tag LOCUS_04960 gene leuC 488207 486804 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_04960 488279 488980 gene locus_tag LOCUS_04970 488279 488980 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560682.1 protein_id gnl|my_center|LOCUS_04970 489163 489090 gene locus_tag LOCUS_t00050 489163 489090 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 489320 489248 gene locus_tag LOCUS_t00060 489320 489248 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 490105 489422 gene locus_tag LOCUS_04980 490105 489422 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284413.1 protein_id gnl|my_center|LOCUS_04980 491685 490264 gene locus_tag LOCUS_04990 gene gltX 491685 490264 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081448.1 protein_id gnl|my_center|LOCUS_04990 491859 493106 gene locus_tag LOCUS_05000 491859 493106 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110188.1 protein_id gnl|my_center|LOCUS_05000 493769 493851 gene locus_tag LOCUS_t00070 493769 493851 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 493939 494568 gene locus_tag LOCUS_05010 493939 494568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 496144 494549 gene locus_tag LOCUS_05020 gene cimA 496144 494549 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223593.1 protein_id gnl|my_center|LOCUS_05020 497310 496333 gene locus_tag LOCUS_05030 497310 496333 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031519.1 protein_id gnl|my_center|LOCUS_05030 498056 497307 gene locus_tag LOCUS_05040 498056 497307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_05040 499129 498056 gene locus_tag LOCUS_05050 499129 498056 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_05050 500634 499597 gene locus_tag LOCUS_05060 500634 499597 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223592.1 protein_id gnl|my_center|LOCUS_05060 504165 500863 gene locus_tag LOCUS_05070 504165 500863 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_05070 506057 504468 gene locus_tag LOCUS_05080 gene serA 506057 504468 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223590.1 protein_id gnl|my_center|LOCUS_05080 506592 506323 gene locus_tag LOCUS_05090 506592 506323 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223584.1 protein_id gnl|my_center|LOCUS_05090 507668 506655 gene locus_tag LOCUS_05100 gene ilvC 507668 506655 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_05100 508212 507700 gene locus_tag LOCUS_05110 gene ilvN 508212 507700 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_05110 509948 508209 gene locus_tag LOCUS_05120 509948 508209 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_05120 510335 510784 gene locus_tag LOCUS_05130 510335 510784 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104354.1 protein_id gnl|my_center|LOCUS_05130 510808 511215 gene locus_tag LOCUS_05140 510808 511215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 511297 513144 gene locus_tag LOCUS_05150 gene ilvD 511297 513144 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 protein_id gnl|my_center|LOCUS_05150 513935 513273 gene locus_tag LOCUS_05160 513935 513273 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223579.1 protein_id gnl|my_center|LOCUS_05160 514994 514080 gene locus_tag LOCUS_05170 514994 514080 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466703.1 protein_id gnl|my_center|LOCUS_05170 514878 515894 gene locus_tag LOCUS_05180 514878 515894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 515923 517092 gene locus_tag LOCUS_05190 515923 517092 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223577.1 protein_id gnl|my_center|LOCUS_05190 517163 518104 gene locus_tag LOCUS_05200 517163 518104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223658.1 protein_id gnl|my_center|LOCUS_05200 518101 518472 gene locus_tag LOCUS_05210 518101 518472 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223657.1 protein_id gnl|my_center|LOCUS_05210 520943 518478 gene locus_tag LOCUS_05220 520943 518478 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117302210.1 protein_id gnl|my_center|LOCUS_05220 523658 521037 gene locus_tag LOCUS_05230 523658 521037 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229380.1 protein_id gnl|my_center|LOCUS_05230 524027 523746 gene locus_tag LOCUS_05240 524027 523746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 526003 524501 gene locus_tag LOCUS_05250 gene gatB 526003 524501 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_05250 526191 526000 gene locus_tag LOCUS_05260 526191 526000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 527708 526188 gene locus_tag LOCUS_05270 gene gatA 527708 526188 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_05270 527243 527154 gene locus_tag LOCUS_t00080 527243 527154 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 528004 527705 gene locus_tag LOCUS_05280 gene gatC 528004 527705 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_05280 528223 528876 gene locus_tag LOCUS_05290 528223 528876 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284416.1 protein_id gnl|my_center|LOCUS_05290 529665 529027 gene locus_tag LOCUS_05300 529665 529027 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224664.1 protein_id gnl|my_center|LOCUS_05300 530423 529716 gene locus_tag LOCUS_05310 530423 529716 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090118.1 protein_id gnl|my_center|LOCUS_05310 530450 530860 gene locus_tag LOCUS_05320 530450 530860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 531347 530841 gene locus_tag LOCUS_05330 531347 530841 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223567.1 protein_id gnl|my_center|LOCUS_05330 531642 533561 gene locus_tag LOCUS_05340 531642 533561 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971555.1 protein_id gnl|my_center|LOCUS_05340 533576 534316 gene locus_tag LOCUS_05350 533576 534316 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 protein_id gnl|my_center|LOCUS_05350 534818 535033 gene locus_tag LOCUS_05360 534818 535033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 537476 535311 gene locus_tag LOCUS_05370 gene ligA 537476 535311 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223566.1 protein_id gnl|my_center|LOCUS_05370 538158 537508 gene locus_tag LOCUS_05380 538158 537508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223565.1 protein_id gnl|my_center|LOCUS_05380 539073 538171 gene locus_tag LOCUS_05390 539073 538171 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226008.1 protein_id gnl|my_center|LOCUS_05390 539145 539933 gene locus_tag LOCUS_05400 539145 539933 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226007.1 protein_id gnl|my_center|LOCUS_05400 540655 539909 gene locus_tag LOCUS_05410 540655 539909 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225083.1 protein_id gnl|my_center|LOCUS_05410 542565 540652 gene locus_tag LOCUS_05420 542565 540652 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_05420 543196 542567 gene locus_tag LOCUS_05430 543196 542567 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_05430 543269 544174 gene locus_tag LOCUS_05440 543269 544174 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_05440 544186 544689 gene locus_tag LOCUS_05450 544186 544689 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_05450 545798 544788 gene locus_tag LOCUS_05460 545798 544788 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284403.1 protein_id gnl|my_center|LOCUS_05460 546005 547351 gene locus_tag LOCUS_05470 546005 547351 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222228.1 protein_id gnl|my_center|LOCUS_05470 547414 547827 gene locus_tag LOCUS_05480 gene paaI 547414 547827 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270401.1 protein_id gnl|my_center|LOCUS_05480 548170 547790 gene locus_tag LOCUS_05490 548170 547790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 549409 548234 gene locus_tag LOCUS_05500 549409 548234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110026.1 protein_id gnl|my_center|LOCUS_05500 549451 549957 gene locus_tag LOCUS_05510 549451 549957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 549973 550845 gene locus_tag LOCUS_05520 549973 550845 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_05520 551368 551048 gene locus_tag LOCUS_05530 551368 551048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 552536 551451 gene locus_tag LOCUS_05540 gene mnmA 552536 551451 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223558.1 protein_id gnl|my_center|LOCUS_05540 553729 552542 gene locus_tag LOCUS_05550 553729 552542 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 protein_id gnl|my_center|LOCUS_05550 555099 553729 gene locus_tag LOCUS_05560 555099 553729 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223556.1 protein_id gnl|my_center|LOCUS_05560 555242 555574 gene locus_tag LOCUS_05570 555242 555574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 556492 555626 gene locus_tag LOCUS_05580 556492 555626 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223553.1 protein_id gnl|my_center|LOCUS_05580 557274 556489 gene locus_tag LOCUS_05590 557274 556489 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223552.1 protein_id gnl|my_center|LOCUS_05590 558382 557423 gene locus_tag LOCUS_05600 558382 557423 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_05600 559179 558397 gene locus_tag LOCUS_05610 559179 558397 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_05610 559459 560301 gene locus_tag LOCUS_05620 559459 560301 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223549.1 protein_id gnl|my_center|LOCUS_05620 560351 560494 gene locus_tag LOCUS_05630 560351 560494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325212.1 protein_id gnl|my_center|LOCUS_05630 561169 560522 gene locus_tag LOCUS_05640 561169 560522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 561339 561169 gene locus_tag LOCUS_05650 561339 561169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 562391 561339 gene locus_tag LOCUS_05660 562391 561339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 562706 563452 gene locus_tag LOCUS_05670 562706 563452 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466697.1 protein_id gnl|my_center|LOCUS_05670 563449 564921 gene locus_tag LOCUS_05680 563449 564921 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223546.1 protein_id gnl|my_center|LOCUS_05680 565100 566350 gene locus_tag LOCUS_05690 565100 566350 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223543.1 protein_id gnl|my_center|LOCUS_05690 569778 566347 gene locus_tag LOCUS_05700 569778 566347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 570313 569906 gene locus_tag LOCUS_05710 570313 569906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 570269 570793 gene locus_tag LOCUS_05720 570269 570793 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027269.1 protein_id gnl|my_center|LOCUS_05720 571736 570783 gene locus_tag LOCUS_05730 571736 570783 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_05730 571771 572196 gene locus_tag LOCUS_05740 571771 572196 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529906.1 protein_id gnl|my_center|LOCUS_05740 572934 572197 gene locus_tag LOCUS_05750 572934 572197 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223530.1 protein_id gnl|my_center|LOCUS_05750 573000 573950 gene locus_tag LOCUS_05760 573000 573950 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223529.1 protein_id gnl|my_center|LOCUS_05760 575098 573947 gene locus_tag LOCUS_05770 575098 573947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223514.1 protein_id gnl|my_center|LOCUS_05770 576051 575098 gene locus_tag LOCUS_05780 576051 575098 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223513.1 protein_id gnl|my_center|LOCUS_05780 576820 576041 gene locus_tag LOCUS_05790 576820 576041 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_05790 577635 576859 gene locus_tag LOCUS_05800 577635 576859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_05800 577811 579919 gene locus_tag LOCUS_05810 gene glgX 577811 579919 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224466.1 protein_id gnl|my_center|LOCUS_05810 580172 580750 gene locus_tag LOCUS_05820 580172 580750 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223510.1 protein_id gnl|my_center|LOCUS_05820 580747 581133 gene locus_tag LOCUS_05830 580747 581133 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223509.1 protein_id gnl|my_center|LOCUS_05830 581304 582419 gene locus_tag LOCUS_05840 581304 582419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 582956 582426 gene locus_tag LOCUS_05850 582956 582426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 585648 583078 gene locus_tag LOCUS_05860 gene glgP 585648 583078 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223503.1 protein_id gnl|my_center|LOCUS_05860 586047 588023 gene locus_tag LOCUS_05870 586047 588023 CDS product DUF3416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224467.1 protein_id gnl|my_center|LOCUS_05870 588148 589959 gene locus_tag LOCUS_05880 gene treS 588148 589959 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224468.1 protein_id gnl|my_center|LOCUS_05880 589959 591305 gene locus_tag LOCUS_05890 589959 591305 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_05890 591302 593602 gene locus_tag LOCUS_05900 gene glgB 591302 593602 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_05900 593935 594792 gene locus_tag LOCUS_05910 593935 594792 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_05910 595492 594776 gene locus_tag LOCUS_05920 595492 594776 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225084.1 protein_id gnl|my_center|LOCUS_05920 595589 596782 gene locus_tag LOCUS_05930 595589 596782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225085.1 protein_id gnl|my_center|LOCUS_05930 596809 598185 gene locus_tag LOCUS_05940 596809 598185 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284439.1 protein_id gnl|my_center|LOCUS_05940 598279 599685 gene locus_tag LOCUS_05950 598279 599685 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284439.1 protein_id gnl|my_center|LOCUS_05950 600757 599753 gene locus_tag LOCUS_05960 600757 599753 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_05960 601636 600791 gene locus_tag LOCUS_05970 601636 600791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029935.1 protein_id gnl|my_center|LOCUS_05970 601979 601671 gene locus_tag LOCUS_05980 601979 601671 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_05980 602021 602524 gene locus_tag LOCUS_05990 602021 602524 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223498.1 protein_id gnl|my_center|LOCUS_05990 602589 603611 gene locus_tag LOCUS_06000 602589 603611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 603907 603593 gene locus_tag LOCUS_06010 603907 603593 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730191.1 protein_id gnl|my_center|LOCUS_06010 605013 603970 gene locus_tag LOCUS_06020 605013 603970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082555.1 protein_id gnl|my_center|LOCUS_06020 605924 605010 gene locus_tag LOCUS_06030 605924 605010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_06030 608276 606042 gene locus_tag LOCUS_06040 608276 606042 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223496.1 protein_id gnl|my_center|LOCUS_06040 608676 609719 gene locus_tag LOCUS_06050 608676 609719 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223494.1 protein_id gnl|my_center|LOCUS_06050 609716 610720 gene locus_tag LOCUS_06060 609716 610720 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_06060 611836 610883 gene locus_tag LOCUS_06070 611836 610883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049871458.1 protein_id gnl|my_center|LOCUS_06070 612011 613504 gene locus_tag LOCUS_06080 612011 613504 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230951.1 protein_id gnl|my_center|LOCUS_06080 614148 613501 gene locus_tag LOCUS_06090 614148 613501 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226222.1 protein_id gnl|my_center|LOCUS_06090 615738 614158 gene locus_tag LOCUS_06100 615738 614158 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226221.1 protein_id gnl|my_center|LOCUS_06100 616182 615784 gene locus_tag LOCUS_06110 616182 615784 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978653.1 protein_id gnl|my_center|LOCUS_06110 616295 617143 gene locus_tag LOCUS_06120 616295 617143 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229456.1 protein_id gnl|my_center|LOCUS_06120 617643 617140 gene locus_tag LOCUS_06130 617643 617140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 618224 617640 gene locus_tag LOCUS_06140 618224 617640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 619185 618193 gene locus_tag LOCUS_06150 gene meaB 619185 618193 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_06150 620377 619190 gene locus_tag LOCUS_06160 620377 619190 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_06160 620502 620942 gene locus_tag LOCUS_06170 gene mce 620502 620942 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_06170 621523 620939 gene locus_tag LOCUS_06180 621523 620939 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223475.1 protein_id gnl|my_center|LOCUS_06180 621920 621558 gene locus_tag LOCUS_06190 621920 621558 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831581.1 protein_id gnl|my_center|LOCUS_06190 622134 623447 gene locus_tag LOCUS_06200 gene ccrA 622134 623447 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_06200 623508 624746 gene locus_tag LOCUS_06210 623508 624746 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306094.1 protein_id gnl|my_center|LOCUS_06210 625552 624842 gene locus_tag LOCUS_06220 625552 624842 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229478.1 protein_id gnl|my_center|LOCUS_06220 625590 626126 gene locus_tag LOCUS_06230 625590 626126 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229479.1 protein_id gnl|my_center|LOCUS_06230 626779 626102 gene locus_tag LOCUS_06240 626779 626102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 627702 627409 gene locus_tag LOCUS_06250 627702 627409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_06250 627755 628171 gene locus_tag LOCUS_06260 627755 628171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 628168 628386 gene locus_tag LOCUS_06270 628168 628386 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028303.1 protein_id gnl|my_center|LOCUS_06270 629277 628657 gene locus_tag LOCUS_06280 629277 628657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 631076 629298 gene locus_tag LOCUS_06290 631076 629298 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_06290 631867 631211 gene locus_tag LOCUS_06300 gene dhaM 631867 631211 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229493.1 protein_id gnl|my_center|LOCUS_06300 632490 631864 gene locus_tag LOCUS_06310 gene dhaL 632490 631864 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229494.1 protein_id gnl|my_center|LOCUS_06310 633491 632490 gene locus_tag LOCUS_06320 gene dhaK 633491 632490 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229495.1 protein_id gnl|my_center|LOCUS_06320 635525 634020 gene locus_tag LOCUS_06330 635525 634020 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_06330 636631 635603 gene locus_tag LOCUS_06340 636631 635603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 637099 636851 gene locus_tag LOCUS_06350 637099 636851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229497.1 protein_id gnl|my_center|LOCUS_06350 638796 637111 gene locus_tag LOCUS_06360 638796 637111 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229498.1 protein_id gnl|my_center|LOCUS_06360 639293 638931 gene locus_tag LOCUS_06370 639293 638931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 641108 639531 gene locus_tag LOCUS_06380 641108 639531 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222854.1 protein_id gnl|my_center|LOCUS_06380 642097 641438 gene locus_tag LOCUS_06390 gene nucS 642097 641438 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467679.1 protein_id gnl|my_center|LOCUS_06390 642154 643548 gene locus_tag LOCUS_06400 642154 643548 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027796.1 protein_id gnl|my_center|LOCUS_06400 643551 644087 gene locus_tag LOCUS_06410 643551 644087 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730328.1 protein_id gnl|my_center|LOCUS_06410 644376 644726 gene locus_tag LOCUS_06420 644376 644726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 645496 644723 gene locus_tag LOCUS_06430 645496 644723 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_06430 645571 646368 gene locus_tag LOCUS_06440 645571 646368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 648401 646410 gene locus_tag LOCUS_06450 648401 646410 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840716.1 protein_id gnl|my_center|LOCUS_06450 648537 648830 gene locus_tag LOCUS_06460 648537 648830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 650128 648872 gene locus_tag LOCUS_06470 gene murA 650128 648872 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229517.1 protein_id gnl|my_center|LOCUS_06470 650214 650795 gene locus_tag LOCUS_06480 650214 650795 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229518.1 protein_id gnl|my_center|LOCUS_06480 650871 651554 gene locus_tag LOCUS_06490 650871 651554 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_06490 651559 652269 gene locus_tag LOCUS_06500 651559 652269 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228655.1 protein_id gnl|my_center|LOCUS_06500 652610 652257 gene locus_tag LOCUS_06510 652610 652257 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028376.1 protein_id gnl|my_center|LOCUS_06510 652740 653567 gene locus_tag LOCUS_06520 652740 653567 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731219.1 protein_id gnl|my_center|LOCUS_06520 653727 655193 gene locus_tag LOCUS_06530 653727 655193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 655633 655202 gene locus_tag LOCUS_06540 655633 655202 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229520.1 protein_id gnl|my_center|LOCUS_06540 656021 655656 gene locus_tag LOCUS_06550 656021 655656 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229521.1 protein_id gnl|my_center|LOCUS_06550 656293 656048 gene locus_tag LOCUS_06560 656293 656048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 656175 656921 gene locus_tag LOCUS_06570 656175 656921 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222327.1 protein_id gnl|my_center|LOCUS_06570 658409 656973 gene locus_tag LOCUS_06580 gene atpD 658409 656973 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 protein_id gnl|my_center|LOCUS_06580 659337 658402 gene locus_tag LOCUS_06590 659337 658402 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074370.1 protein_id gnl|my_center|LOCUS_06590 660991 659345 gene locus_tag LOCUS_06600 gene atpA 660991 659345 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229524.1 protein_id gnl|my_center|LOCUS_06600 661889 661053 gene locus_tag LOCUS_06610 661889 661053 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229525.1 protein_id gnl|my_center|LOCUS_06610 662448 661900 gene locus_tag LOCUS_06620 662448 661900 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_06620 662734 662480 gene locus_tag LOCUS_06630 662734 662480 CDS product F-type H+-transporting ATPase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229527.1 protein_id gnl|my_center|LOCUS_06630 663575 662796 gene locus_tag LOCUS_06640 gene atpB 663575 662796 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_06640 664177 663728 gene locus_tag LOCUS_06650 664177 663728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 665404 664244 gene locus_tag LOCUS_06660 665404 664244 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229530.1 protein_id gnl|my_center|LOCUS_06660 666039 665476 gene locus_tag LOCUS_06670 666039 665476 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229531.1 protein_id gnl|my_center|LOCUS_06670 667310 666648 gene locus_tag LOCUS_06680 667310 666648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 667377 668024 gene locus_tag LOCUS_06690 667377 668024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 668905 668039 gene locus_tag LOCUS_06700 gene prmC 668905 668039 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229533.1 protein_id gnl|my_center|LOCUS_06700 670318 668924 gene locus_tag LOCUS_06710 gene lpdA 670318 668924 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_06710 671525 670320 gene locus_tag LOCUS_06720 671525 670320 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538269.1 protein_id gnl|my_center|LOCUS_06720 672604 671549 gene locus_tag LOCUS_06730 gene prfA 672604 671549 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_06730 672930 672718 gene locus_tag LOCUS_06740 gene rpmE 672930 672718 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_06740 673182 673589 gene locus_tag LOCUS_06750 673182 673589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 675740 673671 gene locus_tag LOCUS_06760 675740 673671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 676975 676085 gene locus_tag LOCUS_06770 gene thrB 676975 676085 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229540.1 protein_id gnl|my_center|LOCUS_06770 678075 676972 gene locus_tag LOCUS_06780 gene thrC 678075 676972 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229541.1 protein_id gnl|my_center|LOCUS_06780 679406 678072 gene locus_tag LOCUS_06790 679406 678072 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_06790 680834 679410 gene locus_tag LOCUS_06800 gene lysA 680834 679410 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229543.1 protein_id gnl|my_center|LOCUS_06800 682435 680834 gene locus_tag LOCUS_06810 gene argS 682435 680834 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229544.1 protein_id gnl|my_center|LOCUS_06810 682648 683448 gene locus_tag LOCUS_06820 682648 683448 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229545.1 protein_id gnl|my_center|LOCUS_06820 683453 684145 gene locus_tag LOCUS_06830 683453 684145 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_06830 684243 684611 gene locus_tag LOCUS_06840 684243 684611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 684782 686671 gene locus_tag LOCUS_06850 684782 686671 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_06850 688438 686894 gene locus_tag LOCUS_06860 688438 686894 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225276.1 protein_id gnl|my_center|LOCUS_06860 688329 692483 gene locus_tag LOCUS_06870 688329 692483 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226484.1 protein_id gnl|my_center|LOCUS_06870 693399 692491 gene locus_tag LOCUS_06880 693399 692491 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_06880 694269 693472 gene locus_tag LOCUS_06890 694269 693472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 694334 694406 gene locus_tag LOCUS_t00090 694334 694406 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 694576 695517 gene locus_tag LOCUS_06900 694576 695517 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813471.1 protein_id gnl|my_center|LOCUS_06900 695641 696750 gene locus_tag LOCUS_06910 695641 696750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 698058 696886 gene locus_tag LOCUS_06920 698058 696886 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630214.1 protein_id gnl|my_center|LOCUS_06920 698115 698477 gene locus_tag LOCUS_06930 698115 698477 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728052.1 protein_id gnl|my_center|LOCUS_06930 699683 698481 gene locus_tag LOCUS_06940 699683 698481 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_06940 699766 700281 gene locus_tag LOCUS_06950 699766 700281 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224261.1 protein_id gnl|my_center|LOCUS_06950 700325 701893 gene locus_tag LOCUS_06960 700325 701893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 702627 701869 gene locus_tag LOCUS_06970 gene lieB 702627 701869 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_06970 703547 702624 gene locus_tag LOCUS_06980 703547 702624 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_06980 703601 704395 gene locus_tag LOCUS_06990 703601 704395 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 protein_id gnl|my_center|LOCUS_06990 704934 704437 gene locus_tag LOCUS_07000 704934 704437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 707098 705068 gene locus_tag LOCUS_07010 707098 705068 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847355.1 protein_id gnl|my_center|LOCUS_07010 708130 707315 gene locus_tag LOCUS_07020 708130 707315 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226194.1 protein_id gnl|my_center|LOCUS_07020 708468 709613 gene locus_tag LOCUS_07030 708468 709613 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284065.1 protein_id gnl|my_center|LOCUS_07030 709635 710645 gene locus_tag LOCUS_07040 709635 710645 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226650.1 protein_id gnl|my_center|LOCUS_07040 712764 710716 gene locus_tag LOCUS_07050 712764 710716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 713401 712910 gene locus_tag LOCUS_07060 713401 712910 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_07060 713493 714371 gene locus_tag LOCUS_07070 713493 714371 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223267.1 protein_id gnl|my_center|LOCUS_07070 714340 714933 gene locus_tag LOCUS_07080 714340 714933 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816000.1 protein_id gnl|my_center|LOCUS_07080 717604 714995 gene locus_tag LOCUS_07090 717604 714995 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229330.1 protein_id gnl|my_center|LOCUS_07090 717873 718742 gene locus_tag LOCUS_07100 717873 718742 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978149.1 protein_id gnl|my_center|LOCUS_07100 719083 719679 gene locus_tag LOCUS_07110 719083 719679 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466608.1 protein_id gnl|my_center|LOCUS_07110 719676 720554 gene locus_tag LOCUS_07120 719676 720554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 721025 720579 gene locus_tag LOCUS_07130 721025 720579 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229488.1 protein_id gnl|my_center|LOCUS_07130 721119 721952 gene locus_tag LOCUS_07140 721119 721952 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 protein_id gnl|my_center|LOCUS_07140 721949 722392 gene locus_tag LOCUS_07150 721949 722392 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229490.1 protein_id gnl|my_center|LOCUS_07150 722867 723538 gene locus_tag LOCUS_07160 722867 723538 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224977.1 protein_id gnl|my_center|LOCUS_07160 724689 723586 gene locus_tag LOCUS_07170 gene manA 724689 723586 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_07170 725647 724700 gene locus_tag LOCUS_07180 725647 724700 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727626.1 protein_id gnl|my_center|LOCUS_07180 726968 725988 gene locus_tag LOCUS_07190 gene mgrA 726968 725988 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227010.1 protein_id gnl|my_center|LOCUS_07190 727857 727024 gene locus_tag LOCUS_07200 727857 727024 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225597.1 protein_id gnl|my_center|LOCUS_07200 730298 727854 gene locus_tag LOCUS_07210 730298 727854 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_07210 730417 732537 gene locus_tag LOCUS_07220 730417 732537 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_07220 732741 733274 gene locus_tag LOCUS_07230 732741 733274 CDS product DUF3558 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831494.1 protein_id gnl|my_center|LOCUS_07230 735351 733285 gene locus_tag LOCUS_07240 735351 733285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 736220 735348 gene locus_tag LOCUS_07250 736220 735348 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225595.1 protein_id gnl|my_center|LOCUS_07250 737983 736217 gene locus_tag LOCUS_07260 737983 736217 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225594.1 protein_id gnl|my_center|LOCUS_07260 739050 738061 gene locus_tag LOCUS_07270 739050 738061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225593.1 protein_id gnl|my_center|LOCUS_07270 740767 739079 gene locus_tag LOCUS_07280 740767 739079 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043792085.1 protein_id gnl|my_center|LOCUS_07280 740924 742195 gene locus_tag LOCUS_07290 740924 742195 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225591.1 protein_id gnl|my_center|LOCUS_07290 742902 742270 gene locus_tag LOCUS_07300 742902 742270 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803815.1 protein_id gnl|my_center|LOCUS_07300 743568 742927 gene locus_tag LOCUS_07310 743568 742927 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223207.1 protein_id gnl|my_center|LOCUS_07310 743644 744405 gene locus_tag LOCUS_07320 743644 744405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 744441 744881 gene locus_tag LOCUS_07330 744441 744881 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229427.1 protein_id gnl|my_center|LOCUS_07330 744940 745821 gene locus_tag LOCUS_07340 744940 745821 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224923.1 protein_id gnl|my_center|LOCUS_07340 745955 746386 gene locus_tag LOCUS_07350 745955 746386 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_07350 746447 747688 gene locus_tag LOCUS_07360 746447 747688 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230367.1 protein_id gnl|my_center|LOCUS_07360 748669 747833 gene locus_tag LOCUS_07370 748669 747833 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726937.1 protein_id gnl|my_center|LOCUS_07370 748752 750161 gene locus_tag LOCUS_07380 748752 750161 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104578.1 protein_id gnl|my_center|LOCUS_07380 750421 750164 gene locus_tag LOCUS_07390 750421 750164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 750539 751771 gene locus_tag LOCUS_07400 750539 751771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_07400 751774 752280 gene locus_tag LOCUS_07410 751774 752280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 753016 752345 gene locus_tag LOCUS_07420 753016 752345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 753071 753844 gene locus_tag LOCUS_07430 753071 753844 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229089.1 protein_id gnl|my_center|LOCUS_07430 753888 754439 gene locus_tag LOCUS_07440 753888 754439 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229886.1 protein_id gnl|my_center|LOCUS_07440 757022 754356 gene locus_tag LOCUS_07450 757022 754356 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229885.1 protein_id gnl|my_center|LOCUS_07450 757451 757975 gene locus_tag LOCUS_07460 757451 757975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 758048 759340 gene locus_tag LOCUS_07470 758048 759340 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267888.1 protein_id gnl|my_center|LOCUS_07470 759495 760598 gene locus_tag LOCUS_07480 759495 760598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_07480 759803 759900 gene locus_tag LOCUS_t00100 759803 759900 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 760642 761805 gene locus_tag LOCUS_07490 760642 761805 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031686.1 protein_id gnl|my_center|LOCUS_07490 763194 761902 gene locus_tag LOCUS_07500 763194 761902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 763251 763931 gene locus_tag LOCUS_07510 763251 763931 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027927.1 protein_id gnl|my_center|LOCUS_07510 764705 763956 gene locus_tag LOCUS_07520 764705 763956 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230655.1 protein_id gnl|my_center|LOCUS_07520 765839 764784 gene locus_tag LOCUS_07530 765839 764784 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230996.1 protein_id gnl|my_center|LOCUS_07530 765893 766912 gene locus_tag LOCUS_07540 765893 766912 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230995.1 protein_id gnl|my_center|LOCUS_07540 766909 767370 gene locus_tag LOCUS_07550 766909 767370 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230675.1 protein_id gnl|my_center|LOCUS_07550 767539 768687 gene locus_tag LOCUS_07560 767539 768687 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229381.1 protein_id gnl|my_center|LOCUS_07560 768684 769226 gene locus_tag LOCUS_07570 768684 769226 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029961.1 protein_id gnl|my_center|LOCUS_07570 770410 769301 gene locus_tag LOCUS_07580 770410 769301 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225511.1 protein_id gnl|my_center|LOCUS_07580 770676 772298 gene locus_tag LOCUS_07590 770676 772298 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222227.1 protein_id gnl|my_center|LOCUS_07590 774181 772412 gene locus_tag LOCUS_07600 774181 772412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 774336 774575 gene locus_tag LOCUS_07610 774336 774575 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897080.1 protein_id gnl|my_center|LOCUS_07610 774695 775456 gene locus_tag LOCUS_07620 774695 775456 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029656.1 protein_id gnl|my_center|LOCUS_07620 777738 775573 gene locus_tag LOCUS_07630 777738 775573 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_07630 778831 777743 gene locus_tag LOCUS_07640 778831 777743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 779086 779727 gene locus_tag LOCUS_07650 779086 779727 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449647.1 protein_id gnl|my_center|LOCUS_07650 779724 780755 gene locus_tag LOCUS_07660 779724 780755 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228416.1 protein_id gnl|my_center|LOCUS_07660 781047 782375 gene locus_tag LOCUS_07670 781047 782375 CDS product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261187.1 protein_id gnl|my_center|LOCUS_07670 783192 782350 gene locus_tag LOCUS_07680 783192 782350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 783266 783895 gene locus_tag LOCUS_07690 783266 783895 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877368.1 protein_id gnl|my_center|LOCUS_07690 784054 785193 gene locus_tag LOCUS_07700 784054 785193 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226510.1 protein_id gnl|my_center|LOCUS_07700 785251 785670 gene locus_tag LOCUS_07710 785251 785670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 788952 785755 gene locus_tag LOCUS_07720 788952 785755 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228544.1 protein_id gnl|my_center|LOCUS_07720 789277 790083 gene locus_tag LOCUS_07730 789277 790083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 790847 790374 gene locus_tag LOCUS_07740 790847 790374 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972016.1 protein_id gnl|my_center|LOCUS_07740 790918 792570 gene locus_tag LOCUS_07750 790918 792570 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_07750 795406 792665 gene locus_tag LOCUS_07760 795406 792665 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_07760 794322 794225 gene locus_tag LOCUS_t00110 794322 794225 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 795564 795980 gene locus_tag LOCUS_07770 795564 795980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 795994 797640 gene locus_tag LOCUS_07780 795994 797640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 797637 798404 gene locus_tag LOCUS_07790 797637 798404 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228048.1 protein_id gnl|my_center|LOCUS_07790 799355 798492 gene locus_tag LOCUS_07800 799355 798492 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848494.1 protein_id gnl|my_center|LOCUS_07800 799577 801667 gene locus_tag LOCUS_07810 gene rmdA 799577 801667 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_07810 801713 802555 gene locus_tag LOCUS_07820 801713 802555 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228842.1 protein_id gnl|my_center|LOCUS_07820 803862 802627 gene locus_tag LOCUS_07830 803862 802627 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_07830 805202 803877 gene locus_tag LOCUS_07840 805202 803877 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_07840 805340 806932 gene locus_tag LOCUS_07850 805340 806932 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_07850 806929 807684 gene locus_tag LOCUS_07860 806929 807684 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296694.1 protein_id gnl|my_center|LOCUS_07860 808997 807837 gene locus_tag LOCUS_07870 808997 807837 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_07870 810926 809001 gene locus_tag LOCUS_07880 810926 809001 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_07880 812530 810926 gene locus_tag LOCUS_07890 812530 810926 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_07890 813437 812649 gene locus_tag LOCUS_07900 813437 812649 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229662.1 protein_id gnl|my_center|LOCUS_07900 813620 814222 gene locus_tag LOCUS_07910 813620 814222 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_07910 814364 816514 gene locus_tag LOCUS_07920 814364 816514 CDS product phospholipase A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229436.1 protein_id gnl|my_center|LOCUS_07920 816531 816767 gene locus_tag LOCUS_07930 816531 816767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 818049 817390 gene locus_tag LOCUS_07940 818049 817390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 818775 818128 gene locus_tag LOCUS_07950 818775 818128 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_07950 819955 818789 gene locus_tag LOCUS_07960 819955 818789 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 protein_id gnl|my_center|LOCUS_07960 820093 820593 gene locus_tag LOCUS_07970 820093 820593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229665.1 protein_id gnl|my_center|LOCUS_07970 822042 820984 gene locus_tag LOCUS_07980 822042 820984 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_07980 823307 822039 gene locus_tag LOCUS_07990 823307 822039 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229668.1 protein_id gnl|my_center|LOCUS_07990 823255 823446 gene locus_tag LOCUS_08000 823255 823446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 823551 824567 gene locus_tag LOCUS_08010 823551 824567 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_08010 824636 826135 gene locus_tag LOCUS_08020 824636 826135 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229669.1 protein_id gnl|my_center|LOCUS_08020 827594 826326 gene locus_tag LOCUS_08030 827594 826326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083711.1 protein_id gnl|my_center|LOCUS_08030 827766 828119 gene locus_tag LOCUS_08040 827766 828119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 828421 830334 gene locus_tag LOCUS_08050 828421 830334 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224706.1 protein_id gnl|my_center|LOCUS_08050 830392 831102 gene locus_tag LOCUS_08060 830392 831102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 831095 831409 gene locus_tag LOCUS_08070 831095 831409 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174185.1 protein_id gnl|my_center|LOCUS_08070 831406 831891 gene locus_tag LOCUS_08080 831406 831891 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_08080 833302 831938 gene locus_tag LOCUS_08090 833302 831938 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_08090 833687 833307 gene locus_tag LOCUS_08100 gene gcvH 833687 833307 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223709.1 protein_id gnl|my_center|LOCUS_08100 834095 835201 gene locus_tag LOCUS_08110 gene ald 834095 835201 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_08110 835544 835726 gene locus_tag LOCUS_08120 835544 835726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 835732 836106 gene locus_tag LOCUS_08130 835732 836106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 836155 837405 gene locus_tag LOCUS_08140 836155 837405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 837405 838277 gene locus_tag LOCUS_08150 837405 838277 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229684.1 protein_id gnl|my_center|LOCUS_08150 838438 842199 gene locus_tag LOCUS_08160 838438 842199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229685.1 protein_id gnl|my_center|LOCUS_08160 842758 842273 gene locus_tag LOCUS_08170 842758 842273 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225944.1 protein_id gnl|my_center|LOCUS_08170 843117 842755 gene locus_tag LOCUS_08180 843117 842755 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225945.1 protein_id gnl|my_center|LOCUS_08180 843539 847192 gene locus_tag LOCUS_08190 843539 847192 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467712.1 protein_id gnl|my_center|LOCUS_08190 847270 847449 gene locus_tag LOCUS_08200 847270 847449 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_08200 847751 848305 gene locus_tag LOCUS_08210 847751 848305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 849488 848355 gene locus_tag LOCUS_08220 849488 848355 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030673054.1 protein_id gnl|my_center|LOCUS_08220 849487 850842 gene locus_tag LOCUS_08230 849487 850842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 850839 851282 gene locus_tag LOCUS_08240 850839 851282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 852195 851299 gene locus_tag LOCUS_08250 852195 851299 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028565.1 protein_id gnl|my_center|LOCUS_08250 852267 853145 gene locus_tag LOCUS_08260 gene dapA 852267 853145 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806998.1 protein_id gnl|my_center|LOCUS_08260 854247 853105 gene locus_tag LOCUS_08270 gene hutI 854247 853105 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 protein_id gnl|my_center|LOCUS_08270 854429 854244 gene locus_tag LOCUS_08280 854429 854244 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976062.1 protein_id gnl|my_center|LOCUS_08280 855906 854638 gene locus_tag LOCUS_08290 855906 854638 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_08290 857081 855903 gene locus_tag LOCUS_08300 857081 855903 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223169.1 protein_id gnl|my_center|LOCUS_08300 858717 857074 gene locus_tag LOCUS_08310 gene hutU 858717 857074 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 protein_id gnl|my_center|LOCUS_08310 860222 858717 gene locus_tag LOCUS_08320 gene hutH 860222 858717 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223167.1 protein_id gnl|my_center|LOCUS_08320 860370 861308 gene locus_tag LOCUS_08330 860370 861308 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_08330 861311 862078 gene locus_tag LOCUS_08340 861311 862078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 862071 862865 gene locus_tag LOCUS_08350 862071 862865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 863998 862916 gene locus_tag LOCUS_08360 863998 862916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 864477 863998 gene locus_tag LOCUS_08370 864477 863998 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224154.1 protein_id gnl|my_center|LOCUS_08370 864541 865299 gene locus_tag LOCUS_08380 864541 865299 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_08380 865422 865568 gene locus_tag LOCUS_08390 865422 865568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 866516 865632 gene locus_tag LOCUS_08400 866516 865632 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229695.1 protein_id gnl|my_center|LOCUS_08400 867268 866513 gene locus_tag LOCUS_08410 867268 866513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 867927 867265 gene locus_tag LOCUS_08420 867927 867265 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229697.1 protein_id gnl|my_center|LOCUS_08420 868969 867920 gene locus_tag LOCUS_08430 868969 867920 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229698.1 protein_id gnl|my_center|LOCUS_08430 869073 870626 gene locus_tag LOCUS_08440 869073 870626 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229699.1 protein_id gnl|my_center|LOCUS_08440 870925 871395 gene locus_tag LOCUS_08450 870925 871395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 872019 871405 gene locus_tag LOCUS_08460 872019 871405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 872453 872016 gene locus_tag LOCUS_08470 872453 872016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 875700 872503 gene locus_tag LOCUS_08480 875700 872503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 877111 875924 gene locus_tag LOCUS_08490 877111 875924 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229700.1 protein_id gnl|my_center|LOCUS_08490 877399 877992 gene locus_tag LOCUS_08500 877399 877992 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_08500 878348 878013 gene locus_tag LOCUS_08510 878348 878013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 878427 878846 gene locus_tag LOCUS_08520 gene sodN 878427 878846 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_08520 878972 879577 gene locus_tag LOCUS_08530 878972 879577 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_08530 879570 880055 gene locus_tag LOCUS_08540 879570 880055 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_08540 880530 880030 gene locus_tag LOCUS_08550 880530 880030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951582.1 protein_id gnl|my_center|LOCUS_08550 880595 881044 gene locus_tag LOCUS_08560 880595 881044 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223318.1 protein_id gnl|my_center|LOCUS_08560 881876 881070 gene locus_tag LOCUS_08570 881876 881070 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_08570 882829 882080 gene locus_tag LOCUS_08580 882829 882080 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222282.1 protein_id gnl|my_center|LOCUS_08580 883412 883008 gene locus_tag LOCUS_08590 883412 883008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 883692 884621 gene locus_tag LOCUS_08600 883692 884621 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229709.1 protein_id gnl|my_center|LOCUS_08600 884848 885102 gene locus_tag LOCUS_08610 gene whiB1 884848 885102 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893300.1 protein_id gnl|my_center|LOCUS_08610 886643 885237 gene locus_tag LOCUS_08620 886643 885237 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_08620 886931 886716 gene locus_tag LOCUS_08630 886931 886716 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416887.1 protein_id gnl|my_center|LOCUS_08630 887522 887208 gene locus_tag LOCUS_08640 887522 887208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 888145 887519 gene locus_tag LOCUS_08650 888145 887519 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_08650 888360 888836 gene locus_tag LOCUS_08660 gene ybaK 888360 888836 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229713.1 protein_id gnl|my_center|LOCUS_08660 889460 888846 gene locus_tag LOCUS_08670 889460 888846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 protein_id gnl|my_center|LOCUS_08670 890227 889457 gene locus_tag LOCUS_08680 890227 889457 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_08680 890320 891594 gene locus_tag LOCUS_08690 gene aroA 890320 891594 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_08690 891596 892606 gene locus_tag LOCUS_08700 gene rsgA 891596 892606 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229716.1 protein_id gnl|my_center|LOCUS_08700 892809 893177 gene locus_tag LOCUS_08710 892809 893177 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225099.1 protein_id gnl|my_center|LOCUS_08710 893680 893189 gene locus_tag LOCUS_08720 893680 893189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229719.1 protein_id gnl|my_center|LOCUS_08720 895053 893677 gene locus_tag LOCUS_08730 895053 893677 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_08730 895732 895064 gene locus_tag LOCUS_08740 895732 895064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 895796 896542 gene locus_tag LOCUS_08750 895796 896542 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_08750 897254 896844 gene locus_tag LOCUS_08760 897254 896844 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229722.1 protein_id gnl|my_center|LOCUS_08760 897312 897701 gene locus_tag LOCUS_08770 897312 897701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 901322 898452 gene locus_tag LOCUS_08780 gene secA 901322 898452 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229725.1 protein_id gnl|my_center|LOCUS_08780 902516 901824 gene locus_tag LOCUS_08790 gene raiA 902516 901824 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229726.1 protein_id gnl|my_center|LOCUS_08790 903591 902947 gene locus_tag LOCUS_08800 903591 902947 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094308.1 protein_id gnl|my_center|LOCUS_08800 905398 903668 gene locus_tag LOCUS_08810 905398 903668 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229728.1 protein_id gnl|my_center|LOCUS_08810 907101 905395 gene locus_tag LOCUS_08820 gene mtrB 907101 905395 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229729.1 protein_id gnl|my_center|LOCUS_08820 907949 907272 gene locus_tag LOCUS_08830 gene mtrA 907949 907272 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005150760.1 protein_id gnl|my_center|LOCUS_08830 908776 908135 gene locus_tag LOCUS_08840 908776 908135 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_08840 908917 909876 gene locus_tag LOCUS_08850 908917 909876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085563.1 protein_id gnl|my_center|LOCUS_08850 911486 910023 gene locus_tag LOCUS_08860 gene ahcY 911486 910023 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229742.1 protein_id gnl|my_center|LOCUS_08860 911619 914006 gene locus_tag LOCUS_08870 911619 914006 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229743.1 protein_id gnl|my_center|LOCUS_08870 915252 913978 gene locus_tag LOCUS_08880 gene glmL 915252 913978 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_08880 915364 916884 gene locus_tag LOCUS_08890 915364 916884 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229745.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence02 1426 401 gene locus_tag LOCUS_08900 1426 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2045 1596 gene locus_tag LOCUS_08910 2045 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2770 3906 gene locus_tag LOCUS_08920 2770 3906 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_08920 4215 5171 gene locus_tag LOCUS_08930 4215 5171 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086857074.1 protein_id gnl|my_center|LOCUS_08930 6058 5330 gene locus_tag LOCUS_08940 6058 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6771 6448 gene locus_tag LOCUS_08950 6771 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 7111 7836 gene locus_tag LOCUS_08960 7111 7836 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076158225.1 protein_id gnl|my_center|LOCUS_08960 7888 8634 gene locus_tag LOCUS_08970 7888 8634 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_08970 9416 8652 gene locus_tag LOCUS_08980 9416 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 10148 9792 gene locus_tag LOCUS_08990 10148 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10036 10242 gene locus_tag LOCUS_09000 10036 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 11799 10702 gene locus_tag LOCUS_09010 11799 10702 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031515.1 protein_id gnl|my_center|LOCUS_09010 13344 12508 gene locus_tag LOCUS_09020 13344 12508 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222318.1 protein_id gnl|my_center|LOCUS_09020 14322 14143 gene locus_tag LOCUS_09030 14322 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 14237 14995 gene locus_tag LOCUS_09040 14237 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 14967 15857 gene locus_tag LOCUS_09050 14967 15857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110383.1 protein_id gnl|my_center|LOCUS_09050 16171 16614 gene locus_tag LOCUS_09060 16171 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16611 17852 gene locus_tag LOCUS_09070 16611 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 17849 19162 gene locus_tag LOCUS_09080 17849 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 19354 19833 gene locus_tag LOCUS_09090 19354 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 20863 20006 gene locus_tag LOCUS_09100 20863 20006 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226336.1 protein_id gnl|my_center|LOCUS_09100 22182 21070 gene locus_tag LOCUS_09110 22182 21070 CDS product DUF3103 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707631.1 protein_id gnl|my_center|LOCUS_09110 24888 22615 gene locus_tag LOCUS_09120 24888 22615 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045694387.1 protein_id gnl|my_center|LOCUS_09120 25144 24890 gene locus_tag LOCUS_09130 25144 24890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 26100 25174 gene locus_tag LOCUS_09140 26100 25174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 27584 26097 gene locus_tag LOCUS_09150 27584 26097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 29907 27571 gene locus_tag LOCUS_09160 29907 27571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 30138 29935 gene locus_tag LOCUS_09170 30138 29935 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226625.1 protein_id gnl|my_center|LOCUS_09170 30321 36560 gene locus_tag LOCUS_09180 30321 36560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 36583 43728 gene locus_tag LOCUS_09190 gene pvdD 36583 43728 CDS product pyoverdine non-ribosomal peptide synthetase PvdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895611.1 protein_id gnl|my_center|LOCUS_09190 43725 44969 gene locus_tag LOCUS_09200 43725 44969 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_09200 45000 46250 gene locus_tag LOCUS_09210 45000 46250 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976770.1 protein_id gnl|my_center|LOCUS_09210 46411 47031 gene locus_tag LOCUS_09220 46411 47031 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226659.1 protein_id gnl|my_center|LOCUS_09220 47028 47615 gene locus_tag LOCUS_09230 47028 47615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 47759 48064 gene locus_tag LOCUS_09240 47759 48064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 51046 48167 gene locus_tag LOCUS_09250 51046 48167 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226639.1 protein_id gnl|my_center|LOCUS_09250 51293 51679 gene locus_tag LOCUS_09260 51293 51679 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226640.1 protein_id gnl|my_center|LOCUS_09260 51904 52419 gene locus_tag LOCUS_09270 51904 52419 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803918.1 protein_id gnl|my_center|LOCUS_09270 52416 53081 gene locus_tag LOCUS_09280 52416 53081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 53735 53346 gene locus_tag LOCUS_09290 53735 53346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 54757 53828 gene locus_tag LOCUS_09300 54757 53828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 54935 55063 gene locus_tag LOCUS_09310 54935 55063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 56107 55127 gene locus_tag LOCUS_09320 56107 55127 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225916.1 protein_id gnl|my_center|LOCUS_09320 61443 56104 gene locus_tag LOCUS_09330 61443 56104 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225915.1 protein_id gnl|my_center|LOCUS_09330 69176 61458 gene locus_tag LOCUS_09340 69176 61458 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143060707.1 protein_id gnl|my_center|LOCUS_09340 69389 69664 gene locus_tag LOCUS_09350 69389 69664 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225913.1 protein_id gnl|my_center|LOCUS_09350 69668 69964 gene locus_tag LOCUS_09360 69668 69964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 69961 70992 gene locus_tag LOCUS_09370 69961 70992 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313601.1 protein_id gnl|my_center|LOCUS_09370 70989 71831 gene locus_tag LOCUS_09380 70989 71831 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225910.1 protein_id gnl|my_center|LOCUS_09380 72187 72675 gene locus_tag LOCUS_09390 72187 72675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 72886 73164 gene locus_tag LOCUS_09400 72886 73164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 74821 73358 gene locus_tag LOCUS_09410 74821 73358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 76233 74914 gene locus_tag LOCUS_09420 76233 74914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 77568 76312 gene locus_tag LOCUS_09430 77568 76312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09430 77925 77581 gene locus_tag LOCUS_09440 77925 77581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09440 79171 79485 gene locus_tag LOCUS_09450 79171 79485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 79530 81266 gene locus_tag LOCUS_09460 79530 81266 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229166.1 protein_id gnl|my_center|LOCUS_09460 81347 83482 gene locus_tag LOCUS_09470 81347 83482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 83623 85515 gene locus_tag LOCUS_09480 83623 85515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 86587 86769 gene locus_tag LOCUS_09490 86587 86769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 87079 87834 gene locus_tag LOCUS_09500 87079 87834 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_09500 88238 88558 gene locus_tag LOCUS_09510 88238 88558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 88928 89185 gene locus_tag LOCUS_09520 88928 89185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09520 89210 89419 gene locus_tag LOCUS_09530 89210 89419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 89433 89957 gene locus_tag LOCUS_09540 89433 89957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 90494 89967 gene locus_tag LOCUS_09550 90494 89967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 90618 91259 gene locus_tag LOCUS_09560 90618 91259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 92578 91274 gene locus_tag LOCUS_09570 92578 91274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 94581 93700 gene locus_tag LOCUS_09580 94581 93700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 95136 94834 gene locus_tag LOCUS_09590 95136 94834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 96248 95757 gene locus_tag LOCUS_09600 96248 95757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 96500 99325 gene locus_tag LOCUS_09610 96500 99325 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003078144.1 protein_id gnl|my_center|LOCUS_09610 99764 99504 gene locus_tag LOCUS_09620 99764 99504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 100105 99821 gene locus_tag LOCUS_09630 100105 99821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 100198 100458 gene locus_tag LOCUS_09640 100198 100458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 101006 100737 gene locus_tag LOCUS_09650 101006 100737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 101739 101026 gene locus_tag LOCUS_09660 101739 101026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 102458 101760 gene locus_tag LOCUS_09670 102458 101760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 102611 102979 gene locus_tag LOCUS_09680 102611 102979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 102976 103449 gene locus_tag LOCUS_09690 102976 103449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 105868 105356 gene locus_tag LOCUS_09700 105868 105356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 106604 105825 gene locus_tag LOCUS_09710 106604 105825 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225558.1 protein_id gnl|my_center|LOCUS_09710 106745 107389 gene locus_tag LOCUS_09720 106745 107389 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225557.1 protein_id gnl|my_center|LOCUS_09720 108909 108160 gene locus_tag LOCUS_09730 108909 108160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090295.1 protein_id gnl|my_center|LOCUS_09730 109036 109473 gene locus_tag LOCUS_09740 109036 109473 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028484.1 protein_id gnl|my_center|LOCUS_09740 109610 110077 gene locus_tag LOCUS_09750 109610 110077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 111160 110270 gene locus_tag LOCUS_09760 111160 110270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 111369 116060 gene locus_tag LOCUS_09770 111369 116060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 116057 121837 gene locus_tag LOCUS_09780 116057 121837 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225652.1 protein_id gnl|my_center|LOCUS_09780 123386 122373 gene locus_tag LOCUS_09790 123386 122373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 123754 123383 gene locus_tag LOCUS_09800 123754 123383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 125780 123834 gene locus_tag LOCUS_09810 125780 123834 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036780.1 protein_id gnl|my_center|LOCUS_09810 126265 125777 gene locus_tag LOCUS_09820 126265 125777 CDS product DUF6521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204896.1 protein_id gnl|my_center|LOCUS_09820 127470 126262 gene locus_tag LOCUS_09830 127470 126262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036781.1 protein_id gnl|my_center|LOCUS_09830 127835 128179 gene locus_tag LOCUS_09840 127835 128179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 128183 128437 gene locus_tag LOCUS_09850 128183 128437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 130147 128900 gene locus_tag LOCUS_09860 130147 128900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 130723 134052 gene locus_tag LOCUS_09870 130723 134052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224774.1 protein_id gnl|my_center|LOCUS_09870 136157 134718 gene locus_tag LOCUS_09880 136157 134718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 136714 136157 gene locus_tag LOCUS_09890 136714 136157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 140927 136716 gene locus_tag LOCUS_09900 140927 136716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 141158 141322 gene locus_tag LOCUS_09910 141158 141322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 142120 141914 gene locus_tag LOCUS_09920 142120 141914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 145614 142294 gene locus_tag LOCUS_09930 145614 142294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 146489 145761 gene locus_tag LOCUS_09940 146489 145761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 147340 146486 gene locus_tag LOCUS_09950 147340 146486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 147744 147911 gene locus_tag LOCUS_09960 147744 147911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 147983 149866 gene locus_tag LOCUS_09970 147983 149866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 150589 150086 gene locus_tag LOCUS_09980 150589 150086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 150656 150997 gene locus_tag LOCUS_09990 150656 150997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 152016 153764 gene locus_tag LOCUS_10000 152016 153764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 153985 154203 gene locus_tag LOCUS_10010 153985 154203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 154181 154516 gene locus_tag LOCUS_10020 154181 154516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 154563 155066 gene locus_tag LOCUS_10030 154563 155066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 155376 156950 gene locus_tag LOCUS_10040 155376 156950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 157289 156939 gene locus_tag LOCUS_10050 157289 156939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029512.1 protein_id gnl|my_center|LOCUS_10050 158704 157286 gene locus_tag LOCUS_10060 158704 157286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 159379 158996 gene locus_tag LOCUS_10070 159379 158996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 159546 159740 gene locus_tag LOCUS_10080 159546 159740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 159737 160066 gene locus_tag LOCUS_10090 159737 160066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 160063 160395 gene locus_tag LOCUS_10100 160063 160395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 160392 161003 gene locus_tag LOCUS_10110 160392 161003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 161000 163093 gene locus_tag LOCUS_10120 161000 163093 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953239.1 protein_id gnl|my_center|LOCUS_10120 163232 164992 gene locus_tag LOCUS_10130 163232 164992 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227625.1 protein_id gnl|my_center|LOCUS_10130 165056 164973 gene locus_tag LOCUS_t00120 165056 164973 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 165357 165641 gene locus_tag LOCUS_10140 165357 165641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 167376 165931 gene locus_tag LOCUS_10150 167376 165931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 169194 167419 gene locus_tag LOCUS_10160 169194 167419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 169420 170274 gene locus_tag LOCUS_10170 169420 170274 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_10170 170717 170238 gene locus_tag LOCUS_10180 170717 170238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 171971 170727 gene locus_tag LOCUS_10190 171971 170727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 172279 171968 gene locus_tag LOCUS_10200 172279 171968 CDS product type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229831.1 protein_id gnl|my_center|LOCUS_10200 172743 172291 gene locus_tag LOCUS_10210 172743 172291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 173529 172852 gene locus_tag LOCUS_10220 173529 172852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 175846 173984 gene locus_tag LOCUS_10230 175846 173984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 176395 176012 gene locus_tag LOCUS_10240 176395 176012 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227684.1 protein_id gnl|my_center|LOCUS_10240 176854 176468 gene locus_tag LOCUS_10250 176854 176468 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226985.1 protein_id gnl|my_center|LOCUS_10250 178355 176847 gene locus_tag LOCUS_10260 178355 176847 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226986.1 protein_id gnl|my_center|LOCUS_10260 178810 178373 gene locus_tag LOCUS_10270 178810 178373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 179449 178859 gene locus_tag LOCUS_10280 179449 178859 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226988.1 protein_id gnl|my_center|LOCUS_10280 180498 179605 gene locus_tag LOCUS_10290 gene sigJ 180498 179605 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_10290 180576 181031 gene locus_tag LOCUS_10300 180576 181031 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_10300 181957 181211 gene locus_tag LOCUS_10310 181957 181211 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031845.1 protein_id gnl|my_center|LOCUS_10310 181995 182345 gene locus_tag LOCUS_10320 181995 182345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 183193 182342 gene locus_tag LOCUS_10330 183193 182342 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_10330 183485 184318 gene locus_tag LOCUS_10340 183485 184318 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776254.1 protein_id gnl|my_center|LOCUS_10340 184456 187680 gene locus_tag LOCUS_10350 184456 187680 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230069.1 protein_id gnl|my_center|LOCUS_10350 187703 187906 gene locus_tag LOCUS_10360 187703 187906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350508.1 protein_id gnl|my_center|LOCUS_10360 188039 188398 gene locus_tag LOCUS_10370 188039 188398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 188479 189333 gene locus_tag LOCUS_10380 188479 189333 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225079.1 protein_id gnl|my_center|LOCUS_10380 191233 189374 gene locus_tag LOCUS_10390 191233 189374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_10390 192963 191230 gene locus_tag LOCUS_10400 192963 191230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_10400 193069 193698 gene locus_tag LOCUS_10410 193069 193698 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977638.1 protein_id gnl|my_center|LOCUS_10410 193830 193699 gene locus_tag LOCUS_10420 193830 193699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 195456 194047 gene locus_tag LOCUS_10430 195456 194047 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225063.1 protein_id gnl|my_center|LOCUS_10430 196897 195560 gene locus_tag LOCUS_10440 196897 195560 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145168863.1 protein_id gnl|my_center|LOCUS_10440 198225 196894 gene locus_tag LOCUS_10450 198225 196894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 199100 198222 gene locus_tag LOCUS_10460 199100 198222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 200485 199097 gene locus_tag LOCUS_10470 200485 199097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 201900 200482 gene locus_tag LOCUS_10480 201900 200482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 201875 202093 gene locus_tag LOCUS_10490 201875 202093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 202723 202151 gene locus_tag LOCUS_10500 202723 202151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 202804 203376 gene locus_tag LOCUS_10510 202804 203376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 204243 203740 gene locus_tag LOCUS_10520 gene msrA 204243 203740 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530793.1 protein_id gnl|my_center|LOCUS_10520 205998 204385 gene locus_tag LOCUS_10530 205998 204385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 207050 206223 gene locus_tag LOCUS_10540 207050 206223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 208369 207047 gene locus_tag LOCUS_10550 208369 207047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 209111 208332 gene locus_tag LOCUS_10560 209111 208332 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403622.1 protein_id gnl|my_center|LOCUS_10560 209948 209115 gene locus_tag LOCUS_10570 209948 209115 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838432.1 protein_id gnl|my_center|LOCUS_10570 210767 210306 gene locus_tag LOCUS_10580 210767 210306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 211632 210847 gene locus_tag LOCUS_10590 211632 210847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 213156 212062 gene locus_tag LOCUS_10600 213156 212062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849900.1 protein_id gnl|my_center|LOCUS_10600 214321 213203 gene locus_tag LOCUS_10610 214321 213203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849900.1 protein_id gnl|my_center|LOCUS_10610 214433 214696 gene locus_tag LOCUS_10620 214433 214696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 219943 214700 gene locus_tag LOCUS_10630 219943 214700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 220100 220663 gene locus_tag LOCUS_10640 220100 220663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 220815 222788 gene locus_tag LOCUS_10650 220815 222788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 222785 227887 gene locus_tag LOCUS_10660 222785 227887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 227884 229197 gene locus_tag LOCUS_10670 227884 229197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 229227 230165 gene locus_tag LOCUS_10680 229227 230165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 230204 230881 gene locus_tag LOCUS_10690 230204 230881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 231478 230981 gene locus_tag LOCUS_10700 231478 230981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 231768 231475 gene locus_tag LOCUS_10710 231768 231475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 232114 232995 gene locus_tag LOCUS_10720 232114 232995 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767940.1 protein_id gnl|my_center|LOCUS_10720 233020 233232 gene locus_tag LOCUS_10730 233020 233232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 234064 233303 gene locus_tag LOCUS_10740 234064 233303 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_10740 235340 234144 gene locus_tag LOCUS_10750 235340 234144 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229859.1 protein_id gnl|my_center|LOCUS_10750 236788 235559 gene locus_tag LOCUS_10760 236788 235559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 236852 237067 gene locus_tag LOCUS_10770 236852 237067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 237350 238678 gene locus_tag LOCUS_10780 237350 238678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 239432 238881 gene locus_tag LOCUS_10790 239432 238881 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_10790 239524 239991 gene locus_tag LOCUS_10800 239524 239991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092142.1 protein_id gnl|my_center|LOCUS_10800 240002 240577 gene locus_tag LOCUS_10810 240002 240577 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_10810 240660 241109 gene locus_tag LOCUS_10820 240660 241109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 241190 242287 gene locus_tag LOCUS_10830 241190 242287 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970682.1 protein_id gnl|my_center|LOCUS_10830 242854 242306 gene locus_tag LOCUS_10840 242854 242306 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_10840 243443 242979 gene locus_tag LOCUS_10850 243443 242979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958561.1 protein_id gnl|my_center|LOCUS_10850 244371 243460 gene locus_tag LOCUS_10860 244371 243460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224152.1 protein_id gnl|my_center|LOCUS_10860 245581 244574 gene locus_tag LOCUS_10870 245581 244574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 245824 245648 gene locus_tag LOCUS_10880 245824 245648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 245754 246179 gene locus_tag LOCUS_10890 245754 246179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 247356 246187 gene locus_tag LOCUS_10900 247356 246187 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227164.1 protein_id gnl|my_center|LOCUS_10900 247385 248461 gene locus_tag LOCUS_10910 247385 248461 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227165.1 protein_id gnl|my_center|LOCUS_10910 248482 249465 gene locus_tag LOCUS_10920 248482 249465 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230423.1 protein_id gnl|my_center|LOCUS_10920 249515 251794 gene locus_tag LOCUS_10930 249515 251794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 251791 253059 gene locus_tag LOCUS_10940 251791 253059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 253169 254518 gene locus_tag LOCUS_10950 253169 254518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 255908 254526 gene locus_tag LOCUS_10960 255908 254526 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031044.1 protein_id gnl|my_center|LOCUS_10960 257200 255926 gene locus_tag LOCUS_10970 257200 255926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107661203.1 protein_id gnl|my_center|LOCUS_10970 257747 257193 gene locus_tag LOCUS_10980 257747 257193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 258493 257771 gene locus_tag LOCUS_10990 258493 257771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 258902 259894 gene locus_tag LOCUS_11000 258902 259894 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_11000 259930 261261 gene locus_tag LOCUS_11010 259930 261261 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226464.1 protein_id gnl|my_center|LOCUS_11010 261438 264242 gene locus_tag LOCUS_11020 261438 264242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 265336 264314 gene locus_tag LOCUS_11030 265336 264314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 265591 266727 gene locus_tag LOCUS_11040 265591 266727 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226964.1 protein_id gnl|my_center|LOCUS_11040 268536 266959 gene locus_tag LOCUS_11050 268536 266959 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_11050 269605 268610 gene locus_tag LOCUS_11060 269605 268610 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973721.1 protein_id gnl|my_center|LOCUS_11060 271436 269838 gene locus_tag LOCUS_11070 271436 269838 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_11070 272447 271446 gene locus_tag LOCUS_11080 272447 271446 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_11080 274133 272730 gene locus_tag LOCUS_11090 274133 272730 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030556.1 protein_id gnl|my_center|LOCUS_11090 274495 275538 gene locus_tag LOCUS_11100 274495 275538 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930148.1 protein_id gnl|my_center|LOCUS_11100 275581 276441 gene locus_tag LOCUS_11110 275581 276441 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225014.1 protein_id gnl|my_center|LOCUS_11110 277262 278413 gene locus_tag LOCUS_11120 277262 278413 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225015.1 protein_id gnl|my_center|LOCUS_11120 278397 279113 gene locus_tag LOCUS_11130 278397 279113 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225016.1 protein_id gnl|my_center|LOCUS_11130 279750 279058 gene locus_tag LOCUS_11140 279750 279058 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225016.1 protein_id gnl|my_center|LOCUS_11140 280772 279747 gene locus_tag LOCUS_11150 280772 279747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 281571 280906 gene locus_tag LOCUS_11160 281571 280906 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039537.1 protein_id gnl|my_center|LOCUS_11160 281807 281568 gene locus_tag LOCUS_11170 281807 281568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 282551 281841 gene locus_tag LOCUS_11180 282551 281841 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039534.1 protein_id gnl|my_center|LOCUS_11180 283610 282612 gene locus_tag LOCUS_11190 283610 282612 CDS product AvrD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192746513.1 protein_id gnl|my_center|LOCUS_11190 284406 283780 gene locus_tag LOCUS_11200 284406 283780 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226698.1 protein_id gnl|my_center|LOCUS_11200 284679 287594 gene locus_tag LOCUS_11210 284679 287594 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226193.1 protein_id gnl|my_center|LOCUS_11210 287594 288871 gene locus_tag LOCUS_11220 287594 288871 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 protein_id gnl|my_center|LOCUS_11220 288868 289770 gene locus_tag LOCUS_11230 288868 289770 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 protein_id gnl|my_center|LOCUS_11230 289767 290579 gene locus_tag LOCUS_11240 289767 290579 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 protein_id gnl|my_center|LOCUS_11240 290576 292873 gene locus_tag LOCUS_11250 gene yicI 290576 292873 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 protein_id gnl|my_center|LOCUS_11250 292870 295680 gene locus_tag LOCUS_11260 292870 295680 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226283.1 protein_id gnl|my_center|LOCUS_11260 296649 295642 gene locus_tag LOCUS_11270 296649 295642 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 protein_id gnl|my_center|LOCUS_11270 295670 295761 gene locus_tag LOCUS_t00130 295670 295761 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 297163 298551 gene locus_tag LOCUS_11280 297163 298551 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_11280 298663 299589 gene locus_tag LOCUS_11290 298663 299589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 299586 300620 gene locus_tag LOCUS_11300 299586 300620 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134732678.1 protein_id gnl|my_center|LOCUS_11300 301714 300773 gene locus_tag LOCUS_11310 301714 300773 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031422.1 protein_id gnl|my_center|LOCUS_11310 301713 303152 gene locus_tag LOCUS_11320 301713 303152 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091318242.1 protein_id gnl|my_center|LOCUS_11320 303220 303954 gene locus_tag LOCUS_11330 303220 303954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 304019 304870 gene locus_tag LOCUS_11340 304019 304870 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226465.1 protein_id gnl|my_center|LOCUS_11340 305390 304947 gene locus_tag LOCUS_11350 305390 304947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 305643 307949 gene locus_tag LOCUS_11360 gene fxsT 305643 307949 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190714.1 protein_id gnl|my_center|LOCUS_11360 309080 308457 gene locus_tag LOCUS_11370 309080 308457 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030034.1 protein_id gnl|my_center|LOCUS_11370 309185 310111 gene locus_tag LOCUS_11380 309185 310111 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205660833.1 protein_id gnl|my_center|LOCUS_11380 310322 311044 gene locus_tag LOCUS_11390 310322 311044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 311044 311880 gene locus_tag LOCUS_11400 311044 311880 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_11400 311870 312676 gene locus_tag LOCUS_11410 311870 312676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 312673 313956 gene locus_tag LOCUS_11420 312673 313956 CDS product ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031466.1 protein_id gnl|my_center|LOCUS_11420 314992 314018 gene locus_tag LOCUS_11430 314992 314018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 315794 315141 gene locus_tag LOCUS_11440 315794 315141 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027962.1 protein_id gnl|my_center|LOCUS_11440 317030 315795 gene locus_tag LOCUS_11450 317030 315795 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_11450 318010 317030 gene locus_tag LOCUS_11460 318010 317030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 319021 318014 gene locus_tag LOCUS_11470 319021 318014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 319313 319975 gene locus_tag LOCUS_11480 319313 319975 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223308.1 protein_id gnl|my_center|LOCUS_11480 321317 320064 gene locus_tag LOCUS_11490 321317 320064 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838062.1 protein_id gnl|my_center|LOCUS_11490 321452 322150 gene locus_tag LOCUS_11500 321452 322150 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_11500 322137 324077 gene locus_tag LOCUS_11510 322137 324077 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221996.1 protein_id gnl|my_center|LOCUS_11510 324029 324682 gene locus_tag LOCUS_11520 324029 324682 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221997.1 protein_id gnl|my_center|LOCUS_11520 325232 327385 gene locus_tag LOCUS_11530 325232 327385 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_11530 327463 329190 gene locus_tag LOCUS_11540 327463 329190 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 protein_id gnl|my_center|LOCUS_11540 331180 329414 gene locus_tag LOCUS_11550 gene argS 331180 329414 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028896.1 protein_id gnl|my_center|LOCUS_11550 332194 331319 gene locus_tag LOCUS_11560 332194 331319 CDS product TIGR03560 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225208.1 protein_id gnl|my_center|LOCUS_11560 333318 332281 gene locus_tag LOCUS_11570 333318 332281 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226261.1 protein_id gnl|my_center|LOCUS_11570 334474 333425 gene locus_tag LOCUS_11580 334474 333425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_11580 335289 334471 gene locus_tag LOCUS_11590 335289 334471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_11590 336044 335286 gene locus_tag LOCUS_11600 gene modA 336044 335286 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_11600 336442 336044 gene locus_tag LOCUS_11610 336442 336044 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_11610 336730 336978 gene locus_tag LOCUS_11620 336730 336978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 337813 336992 gene locus_tag LOCUS_11630 337813 336992 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_11630 338284 337847 gene locus_tag LOCUS_11640 338284 337847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 339589 338486 gene locus_tag LOCUS_11650 339589 338486 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317270.1 protein_id gnl|my_center|LOCUS_11650 339726 339971 gene locus_tag LOCUS_11660 339726 339971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 340141 342285 gene locus_tag LOCUS_11670 340141 342285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 343075 342422 gene locus_tag LOCUS_11680 343075 342422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229430.1 protein_id gnl|my_center|LOCUS_11680 343346 345403 gene locus_tag LOCUS_11690 343346 345403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 345408 345866 gene locus_tag LOCUS_11700 345408 345866 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726631.1 protein_id gnl|my_center|LOCUS_11700 346087 348843 gene locus_tag LOCUS_11710 346087 348843 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228676.1 protein_id gnl|my_center|LOCUS_11710 348969 350153 gene locus_tag LOCUS_11720 348969 350153 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928952.1 protein_id gnl|my_center|LOCUS_11720 350341 350487 gene locus_tag LOCUS_11730 350341 350487 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896554.1 protein_id gnl|my_center|LOCUS_11730 350620 351339 gene locus_tag LOCUS_11740 350620 351339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 351412 352488 gene locus_tag LOCUS_11750 351412 352488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223374.1 protein_id gnl|my_center|LOCUS_11750 352488 353639 gene locus_tag LOCUS_11760 352488 353639 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223375.1 protein_id gnl|my_center|LOCUS_11760 353636 355255 gene locus_tag LOCUS_11770 353636 355255 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 protein_id gnl|my_center|LOCUS_11770 355252 355863 gene locus_tag LOCUS_11780 355252 355863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223377.1 protein_id gnl|my_center|LOCUS_11780 357190 356204 gene locus_tag LOCUS_11790 357190 356204 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227292.1 protein_id gnl|my_center|LOCUS_11790 357331 359025 gene locus_tag LOCUS_11800 357331 359025 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878257.1 protein_id gnl|my_center|LOCUS_11800 359681 359022 gene locus_tag LOCUS_11810 gene devR 359681 359022 CDS product two-component system response regulator DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416369.1 protein_id gnl|my_center|LOCUS_11810 360487 359780 gene locus_tag LOCUS_11820 360487 359780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 360672 361547 gene locus_tag LOCUS_11830 360672 361547 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_11830 362058 361624 gene locus_tag LOCUS_11840 362058 361624 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227282.1 protein_id gnl|my_center|LOCUS_11840 362267 362743 gene locus_tag LOCUS_11850 362267 362743 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_11850 362740 365367 gene locus_tag LOCUS_11860 362740 365367 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227290.1 protein_id gnl|my_center|LOCUS_11860 365364 365786 gene locus_tag LOCUS_11870 365364 365786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 365783 366256 gene locus_tag LOCUS_11880 365783 366256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 366253 366876 gene locus_tag LOCUS_11890 366253 366876 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227299.1 protein_id gnl|my_center|LOCUS_11890 366857 369382 gene locus_tag LOCUS_11900 366857 369382 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410027.1 protein_id gnl|my_center|LOCUS_11900 370027 369731 gene locus_tag LOCUS_11910 370027 369731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 370165 372534 gene locus_tag LOCUS_11920 370165 372534 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227297.1 protein_id gnl|my_center|LOCUS_11920 372534 373607 gene locus_tag LOCUS_11930 372534 373607 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228351.1 protein_id gnl|my_center|LOCUS_11930 373892 374113 gene locus_tag LOCUS_11940 373892 374113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 374146 374397 gene locus_tag LOCUS_11950 374146 374397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 375133 374408 gene locus_tag LOCUS_11960 gene pflA 375133 374408 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390067.1 protein_id gnl|my_center|LOCUS_11960 377379 375133 gene locus_tag LOCUS_11970 gene pflB 377379 375133 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390748.1 protein_id gnl|my_center|LOCUS_11970 378413 377376 gene locus_tag LOCUS_11980 378413 377376 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_11980 378569 379081 gene locus_tag LOCUS_11990 378569 379081 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227306.1 protein_id gnl|my_center|LOCUS_11990 380114 379350 gene locus_tag LOCUS_12000 380114 379350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 381518 380364 gene locus_tag LOCUS_12010 381518 380364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 382349 381666 gene locus_tag LOCUS_12020 382349 381666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 382610 382383 gene locus_tag LOCUS_12030 382610 382383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 382751 383122 gene locus_tag LOCUS_12040 382751 383122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 383721 383230 gene locus_tag LOCUS_12050 383721 383230 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227282.1 protein_id gnl|my_center|LOCUS_12050 384835 383834 gene locus_tag LOCUS_12060 gene gap 384835 383834 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_12060 385172 385017 gene locus_tag LOCUS_12070 385172 385017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 386526 385531 gene locus_tag LOCUS_12080 386526 385531 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 protein_id gnl|my_center|LOCUS_12080 386740 387303 gene locus_tag LOCUS_12090 386740 387303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 387490 388938 gene locus_tag LOCUS_12100 387490 388938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12100 389550 389179 gene locus_tag LOCUS_12110 389550 389179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 390625 390134 gene locus_tag LOCUS_12120 390625 390134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 390826 391410 gene locus_tag LOCUS_12130 390826 391410 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227299.1 protein_id gnl|my_center|LOCUS_12130 391850 392092 gene locus_tag LOCUS_12140 391850 392092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 392089 393462 gene locus_tag LOCUS_12150 392089 393462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 393455 394135 gene locus_tag LOCUS_12160 393455 394135 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227301.1 protein_id gnl|my_center|LOCUS_12160 394132 396672 gene locus_tag LOCUS_12170 394132 396672 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227286.1 protein_id gnl|my_center|LOCUS_12170 396669 397520 gene locus_tag LOCUS_12180 396669 397520 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_12180 397757 397662 gene locus_tag LOCUS_t00140 397757 397662 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 397813 398142 gene locus_tag LOCUS_12190 397813 398142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12190 398139 398366 gene locus_tag LOCUS_12200 398139 398366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 398464 398667 gene locus_tag LOCUS_12210 398464 398667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12210 398709 399572 gene locus_tag LOCUS_12220 398709 399572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 399891 402578 gene locus_tag LOCUS_12230 gene ppdK 399891 402578 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_12230 402968 403189 gene locus_tag LOCUS_12240 402968 403189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 403816 403226 gene locus_tag LOCUS_12250 403816 403226 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_12250 405207 403813 gene locus_tag LOCUS_12260 405207 403813 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727704.1 protein_id gnl|my_center|LOCUS_12260 406528 405236 gene locus_tag LOCUS_12270 gene nhaA 406528 405236 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_12270 406878 406681 gene locus_tag LOCUS_12280 406878 406681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 407327 407821 gene locus_tag LOCUS_12290 407327 407821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 415500 408169 gene locus_tag LOCUS_12300 415500 408169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 415932 415759 gene locus_tag LOCUS_12310 415932 415759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 416015 416317 gene locus_tag LOCUS_12320 416015 416317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 416950 416618 gene locus_tag LOCUS_12330 416950 416618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 416913 417212 gene locus_tag LOCUS_12340 416913 417212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 417998 418219 gene locus_tag LOCUS_12350 417998 418219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 418837 418418 gene locus_tag LOCUS_12360 418837 418418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 419057 418839 gene locus_tag LOCUS_12370 419057 418839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229864.1 protein_id gnl|my_center|LOCUS_12370 420244 419201 gene locus_tag LOCUS_12380 420244 419201 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_12380 420766 421947 gene locus_tag LOCUS_12390 420766 421947 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197085735.1 protein_id gnl|my_center|LOCUS_12390 422112 422651 gene locus_tag LOCUS_12400 422112 422651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 422764 423261 gene locus_tag LOCUS_12410 422764 423261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 423625 424206 gene locus_tag LOCUS_12420 423625 424206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 424651 424433 gene locus_tag LOCUS_12430 424651 424433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 425634 425972 gene locus_tag LOCUS_12440 425634 425972 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_12440 426937 426332 gene locus_tag LOCUS_12450 426937 426332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 427554 427186 gene locus_tag LOCUS_12460 427554 427186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 428681 428088 gene locus_tag LOCUS_12470 428681 428088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 429064 428807 gene locus_tag LOCUS_12480 429064 428807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 429848 429333 gene locus_tag LOCUS_12490 429848 429333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 430624 430250 gene locus_tag LOCUS_12500 430624 430250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 432511 432236 gene locus_tag LOCUS_12510 432511 432236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 432761 432555 gene locus_tag LOCUS_12520 432761 432555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 433015 432800 gene locus_tag LOCUS_12530 433015 432800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 433454 433822 gene locus_tag LOCUS_12540 433454 433822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 433947 435326 gene locus_tag LOCUS_12550 433947 435326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 435475 436017 gene locus_tag LOCUS_12560 435475 436017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 436017 436436 gene locus_tag LOCUS_12570 436017 436436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 436495 436962 gene locus_tag LOCUS_12580 436495 436962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 437031 437537 gene locus_tag LOCUS_12590 437031 437537 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170054.1 protein_id gnl|my_center|LOCUS_12590 437921 438286 gene locus_tag LOCUS_12600 437921 438286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 438391 438708 gene locus_tag LOCUS_12610 438391 438708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 438815 439219 gene locus_tag LOCUS_12620 438815 439219 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_12620 439288 439527 gene locus_tag LOCUS_12630 439288 439527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 440857 439496 gene locus_tag LOCUS_12640 440857 439496 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_12640 441615 440857 gene locus_tag LOCUS_12650 441615 440857 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_12650 441918 441631 gene locus_tag LOCUS_12660 441918 441631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 442384 441929 gene locus_tag LOCUS_12670 442384 441929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 442698 442387 gene locus_tag LOCUS_12680 442698 442387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 443052 443597 gene locus_tag LOCUS_12690 443052 443597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 443599 444603 gene locus_tag LOCUS_12700 443599 444603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 445006 445494 gene locus_tag LOCUS_12710 445006 445494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 445539 445847 gene locus_tag LOCUS_12720 445539 445847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 445964 446887 gene locus_tag LOCUS_12730 445964 446887 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895400.1 protein_id gnl|my_center|LOCUS_12730 447308 446865 gene locus_tag LOCUS_12740 447308 446865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 447613 448113 gene locus_tag LOCUS_12750 447613 448113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 449037 448279 gene locus_tag LOCUS_12760 449037 448279 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027142.1 protein_id gnl|my_center|LOCUS_12760 449515 450732 gene locus_tag LOCUS_12770 449515 450732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 452195 450738 gene locus_tag LOCUS_12780 452195 450738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 452456 452998 gene locus_tag LOCUS_12790 452456 452998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 453816 453043 gene locus_tag LOCUS_12800 453816 453043 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223189.1 protein_id gnl|my_center|LOCUS_12800 454118 454297 gene locus_tag LOCUS_12810 454118 454297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 454552 455757 gene locus_tag LOCUS_12820 454552 455757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 456229 457116 gene locus_tag LOCUS_12830 456229 457116 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895405.1 protein_id gnl|my_center|LOCUS_12830 457869 457351 gene locus_tag LOCUS_12840 457869 457351 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_12840 458070 457879 gene locus_tag LOCUS_12850 458070 457879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 458525 458370 gene locus_tag LOCUS_12860 458525 458370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 458737 459540 gene locus_tag LOCUS_12870 458737 459540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 459719 460189 gene locus_tag LOCUS_12880 459719 460189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 460201 462324 gene locus_tag LOCUS_12890 460201 462324 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 protein_id gnl|my_center|LOCUS_12890 463615 462395 gene locus_tag LOCUS_12900 463615 462395 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227558.1 protein_id gnl|my_center|LOCUS_12900 463795 464388 gene locus_tag LOCUS_12910 463795 464388 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222133.1 protein_id gnl|my_center|LOCUS_12910 464763 465167 gene locus_tag LOCUS_12920 464763 465167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 465577 465801 gene locus_tag LOCUS_12930 465577 465801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12930 468836 465759 gene locus_tag LOCUS_12940 468836 465759 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226159.1 protein_id gnl|my_center|LOCUS_12940 468939 469946 gene locus_tag LOCUS_12950 468939 469946 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_12950 469943 470527 gene locus_tag LOCUS_12960 469943 470527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 470759 471175 gene locus_tag LOCUS_12970 470759 471175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 472406 471240 gene locus_tag LOCUS_12980 472406 471240 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803997.1 protein_id gnl|my_center|LOCUS_12980 472893 473591 gene locus_tag LOCUS_12990 472893 473591 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224977.1 protein_id gnl|my_center|LOCUS_12990 474633 473653 gene locus_tag LOCUS_13000 474633 473653 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582817.1 protein_id gnl|my_center|LOCUS_13000 475639 474650 gene locus_tag LOCUS_13010 475639 474650 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582817.1 protein_id gnl|my_center|LOCUS_13010 476688 475657 gene locus_tag LOCUS_13020 476688 475657 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120387.1 protein_id gnl|my_center|LOCUS_13020 477064 476989 gene locus_tag LOCUS_t00150 477064 476989 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 477343 480651 gene locus_tag LOCUS_13030 477343 480651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224789.1 protein_id gnl|my_center|LOCUS_13030 482279 480795 gene locus_tag LOCUS_13040 gene hpaE 482279 480795 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173038.1 protein_id gnl|my_center|LOCUS_13040 483208 482276 gene locus_tag LOCUS_13050 gene hpaI 483208 482276 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228326.1 protein_id gnl|my_center|LOCUS_13050 483876 483205 gene locus_tag LOCUS_13060 483876 483205 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 protein_id gnl|my_center|LOCUS_13060 485273 483873 gene locus_tag LOCUS_13070 485273 483873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 486136 485270 gene locus_tag LOCUS_13080 gene hpaD 486136 485270 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516973.1 protein_id gnl|my_center|LOCUS_13080 486388 487359 gene locus_tag LOCUS_13090 486388 487359 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266127.1 protein_id gnl|my_center|LOCUS_13090 487422 488846 gene locus_tag LOCUS_13100 gene dhaS 487422 488846 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_13100 490121 488859 gene locus_tag LOCUS_13110 490121 488859 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_13110 491234 490215 gene locus_tag LOCUS_13120 491234 490215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 491405 492931 gene locus_tag LOCUS_13130 491405 492931 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227510.1 protein_id gnl|my_center|LOCUS_13130 493896 492928 gene locus_tag LOCUS_13140 493896 492928 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_13140 494831 493893 gene locus_tag LOCUS_13150 494831 493893 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_13150 496974 494815 gene locus_tag LOCUS_13160 496974 494815 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_13160 497710 496976 gene locus_tag LOCUS_13170 497710 496976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 498675 497710 gene locus_tag LOCUS_13180 498675 497710 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_13180 499798 498686 gene locus_tag LOCUS_13190 499798 498686 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731184.1 protein_id gnl|my_center|LOCUS_13190 500541 499783 gene locus_tag LOCUS_13200 500541 499783 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729157.1 protein_id gnl|my_center|LOCUS_13200 501429 500563 gene locus_tag LOCUS_13210 501429 500563 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083877.1 protein_id gnl|my_center|LOCUS_13210 502594 501440 gene locus_tag LOCUS_13220 502594 501440 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090552.1 protein_id gnl|my_center|LOCUS_13220 504342 502594 gene locus_tag LOCUS_13230 504342 502594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 505057 504344 gene locus_tag LOCUS_13240 505057 504344 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538585.1 protein_id gnl|my_center|LOCUS_13240 507248 505248 gene locus_tag LOCUS_13250 507248 505248 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040688119.1 protein_id gnl|my_center|LOCUS_13250 507269 508381 gene locus_tag LOCUS_13260 507269 508381 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_13260 508442 509311 gene locus_tag LOCUS_13270 508442 509311 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_13270 509570 509334 gene locus_tag LOCUS_13280 509570 509334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 509908 509567 gene locus_tag LOCUS_13290 509908 509567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226100.1 protein_id gnl|my_center|LOCUS_13290 509986 511443 gene locus_tag LOCUS_13300 509986 511443 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_13300 511471 512556 gene locus_tag LOCUS_13310 511471 512556 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259168.1 protein_id gnl|my_center|LOCUS_13310 512568 513098 gene locus_tag LOCUS_13320 512568 513098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 513095 513595 gene locus_tag LOCUS_13330 513095 513595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 513963 513616 gene locus_tag LOCUS_13340 513963 513616 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_13340 514369 513986 gene locus_tag LOCUS_13350 514369 513986 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189554466.1 protein_id gnl|my_center|LOCUS_13350 514454 515014 gene locus_tag LOCUS_13360 514454 515014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 515168 515527 gene locus_tag LOCUS_13370 515168 515527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 515871 516263 gene locus_tag LOCUS_13380 515871 516263 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270067.1 protein_id gnl|my_center|LOCUS_13380 516338 518608 gene locus_tag LOCUS_13390 gene catB 516338 518608 CDS product catalase CatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978196.1 protein_id gnl|my_center|LOCUS_13390 520183 518663 gene locus_tag LOCUS_13400 520183 518663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 522637 520349 gene locus_tag LOCUS_13410 522637 520349 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313782.1 protein_id gnl|my_center|LOCUS_13410 523748 522822 gene locus_tag LOCUS_13420 523748 522822 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206870.1 protein_id gnl|my_center|LOCUS_13420 524085 523861 gene locus_tag LOCUS_13430 524085 523861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 524376 525743 gene locus_tag LOCUS_13440 524376 525743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 525769 526128 gene locus_tag LOCUS_13450 525769 526128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 526939 526136 gene locus_tag LOCUS_13460 526939 526136 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226234.1 protein_id gnl|my_center|LOCUS_13460 528368 526968 gene locus_tag LOCUS_13470 528368 526968 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_13470 529627 528365 gene locus_tag LOCUS_13480 529627 528365 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_13480 531163 529781 gene locus_tag LOCUS_13490 531163 529781 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027188.1 protein_id gnl|my_center|LOCUS_13490 532665 531181 gene locus_tag LOCUS_13500 532665 531181 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027187.1 protein_id gnl|my_center|LOCUS_13500 533504 532683 gene locus_tag LOCUS_13510 533504 532683 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027186.1 protein_id gnl|my_center|LOCUS_13510 534454 533501 gene locus_tag LOCUS_13520 534454 533501 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978331.1 protein_id gnl|my_center|LOCUS_13520 535700 534456 gene locus_tag LOCUS_13530 535700 534456 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027184.1 protein_id gnl|my_center|LOCUS_13530 535881 536693 gene locus_tag LOCUS_13540 535881 536693 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978333.1 protein_id gnl|my_center|LOCUS_13540 536772 537179 gene locus_tag LOCUS_13550 536772 537179 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_13550 537250 537567 gene locus_tag LOCUS_13560 gene blaI 537250 537567 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950618.1 protein_id gnl|my_center|LOCUS_13560 537564 538445 gene locus_tag LOCUS_13570 537564 538445 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729216.1 protein_id gnl|my_center|LOCUS_13570 538526 538906 gene locus_tag LOCUS_13580 538526 538906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 538899 539780 gene locus_tag LOCUS_13590 gene ccsB 538899 539780 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222434.1 protein_id gnl|my_center|LOCUS_13590 540724 539762 gene locus_tag LOCUS_13600 540724 539762 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027239.1 protein_id gnl|my_center|LOCUS_13600 540886 542892 gene locus_tag LOCUS_13610 gene cerN 540886 542892 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_13610 543373 542936 gene locus_tag LOCUS_13620 543373 542936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 543435 544943 gene locus_tag LOCUS_13630 543435 544943 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485437.1 protein_id gnl|my_center|LOCUS_13630 544943 546016 gene locus_tag LOCUS_13640 544943 546016 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226144.1 protein_id gnl|my_center|LOCUS_13640 546013 547011 gene locus_tag LOCUS_13650 546013 547011 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226143.1 protein_id gnl|my_center|LOCUS_13650 547219 547022 gene locus_tag LOCUS_13660 547219 547022 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226142.1 protein_id gnl|my_center|LOCUS_13660 547826 547203 gene locus_tag LOCUS_13670 547826 547203 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226141.1 protein_id gnl|my_center|LOCUS_13670 547943 548710 gene locus_tag LOCUS_13680 547943 548710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 549997 548723 gene locus_tag LOCUS_13690 549997 548723 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_13690 551049 550069 gene locus_tag LOCUS_13700 551049 550069 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113282.1 protein_id gnl|my_center|LOCUS_13700 552498 551053 gene locus_tag LOCUS_13710 552498 551053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 553516 552584 gene locus_tag LOCUS_13720 553516 552584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 553986 554813 gene locus_tag LOCUS_13730 553986 554813 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494169.1 protein_id gnl|my_center|LOCUS_13730 554842 555282 gene locus_tag LOCUS_13740 554842 555282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 555429 556559 gene locus_tag LOCUS_13750 555429 556559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 556720 557595 gene locus_tag LOCUS_13760 556720 557595 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 protein_id gnl|my_center|LOCUS_13760 559000 557600 gene locus_tag LOCUS_13770 559000 557600 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224881.1 protein_id gnl|my_center|LOCUS_13770 560402 559167 gene locus_tag LOCUS_13780 560402 559167 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404946.1 protein_id gnl|my_center|LOCUS_13780 561220 560399 gene locus_tag LOCUS_13790 561220 560399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 562262 561225 gene locus_tag LOCUS_13800 562262 561225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 562459 562842 gene locus_tag LOCUS_13810 562459 562842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 562839 563606 gene locus_tag LOCUS_13820 562839 563606 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878303.1 protein_id gnl|my_center|LOCUS_13820 563603 564982 gene locus_tag LOCUS_13830 563603 564982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 566733 565033 gene locus_tag LOCUS_13840 566733 565033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 566843 568066 gene locus_tag LOCUS_13850 gene aldO 566843 568066 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_13850 569857 568067 gene locus_tag LOCUS_13860 569857 568067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 570242 573331 gene locus_tag LOCUS_13870 570242 573331 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_13870 573416 573847 gene locus_tag LOCUS_13880 573416 573847 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525102.1 protein_id gnl|my_center|LOCUS_13880 573837 574193 gene locus_tag LOCUS_13890 573837 574193 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224368.1 protein_id gnl|my_center|LOCUS_13890 575169 574345 gene locus_tag LOCUS_13900 575169 574345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_13900 576110 575166 gene locus_tag LOCUS_13910 576110 575166 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_13910 576571 576380 gene locus_tag LOCUS_13920 576571 576380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 576476 577543 gene locus_tag LOCUS_13930 576476 577543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 577540 578916 gene locus_tag LOCUS_13940 577540 578916 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012416341.1 protein_id gnl|my_center|LOCUS_13940 578991 580601 gene locus_tag LOCUS_13950 578991 580601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 580696 581892 gene locus_tag LOCUS_13960 580696 581892 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887964.1 protein_id gnl|my_center|LOCUS_13960 582045 582713 gene locus_tag LOCUS_13970 582045 582713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 583491 582658 gene locus_tag LOCUS_13980 583491 582658 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013711.1 protein_id gnl|my_center|LOCUS_13980 585089 583488 gene locus_tag LOCUS_13990 585089 583488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_13990 586138 585086 gene locus_tag LOCUS_14000 586138 585086 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_14000 586950 586135 gene locus_tag LOCUS_14010 586950 586135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 588254 586947 gene locus_tag LOCUS_14020 588254 586947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 588563 589825 gene locus_tag LOCUS_14030 588563 589825 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466963.1 protein_id gnl|my_center|LOCUS_14030 590026 590988 gene locus_tag LOCUS_14040 590026 590988 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222702.1 protein_id gnl|my_center|LOCUS_14040 591103 592284 gene locus_tag LOCUS_14050 591103 592284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 598412 592335 gene locus_tag LOCUS_14060 598412 592335 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225226.1 protein_id gnl|my_center|LOCUS_14060 598699 600363 gene locus_tag LOCUS_14070 598699 600363 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225225.1 protein_id gnl|my_center|LOCUS_14070 600392 601345 gene locus_tag LOCUS_14080 600392 601345 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225228.1 protein_id gnl|my_center|LOCUS_14080 601342 602649 gene locus_tag LOCUS_14090 601342 602649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225224.1 protein_id gnl|my_center|LOCUS_14090 602672 605041 gene locus_tag LOCUS_14100 602672 605041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 605178 606329 gene locus_tag LOCUS_14110 605178 606329 CDS product cellulose-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227009.1 protein_id gnl|my_center|LOCUS_14110 608322 606388 gene locus_tag LOCUS_14120 608322 606388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 610890 608629 gene locus_tag LOCUS_14130 610890 608629 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223220.1 protein_id gnl|my_center|LOCUS_14130 610967 611755 gene locus_tag LOCUS_14140 610967 611755 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223221.1 protein_id gnl|my_center|LOCUS_14140 611898 612662 gene locus_tag LOCUS_14150 611898 612662 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_14150 613191 612733 gene locus_tag LOCUS_14160 613191 612733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 614345 613188 gene locus_tag LOCUS_14170 614345 613188 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028195.1 protein_id gnl|my_center|LOCUS_14170 614423 615004 gene locus_tag LOCUS_14180 614423 615004 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028964.1 protein_id gnl|my_center|LOCUS_14180 615016 617784 gene locus_tag LOCUS_14190 615016 617784 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226543.1 protein_id gnl|my_center|LOCUS_14190 617781 618884 gene locus_tag LOCUS_14200 617781 618884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226544.1 protein_id gnl|my_center|LOCUS_14200 619976 618888 gene locus_tag LOCUS_14210 619976 618888 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230899.1 protein_id gnl|my_center|LOCUS_14210 620064 620663 gene locus_tag LOCUS_14220 620064 620663 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_14220 621035 620820 gene locus_tag LOCUS_14230 621035 620820 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561940.1 protein_id gnl|my_center|LOCUS_14230 621994 621032 gene locus_tag LOCUS_14240 621994 621032 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226470.1 protein_id gnl|my_center|LOCUS_14240 622166 623233 gene locus_tag LOCUS_14250 622166 623233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 624006 623269 gene locus_tag LOCUS_14260 624006 623269 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975219.1 protein_id gnl|my_center|LOCUS_14260 625084 624119 gene locus_tag LOCUS_14270 625084 624119 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_14270 625213 626262 gene locus_tag LOCUS_14280 625213 626262 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_14280 626259 627083 gene locus_tag LOCUS_14290 626259 627083 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086563.1 protein_id gnl|my_center|LOCUS_14290 627094 627789 gene locus_tag LOCUS_14300 627094 627789 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_14300 627890 628192 gene locus_tag LOCUS_14310 627890 628192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 629289 628135 gene locus_tag LOCUS_14320 629289 628135 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010044806.1 protein_id gnl|my_center|LOCUS_14320 629376 629684 gene locus_tag LOCUS_14330 629376 629684 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259894.1 protein_id gnl|my_center|LOCUS_14330 631810 630134 gene locus_tag LOCUS_14340 631810 630134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 632725 631817 gene locus_tag LOCUS_14350 632725 631817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 633904 633188 gene locus_tag LOCUS_14360 633904 633188 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_14360 634875 633901 gene locus_tag LOCUS_14370 634875 633901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 635172 634993 gene locus_tag LOCUS_14380 635172 634993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 635769 635398 gene locus_tag LOCUS_14390 635769 635398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 635719 636474 gene locus_tag LOCUS_14400 635719 636474 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223482.1 protein_id gnl|my_center|LOCUS_14400 636706 640608 gene locus_tag LOCUS_14410 gene hrpA 636706 640608 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_14410 641402 640740 gene locus_tag LOCUS_14420 641402 640740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 642353 641868 gene locus_tag LOCUS_14430 642353 641868 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464470.1 protein_id gnl|my_center|LOCUS_14430 642393 642728 gene locus_tag LOCUS_14440 642393 642728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 643385 642708 gene locus_tag LOCUS_14450 643385 642708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14450 644669 643389 gene locus_tag LOCUS_14460 644669 643389 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_14460 645627 644659 gene locus_tag LOCUS_14470 645627 644659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14470 647640 645631 gene locus_tag LOCUS_14480 647640 645631 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 protein_id gnl|my_center|LOCUS_14480 649244 648183 gene locus_tag LOCUS_14490 649244 648183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_14490 650205 649246 gene locus_tag LOCUS_14500 650205 649246 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_14500 651485 650202 gene locus_tag LOCUS_14510 651485 650202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222294.1 protein_id gnl|my_center|LOCUS_14510 652124 651621 gene locus_tag LOCUS_14520 652124 651621 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_14520 652752 652177 gene locus_tag LOCUS_14530 652752 652177 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_14530 653046 653483 gene locus_tag LOCUS_14540 653046 653483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 653665 655104 gene locus_tag LOCUS_14550 gene rox 653665 655104 CDS product rifampin monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877344.1 protein_id gnl|my_center|LOCUS_14550 656305 655088 gene locus_tag LOCUS_14560 656305 655088 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_14560 656689 656333 gene locus_tag LOCUS_14570 656689 656333 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 protein_id gnl|my_center|LOCUS_14570 656944 656774 gene locus_tag LOCUS_14580 656944 656774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 657381 656941 gene locus_tag LOCUS_14590 657381 656941 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841425.1 protein_id gnl|my_center|LOCUS_14590 658549 657452 gene locus_tag LOCUS_14600 658549 657452 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030012.1 protein_id gnl|my_center|LOCUS_14600 658677 658546 gene locus_tag LOCUS_14610 658677 658546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 659165 658716 gene locus_tag LOCUS_14620 659165 658716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 659593 660069 gene locus_tag LOCUS_14630 659593 660069 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228611.1 protein_id gnl|my_center|LOCUS_14630 660107 660589 gene locus_tag LOCUS_14640 660107 660589 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228614.1 protein_id gnl|my_center|LOCUS_14640 660614 661081 gene locus_tag LOCUS_14650 660614 661081 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_14650 661477 663054 gene locus_tag LOCUS_14660 661477 663054 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840467.1 protein_id gnl|my_center|LOCUS_14660 663090 664469 gene locus_tag LOCUS_14670 663090 664469 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228605.1 protein_id gnl|my_center|LOCUS_14670 664601 665746 gene locus_tag LOCUS_14680 664601 665746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 666889 665759 gene locus_tag LOCUS_14690 666889 665759 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227533.1 protein_id gnl|my_center|LOCUS_14690 667407 666886 gene locus_tag LOCUS_14700 667407 666886 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227534.1 protein_id gnl|my_center|LOCUS_14700 668499 667438 gene locus_tag LOCUS_14710 668499 667438 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_14710 669892 668576 gene locus_tag LOCUS_14720 gene glyA 669892 668576 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_14720 669968 670810 gene locus_tag LOCUS_14730 669968 670810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 670821 671453 gene locus_tag LOCUS_14740 670821 671453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975445.1 protein_id gnl|my_center|LOCUS_14740 671606 672598 gene locus_tag LOCUS_14750 671606 672598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 672722 673150 gene locus_tag LOCUS_14760 672722 673150 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977090.1 protein_id gnl|my_center|LOCUS_14760 674020 673154 gene locus_tag LOCUS_14770 674020 673154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110383.1 protein_id gnl|my_center|LOCUS_14770 674691 674017 gene locus_tag LOCUS_14780 674691 674017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 676072 674786 gene locus_tag LOCUS_14790 676072 674786 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_14790 676868 676065 gene locus_tag LOCUS_14800 676868 676065 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_14800 676987 678768 gene locus_tag LOCUS_14810 676987 678768 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_14810 678765 679721 gene locus_tag LOCUS_14820 678765 679721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_14820 679718 680602 gene locus_tag LOCUS_14830 679718 680602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226494.1 protein_id gnl|my_center|LOCUS_14830 680599 682185 gene locus_tag LOCUS_14840 680599 682185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226495.1 protein_id gnl|my_center|LOCUS_14840 682961 682140 gene locus_tag LOCUS_14850 682961 682140 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223827.1 protein_id gnl|my_center|LOCUS_14850 683663 683292 gene locus_tag LOCUS_14860 683663 683292 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230629.1 protein_id gnl|my_center|LOCUS_14860 684879 683668 gene locus_tag LOCUS_14870 684879 683668 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_14870 685886 684879 gene locus_tag LOCUS_14880 685886 684879 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_14880 686524 685883 gene locus_tag LOCUS_14890 686524 685883 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_14890 687185 686661 gene locus_tag LOCUS_14900 687185 686661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231066.1 protein_id gnl|my_center|LOCUS_14900 687906 687472 gene locus_tag LOCUS_14910 687906 687472 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_14910 688020 688589 gene locus_tag LOCUS_14920 688020 688589 CDS product DUF3156 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227628.1 protein_id gnl|my_center|LOCUS_14920 690058 689093 gene locus_tag LOCUS_14930 690058 689093 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_14930 691968 690055 gene locus_tag LOCUS_14940 691968 690055 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226499.1 protein_id gnl|my_center|LOCUS_14940 692099 692665 gene locus_tag LOCUS_14950 692099 692665 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_14950 692674 693468 gene locus_tag LOCUS_14960 692674 693468 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226501.1 protein_id gnl|my_center|LOCUS_14960 693535 694008 gene locus_tag LOCUS_14970 693535 694008 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143451.1 protein_id gnl|my_center|LOCUS_14970 694022 694783 gene locus_tag LOCUS_14980 694022 694783 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226502.1 protein_id gnl|my_center|LOCUS_14980 694795 695601 gene locus_tag LOCUS_14990 694795 695601 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226503.1 protein_id gnl|my_center|LOCUS_14990 695643 696068 gene locus_tag LOCUS_15000 695643 696068 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226504.1 protein_id gnl|my_center|LOCUS_15000 696085 697305 gene locus_tag LOCUS_15010 696085 697305 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841829.1 protein_id gnl|my_center|LOCUS_15010 697432 698406 gene locus_tag LOCUS_15020 697432 698406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 699858 698485 gene locus_tag LOCUS_15030 699858 698485 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_15030 700272 699895 gene locus_tag LOCUS_15040 700272 699895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 700373 701257 gene locus_tag LOCUS_15050 700373 701257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 701777 701265 gene locus_tag LOCUS_15060 701777 701265 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226520.1 protein_id gnl|my_center|LOCUS_15060 701976 702653 gene locus_tag LOCUS_15070 701976 702653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 703445 702558 gene locus_tag LOCUS_15080 703445 702558 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_15080 703589 704287 gene locus_tag LOCUS_15090 703589 704287 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227930.1 protein_id gnl|my_center|LOCUS_15090 704275 704988 gene locus_tag LOCUS_15100 704275 704988 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 protein_id gnl|my_center|LOCUS_15100 705742 704948 gene locus_tag LOCUS_15110 gene map 705742 704948 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_15110 705876 706046 gene locus_tag LOCUS_15120 705876 706046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 706046 706651 gene locus_tag LOCUS_15130 706046 706651 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388331.1 protein_id gnl|my_center|LOCUS_15130 707596 706652 gene locus_tag LOCUS_15140 gene pip 707596 706652 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_15140 707640 708107 gene locus_tag LOCUS_15150 707640 708107 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222237.1 protein_id gnl|my_center|LOCUS_15150 709081 708137 gene locus_tag LOCUS_15160 709081 708137 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227751.1 protein_id gnl|my_center|LOCUS_15160 709183 709581 gene locus_tag LOCUS_15170 709183 709581 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 protein_id gnl|my_center|LOCUS_15170 710338 711309 gene locus_tag LOCUS_15180 710338 711309 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 protein_id gnl|my_center|LOCUS_15180 711671 711219 gene locus_tag LOCUS_15190 711671 711219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 711610 712491 gene locus_tag LOCUS_15200 711610 712491 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_15200 712509 713972 gene locus_tag LOCUS_15210 712509 713972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 713959 714867 gene locus_tag LOCUS_15220 gene ligD 713959 714867 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467071.1 protein_id gnl|my_center|LOCUS_15220 714915 715463 gene locus_tag LOCUS_15230 714915 715463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 715564 716025 gene locus_tag LOCUS_15240 715564 716025 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_15240 716726 716058 gene locus_tag LOCUS_15250 716726 716058 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325634.1 protein_id gnl|my_center|LOCUS_15250 718797 716761 gene locus_tag LOCUS_15260 718797 716761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 719222 718866 gene locus_tag LOCUS_15270 719222 718866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226557.1 protein_id gnl|my_center|LOCUS_15270 719290 720063 gene locus_tag LOCUS_15280 719290 720063 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226558.1 protein_id gnl|my_center|LOCUS_15280 720127 721551 gene locus_tag LOCUS_15290 720127 721551 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226560.1 protein_id gnl|my_center|LOCUS_15290 722310 721594 gene locus_tag LOCUS_15300 722310 721594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 722609 722307 gene locus_tag LOCUS_15310 722609 722307 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141202.1 protein_id gnl|my_center|LOCUS_15310 722713 723162 gene locus_tag LOCUS_15320 722713 723162 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530895.1 protein_id gnl|my_center|LOCUS_15320 723194 723586 gene locus_tag LOCUS_15330 723194 723586 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531560.1 protein_id gnl|my_center|LOCUS_15330 723763 724482 gene locus_tag LOCUS_15340 723763 724482 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285024.1 protein_id gnl|my_center|LOCUS_15340 724571 725164 gene locus_tag LOCUS_15350 724571 725164 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226060.1 protein_id gnl|my_center|LOCUS_15350 725202 725708 gene locus_tag LOCUS_15360 725202 725708 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_15360 726179 726523 gene locus_tag LOCUS_15370 726179 726523 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081521.1 protein_id gnl|my_center|LOCUS_15370 727390 726599 gene locus_tag LOCUS_15380 727390 726599 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_15380 728957 727365 gene locus_tag LOCUS_15390 gene lnt 728957 727365 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_15390 729267 729452 gene locus_tag LOCUS_15400 729267 729452 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974070.1 protein_id gnl|my_center|LOCUS_15400 730192 729446 gene locus_tag LOCUS_15410 730192 729446 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_15410 730568 730203 gene locus_tag LOCUS_15420 730568 730203 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_15420 730673 731113 gene locus_tag LOCUS_15430 730673 731113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 731526 731110 gene locus_tag LOCUS_15440 731526 731110 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_15440 732263 731523 gene locus_tag LOCUS_15450 732263 731523 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_15450 733828 732260 gene locus_tag LOCUS_15460 733828 732260 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_15460 735585 734005 gene locus_tag LOCUS_15470 735585 734005 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226567.1 protein_id gnl|my_center|LOCUS_15470 736607 735591 gene locus_tag LOCUS_15480 gene kdd 736607 735591 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_15480 736905 736756 gene locus_tag LOCUS_15490 736905 736756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 736942 737094 gene locus_tag LOCUS_15500 736942 737094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 738623 737076 gene locus_tag LOCUS_15510 738623 737076 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338607.1 protein_id gnl|my_center|LOCUS_15510 739579 738620 gene locus_tag LOCUS_15520 739579 738620 CDS product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975020.1 protein_id gnl|my_center|LOCUS_15520 740197 739652 gene locus_tag LOCUS_15530 740197 739652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 740771 740286 gene locus_tag LOCUS_15540 740771 740286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 740898 742286 gene locus_tag LOCUS_15550 740898 742286 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_15550 743807 742455 gene locus_tag LOCUS_15560 743807 742455 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225491.1 protein_id gnl|my_center|LOCUS_15560 744018 744872 gene locus_tag LOCUS_15570 744018 744872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 744952 745977 gene locus_tag LOCUS_15580 744952 745977 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_15580 746004 746936 gene locus_tag LOCUS_15590 746004 746936 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_15590 750218 747234 gene locus_tag LOCUS_15600 750218 747234 CDS product carbohydrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031383.1 protein_id gnl|my_center|LOCUS_15600 750440 752713 gene locus_tag LOCUS_15610 750440 752713 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_15610 754199 752958 gene locus_tag LOCUS_15620 754199 752958 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_15620 755021 754542 gene locus_tag LOCUS_15630 755021 754542 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_15630 755094 756140 gene locus_tag LOCUS_15640 755094 756140 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223247.1 protein_id gnl|my_center|LOCUS_15640 756281 760069 gene locus_tag LOCUS_15650 756281 760069 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227790.1 protein_id gnl|my_center|LOCUS_15650 760066 761355 gene locus_tag LOCUS_15660 760066 761355 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227789.1 protein_id gnl|my_center|LOCUS_15660 761424 762326 gene locus_tag LOCUS_15670 761424 762326 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207897272.1 protein_id gnl|my_center|LOCUS_15670 762323 763063 gene locus_tag LOCUS_15680 762323 763063 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 protein_id gnl|my_center|LOCUS_15680 763197 763060 gene locus_tag LOCUS_15690 763197 763060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 765565 763322 gene locus_tag LOCUS_15700 765565 763322 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 protein_id gnl|my_center|LOCUS_15700 766792 765755 gene locus_tag LOCUS_15710 766792 765755 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229172.1 protein_id gnl|my_center|LOCUS_15710 768974 766941 gene locus_tag LOCUS_15720 768974 766941 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876809.1 protein_id gnl|my_center|LOCUS_15720 770146 768962 gene locus_tag LOCUS_15730 gene rhaI 770146 768962 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226383.1 protein_id gnl|my_center|LOCUS_15730 770485 770165 gene locus_tag LOCUS_15740 770485 770165 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 protein_id gnl|my_center|LOCUS_15740 772418 770595 gene locus_tag LOCUS_15750 772418 770595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 772951 772415 gene locus_tag LOCUS_15760 772951 772415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 773781 772948 gene locus_tag LOCUS_15770 773781 772948 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229174.1 protein_id gnl|my_center|LOCUS_15770 774734 773778 gene locus_tag LOCUS_15780 774734 773778 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229175.1 protein_id gnl|my_center|LOCUS_15780 776014 774737 gene locus_tag LOCUS_15790 776014 774737 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229176.1 protein_id gnl|my_center|LOCUS_15790 776204 778456 gene locus_tag LOCUS_15800 776204 778456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 778475 779176 gene locus_tag LOCUS_15810 778475 779176 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728671.1 protein_id gnl|my_center|LOCUS_15810 781183 779423 gene locus_tag LOCUS_15820 781183 779423 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640391.1 protein_id gnl|my_center|LOCUS_15820 781391 782005 gene locus_tag LOCUS_15830 781391 782005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 782005 783117 gene locus_tag LOCUS_15840 782005 783117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222736.1 protein_id gnl|my_center|LOCUS_15840 783146 784090 gene locus_tag LOCUS_15850 gene ligD 783146 784090 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_15850 784868 784095 gene locus_tag LOCUS_15860 784868 784095 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477112.1 protein_id gnl|my_center|LOCUS_15860 785462 784977 gene locus_tag LOCUS_15870 785462 784977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 785520 786485 gene locus_tag LOCUS_15880 785520 786485 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222113.1 protein_id gnl|my_center|LOCUS_15880 786615 787145 gene locus_tag LOCUS_15890 786615 787145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 787258 790089 gene locus_tag LOCUS_15900 787258 790089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 790873 790043 gene locus_tag LOCUS_15910 790873 790043 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_15910 791094 791486 gene locus_tag LOCUS_15920 791094 791486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 791848 792033 gene locus_tag LOCUS_15930 791848 792033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 792033 794132 gene locus_tag LOCUS_15940 792033 794132 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226197.1 protein_id gnl|my_center|LOCUS_15940 796206 794122 gene locus_tag LOCUS_15950 796206 794122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 796635 796408 gene locus_tag LOCUS_15960 796635 796408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 797446 796538 gene locus_tag LOCUS_15970 797446 796538 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_15970 797544 798146 gene locus_tag LOCUS_15980 797544 798146 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227317.1 protein_id gnl|my_center|LOCUS_15980 798346 798708 gene locus_tag LOCUS_15990 798346 798708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 798952 799815 gene locus_tag LOCUS_16000 gene hisG 798952 799815 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_16000 800159 801007 gene locus_tag LOCUS_16010 800159 801007 CDS product AfsR/SARP family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228641.1 protein_id gnl|my_center|LOCUS_16010 801664 801092 gene locus_tag LOCUS_16020 801664 801092 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_16020 802883 801750 gene locus_tag LOCUS_16030 802883 801750 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304024.1 protein_id gnl|my_center|LOCUS_16030 803573 802923 gene locus_tag LOCUS_16040 803573 802923 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226070.1 protein_id gnl|my_center|LOCUS_16040 803751 805469 gene locus_tag LOCUS_16050 803751 805469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_16050 805466 807292 gene locus_tag LOCUS_16060 805466 807292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_16060 807397 808257 gene locus_tag LOCUS_16070 807397 808257 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 protein_id gnl|my_center|LOCUS_16070 809425 808310 gene locus_tag LOCUS_16080 809425 808310 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144327.1 protein_id gnl|my_center|LOCUS_16080 810193 809486 gene locus_tag LOCUS_16090 810193 809486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 810839 810261 gene locus_tag LOCUS_16100 810839 810261 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 protein_id gnl|my_center|LOCUS_16100 811909 810836 gene locus_tag LOCUS_16110 811909 810836 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_16110 812051 813118 gene locus_tag LOCUS_16120 812051 813118 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_16120 814617 813931 gene locus_tag LOCUS_16130 814617 813931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228025.1 protein_id gnl|my_center|LOCUS_16130 815339 814668 gene locus_tag LOCUS_16140 815339 814668 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088221.1 protein_id gnl|my_center|LOCUS_16140 818766 815365 gene locus_tag LOCUS_16150 818766 815365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 820839 818797 gene locus_tag LOCUS_16160 820839 818797 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223200.1 protein_id gnl|my_center|LOCUS_16160 821094 821522 gene locus_tag LOCUS_16170 821094 821522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467378.1 protein_id gnl|my_center|LOCUS_16170 821532 823589 gene locus_tag LOCUS_16180 821532 823589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 824900 823815 gene locus_tag LOCUS_16190 824900 823815 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_16190 824984 826561 gene locus_tag LOCUS_16200 824984 826561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 826558 827346 gene locus_tag LOCUS_16210 826558 827346 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225107.1 protein_id gnl|my_center|LOCUS_16210 828787 827417 gene locus_tag LOCUS_16220 828787 827417 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224317.1 protein_id gnl|my_center|LOCUS_16220 829742 828861 gene locus_tag LOCUS_16230 829742 828861 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_16230 830672 829752 gene locus_tag LOCUS_16240 830672 829752 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224315.1 protein_id gnl|my_center|LOCUS_16240 831907 830669 gene locus_tag LOCUS_16250 831907 830669 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_16250 832180 833214 gene locus_tag LOCUS_16260 832180 833214 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_16260 834145 833219 gene locus_tag LOCUS_16270 834145 833219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 834717 834142 gene locus_tag LOCUS_16280 834717 834142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 838150 834911 gene locus_tag LOCUS_16290 838150 834911 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_16290 838383 838550 gene locus_tag LOCUS_16300 838383 838550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 838628 839245 gene locus_tag LOCUS_16310 838628 839245 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_16310 841068 840001 gene locus_tag LOCUS_16320 841068 840001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 842186 841068 gene locus_tag LOCUS_16330 842186 841068 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_16330 843100 842183 gene locus_tag LOCUS_16340 843100 842183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 843417 843094 gene locus_tag LOCUS_16350 843417 843094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 843761 843414 gene locus_tag LOCUS_16360 843761 843414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 844629 843832 gene locus_tag LOCUS_16370 844629 843832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 844904 844626 gene locus_tag LOCUS_16380 844904 844626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 846247 844970 gene locus_tag LOCUS_16390 846247 844970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 848682 846382 gene locus_tag LOCUS_16400 848682 846382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 849432 848959 gene locus_tag LOCUS_16410 849432 848959 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265579.1 protein_id gnl|my_center|LOCUS_16410 850696 849518 gene locus_tag LOCUS_16420 850696 849518 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015391.1 protein_id gnl|my_center|LOCUS_16420 850911 852278 gene locus_tag LOCUS_16430 850911 852278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 853359 852298 gene locus_tag LOCUS_16440 853359 852298 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_16440 853256 853531 gene locus_tag LOCUS_16450 853256 853531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 853670 856063 gene locus_tag LOCUS_16460 853670 856063 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031390.1 protein_id gnl|my_center|LOCUS_16460 856060 857046 gene locus_tag LOCUS_16470 856060 857046 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_16470 857040 857978 gene locus_tag LOCUS_16480 857040 857978 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_16480 858030 859661 gene locus_tag LOCUS_16490 858030 859661 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803820.1 protein_id gnl|my_center|LOCUS_16490 859746 861278 gene locus_tag LOCUS_16500 859746 861278 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_16500 861275 861973 gene locus_tag LOCUS_16510 861275 861973 CDS product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803819.1 protein_id gnl|my_center|LOCUS_16510 861970 863994 gene locus_tag LOCUS_16520 861970 863994 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254470.1 protein_id gnl|my_center|LOCUS_16520 865961 863988 gene locus_tag LOCUS_16530 gene aguA 865961 863988 CDS product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 protein_id gnl|my_center|LOCUS_16530 867337 866084 gene locus_tag LOCUS_16540 867337 866084 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 protein_id gnl|my_center|LOCUS_16540 867499 868365 gene locus_tag LOCUS_16550 867499 868365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 868462 869778 gene locus_tag LOCUS_16560 868462 869778 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225106.1 protein_id gnl|my_center|LOCUS_16560 869783 870685 gene locus_tag LOCUS_16570 869783 870685 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_16570 870682 871497 gene locus_tag LOCUS_16580 870682 871497 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225104.1 protein_id gnl|my_center|LOCUS_16580 875848 871478 gene locus_tag LOCUS_16590 875848 871478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 876275 875901 gene locus_tag LOCUS_16600 876275 875901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 876396 876920 gene locus_tag LOCUS_16610 876396 876920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 876917 877330 gene locus_tag LOCUS_16620 876917 877330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 877655 878224 gene locus_tag LOCUS_16630 877655 878224 CDS product QsdR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229987.1 protein_id gnl|my_center|LOCUS_16630 878383 879765 gene locus_tag LOCUS_16640 878383 879765 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_16640 879762 881081 gene locus_tag LOCUS_16650 879762 881081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 881156 881671 gene locus_tag LOCUS_16660 881156 881671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 882970 881696 gene locus_tag LOCUS_16670 882970 881696 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222829.1 protein_id gnl|my_center|LOCUS_16670 883354 883848 gene locus_tag LOCUS_16680 883354 883848 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224154.1 protein_id gnl|my_center|LOCUS_16680 883845 884666 gene locus_tag LOCUS_16690 883845 884666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 888169 884735 gene locus_tag LOCUS_16700 888169 884735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 889492 888311 gene locus_tag LOCUS_16710 889492 888311 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227743.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence03 1289 306 gene locus_tag LOCUS_16720 1289 306 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224496.1 protein_id gnl|my_center|LOCUS_16720 2161 1457 gene locus_tag LOCUS_16730 2161 1457 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_16730 4175 2277 gene locus_tag LOCUS_16740 gene dxs 4175 2277 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224488.1 protein_id gnl|my_center|LOCUS_16740 5479 4250 gene locus_tag LOCUS_16750 5479 4250 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_16750 7485 5476 gene locus_tag LOCUS_16760 7485 5476 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_16760 7568 8230 gene locus_tag LOCUS_16770 7568 8230 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851807.1 protein_id gnl|my_center|LOCUS_16770 8230 8886 gene locus_tag LOCUS_16780 8230 8886 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_16780 9726 8962 gene locus_tag LOCUS_16790 9726 8962 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 protein_id gnl|my_center|LOCUS_16790 10100 9723 gene locus_tag LOCUS_16800 10100 9723 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224481.1 protein_id gnl|my_center|LOCUS_16800 10206 10889 gene locus_tag LOCUS_16810 10206 10889 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224480.1 protein_id gnl|my_center|LOCUS_16810 11518 10886 gene locus_tag LOCUS_16820 11518 10886 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224479.1 protein_id gnl|my_center|LOCUS_16820 11991 11524 gene locus_tag LOCUS_16830 gene dut 11991 11524 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_16830 12031 12480 gene locus_tag LOCUS_16840 12031 12480 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224477.1 protein_id gnl|my_center|LOCUS_16840 12947 12648 gene locus_tag LOCUS_16850 12947 12648 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224476.1 protein_id gnl|my_center|LOCUS_16850 13432 14091 gene locus_tag LOCUS_16860 gene cei 13432 14091 CDS product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224475.1 protein_id gnl|my_center|LOCUS_16860 15085 14285 gene locus_tag LOCUS_16870 15085 14285 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_16870 15181 15942 gene locus_tag LOCUS_16880 15181 15942 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284355.1 protein_id gnl|my_center|LOCUS_16880 16140 17441 gene locus_tag LOCUS_16890 16140 17441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 17623 19116 gene locus_tag LOCUS_16900 17623 19116 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225606.1 protein_id gnl|my_center|LOCUS_16900 19532 19711 gene locus_tag LOCUS_16910 19532 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224457.1 protein_id gnl|my_center|LOCUS_16910 19833 22004 gene locus_tag LOCUS_16920 gene fxsT 19833 22004 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190714.1 protein_id gnl|my_center|LOCUS_16920 23069 21897 gene locus_tag LOCUS_16930 23069 21897 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_16930 24498 23071 gene locus_tag LOCUS_16940 24498 23071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224455.1 protein_id gnl|my_center|LOCUS_16940 25307 24534 gene locus_tag LOCUS_16950 25307 24534 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_16950 26566 25430 gene locus_tag LOCUS_16960 26566 25430 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224453.1 protein_id gnl|my_center|LOCUS_16960 28458 26746 gene locus_tag LOCUS_16970 28458 26746 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224452.1 protein_id gnl|my_center|LOCUS_16970 28660 29793 gene locus_tag LOCUS_16980 28660 29793 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224451.1 protein_id gnl|my_center|LOCUS_16980 30064 29816 gene locus_tag LOCUS_16990 30064 29816 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284335.1 protein_id gnl|my_center|LOCUS_16990 30096 31004 gene locus_tag LOCUS_17000 30096 31004 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224445.1 protein_id gnl|my_center|LOCUS_17000 31001 31894 gene locus_tag LOCUS_17010 31001 31894 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_17010 32190 31876 gene locus_tag LOCUS_17020 32190 31876 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224443.1 protein_id gnl|my_center|LOCUS_17020 32274 33767 gene locus_tag LOCUS_17030 32274 33767 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731180.1 protein_id gnl|my_center|LOCUS_17030 33934 35421 gene locus_tag LOCUS_17040 33934 35421 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742165.1 protein_id gnl|my_center|LOCUS_17040 35418 35843 gene locus_tag LOCUS_17050 gene dtd 35418 35843 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224440.1 protein_id gnl|my_center|LOCUS_17050 36046 37038 gene locus_tag LOCUS_17060 36046 37038 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224439.1 protein_id gnl|my_center|LOCUS_17060 38150 37230 gene locus_tag LOCUS_17070 38150 37230 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223218.1 protein_id gnl|my_center|LOCUS_17070 38239 39912 gene locus_tag LOCUS_17080 38239 39912 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224438.1 protein_id gnl|my_center|LOCUS_17080 40113 39925 gene locus_tag LOCUS_17090 40113 39925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 40958 40110 gene locus_tag LOCUS_17100 40958 40110 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_17100 41060 41320 gene locus_tag LOCUS_17110 41060 41320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 42638 41325 gene locus_tag LOCUS_17120 42638 41325 CDS product jacalin-like lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224244.1 protein_id gnl|my_center|LOCUS_17120 43249 42725 gene locus_tag LOCUS_17130 43249 42725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 43652 43335 gene locus_tag LOCUS_17140 43652 43335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 45180 44038 gene locus_tag LOCUS_17150 45180 44038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731583.1 protein_id gnl|my_center|LOCUS_17150 46430 45174 gene locus_tag LOCUS_17160 46430 45174 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_17160 47329 46427 gene locus_tag LOCUS_17170 47329 46427 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731064.1 protein_id gnl|my_center|LOCUS_17170 47923 47609 gene locus_tag LOCUS_17180 47923 47609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 48065 48847 gene locus_tag LOCUS_17190 48065 48847 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731051.1 protein_id gnl|my_center|LOCUS_17190 48873 49694 gene locus_tag LOCUS_17200 48873 49694 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227771.1 protein_id gnl|my_center|LOCUS_17200 49691 51187 gene locus_tag LOCUS_17210 49691 51187 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227765.1 protein_id gnl|my_center|LOCUS_17210 51651 52433 gene locus_tag LOCUS_17220 51651 52433 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226414.1 protein_id gnl|my_center|LOCUS_17220 53548 52613 gene locus_tag LOCUS_17230 53548 52613 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495068.1 protein_id gnl|my_center|LOCUS_17230 54749 53559 gene locus_tag LOCUS_17240 54749 53559 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026891.1 protein_id gnl|my_center|LOCUS_17240 55121 54858 gene locus_tag LOCUS_17250 55121 54858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 55033 55278 gene locus_tag LOCUS_17260 55033 55278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 57135 55942 gene locus_tag LOCUS_17270 57135 55942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_17270 57793 57128 gene locus_tag LOCUS_17280 57793 57128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_17280 58914 57790 gene locus_tag LOCUS_17290 58914 57790 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_17290 59395 58925 gene locus_tag LOCUS_17300 59395 58925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 59493 60158 gene locus_tag LOCUS_17310 59493 60158 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_17310 60158 61288 gene locus_tag LOCUS_17320 60158 61288 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_17320 62293 61439 gene locus_tag LOCUS_17330 62293 61439 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_17330 62498 63832 gene locus_tag LOCUS_17340 62498 63832 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106970097.1 protein_id gnl|my_center|LOCUS_17340 63829 64569 gene locus_tag LOCUS_17350 63829 64569 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028869.1 protein_id gnl|my_center|LOCUS_17350 64621 65643 gene locus_tag LOCUS_17360 64621 65643 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223936.1 protein_id gnl|my_center|LOCUS_17360 65640 66443 gene locus_tag LOCUS_17370 65640 66443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466752.1 protein_id gnl|my_center|LOCUS_17370 66542 67093 gene locus_tag LOCUS_17380 66542 67093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17380 67090 67737 gene locus_tag LOCUS_17390 67090 67737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224873.1 protein_id gnl|my_center|LOCUS_17390 68145 67819 gene locus_tag LOCUS_17400 68145 67819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 69156 68383 gene locus_tag LOCUS_17410 69156 68383 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224434.1 protein_id gnl|my_center|LOCUS_17410 70048 69215 gene locus_tag LOCUS_17420 70048 69215 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223187.1 protein_id gnl|my_center|LOCUS_17420 72847 70184 gene locus_tag LOCUS_17430 72847 70184 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_17430 74027 72852 gene locus_tag LOCUS_17440 74027 72852 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 protein_id gnl|my_center|LOCUS_17440 74190 74810 gene locus_tag LOCUS_17450 74190 74810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 75697 74861 gene locus_tag LOCUS_17460 75697 74861 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_17460 75759 76451 gene locus_tag LOCUS_17470 75759 76451 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224289.1 protein_id gnl|my_center|LOCUS_17470 76448 77608 gene locus_tag LOCUS_17480 gene galK 76448 77608 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224288.1 protein_id gnl|my_center|LOCUS_17480 77654 78616 gene locus_tag LOCUS_17490 gene galE 77654 78616 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224287.1 protein_id gnl|my_center|LOCUS_17490 78617 80668 gene locus_tag LOCUS_17500 78617 80668 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_17500 82086 81040 gene locus_tag LOCUS_17510 82086 81040 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224286.1 protein_id gnl|my_center|LOCUS_17510 82970 82203 gene locus_tag LOCUS_17520 82970 82203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 83612 83100 gene locus_tag LOCUS_17530 83612 83100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 85522 83705 gene locus_tag LOCUS_17540 85522 83705 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224280.1 protein_id gnl|my_center|LOCUS_17540 85577 86707 gene locus_tag LOCUS_17550 gene add 85577 86707 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228060.1 protein_id gnl|my_center|LOCUS_17550 87827 86664 gene locus_tag LOCUS_17560 87827 86664 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228549.1 protein_id gnl|my_center|LOCUS_17560 88723 87827 gene locus_tag LOCUS_17570 88723 87827 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_17570 88801 89661 gene locus_tag LOCUS_17580 88801 89661 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228693.1 protein_id gnl|my_center|LOCUS_17580 89658 90878 gene locus_tag LOCUS_17590 89658 90878 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223244.1 protein_id gnl|my_center|LOCUS_17590 91498 90866 gene locus_tag LOCUS_17600 91498 90866 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949618.1 protein_id gnl|my_center|LOCUS_17600 92427 91495 gene locus_tag LOCUS_17610 92427 91495 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_17610 92877 92437 gene locus_tag LOCUS_17620 92877 92437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466698.1 protein_id gnl|my_center|LOCUS_17620 93595 92945 gene locus_tag LOCUS_17630 93595 92945 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_17630 93658 94188 gene locus_tag LOCUS_17640 93658 94188 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866867.1 protein_id gnl|my_center|LOCUS_17640 94656 94228 gene locus_tag LOCUS_17650 94656 94228 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_17650 95926 94757 gene locus_tag LOCUS_17660 95926 94757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707777.1 protein_id gnl|my_center|LOCUS_17660 96462 95923 gene locus_tag LOCUS_17670 96462 95923 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977971.1 protein_id gnl|my_center|LOCUS_17670 99151 96512 gene locus_tag LOCUS_17680 99151 96512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 99378 99187 gene locus_tag LOCUS_17690 99378 99187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 99563 99411 gene locus_tag LOCUS_17700 99563 99411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 100060 99737 gene locus_tag LOCUS_17710 100060 99737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 100796 100098 gene locus_tag LOCUS_17720 100796 100098 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483174.1 protein_id gnl|my_center|LOCUS_17720 100839 101936 gene locus_tag LOCUS_17730 100839 101936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413610.1 protein_id gnl|my_center|LOCUS_17730 102842 101994 gene locus_tag LOCUS_17740 102842 101994 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224233.1 protein_id gnl|my_center|LOCUS_17740 103513 102839 gene locus_tag LOCUS_17750 103513 102839 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224234.1 protein_id gnl|my_center|LOCUS_17750 104471 103584 gene locus_tag LOCUS_17760 104471 103584 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224235.1 protein_id gnl|my_center|LOCUS_17760 105289 104534 gene locus_tag LOCUS_17770 105289 104534 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466810.1 protein_id gnl|my_center|LOCUS_17770 105424 106095 gene locus_tag LOCUS_17780 105424 106095 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466811.1 protein_id gnl|my_center|LOCUS_17780 106096 107475 gene locus_tag LOCUS_17790 106096 107475 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_17790 108417 107494 gene locus_tag LOCUS_17800 108417 107494 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226648.1 protein_id gnl|my_center|LOCUS_17800 109624 108677 gene locus_tag LOCUS_17810 109624 108677 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224239.1 protein_id gnl|my_center|LOCUS_17810 109682 111148 gene locus_tag LOCUS_17820 gene miaB 109682 111148 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224253.1 protein_id gnl|my_center|LOCUS_17820 111136 111624 gene locus_tag LOCUS_17830 111136 111624 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224254.1 protein_id gnl|my_center|LOCUS_17830 113390 112056 gene locus_tag LOCUS_17840 113390 112056 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224256.1 protein_id gnl|my_center|LOCUS_17840 113576 114286 gene locus_tag LOCUS_17850 113576 114286 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_17850 114291 115199 gene locus_tag LOCUS_17860 gene miaA 114291 115199 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_17860 115204 116010 gene locus_tag LOCUS_17870 gene dapF 115204 116010 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_17870 116867 116007 gene locus_tag LOCUS_17880 116867 116007 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_17880 118089 116860 gene locus_tag LOCUS_17890 118089 116860 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_17890 119290 118073 gene locus_tag LOCUS_17900 119290 118073 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_17900 119314 119847 gene locus_tag LOCUS_17910 119314 119847 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224261.1 protein_id gnl|my_center|LOCUS_17910 119891 121336 gene locus_tag LOCUS_17920 gene hflX 119891 121336 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_17920 121341 122375 gene locus_tag LOCUS_17930 121341 122375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224263.1 protein_id gnl|my_center|LOCUS_17930 123099 122398 gene locus_tag LOCUS_17940 gene lexA 123099 122398 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091617684.1 protein_id gnl|my_center|LOCUS_17940 123317 123814 gene locus_tag LOCUS_17950 123317 123814 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224265.1 protein_id gnl|my_center|LOCUS_17950 124090 124548 gene locus_tag LOCUS_17960 gene nrdR 124090 124548 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224266.1 protein_id gnl|my_center|LOCUS_17960 124655 127498 gene locus_tag LOCUS_17970 124655 127498 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_17970 127833 128390 gene locus_tag LOCUS_17980 127833 128390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 128412 129011 gene locus_tag LOCUS_17990 128412 129011 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 protein_id gnl|my_center|LOCUS_17990 129086 130291 gene locus_tag LOCUS_18000 129086 130291 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106206.1 protein_id gnl|my_center|LOCUS_18000 130288 131013 gene locus_tag LOCUS_18010 130288 131013 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224270.1 protein_id gnl|my_center|LOCUS_18010 131088 131345 gene locus_tag LOCUS_18020 131088 131345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 131342 131764 gene locus_tag LOCUS_18030 131342 131764 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_18030 132564 131812 gene locus_tag LOCUS_18040 132564 131812 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_18040 134443 132566 gene locus_tag LOCUS_18050 134443 132566 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_18050 135214 134453 gene locus_tag LOCUS_18060 135214 134453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224225.1 protein_id gnl|my_center|LOCUS_18060 135629 135333 gene locus_tag LOCUS_18070 135629 135333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003054488.1 protein_id gnl|my_center|LOCUS_18070 135857 137722 gene locus_tag LOCUS_18080 gene edd 135857 137722 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284323.1 protein_id gnl|my_center|LOCUS_18080 137719 138357 gene locus_tag LOCUS_18090 gene eda 137719 138357 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224222.1 protein_id gnl|my_center|LOCUS_18090 139100 138459 gene locus_tag LOCUS_18100 139100 138459 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_18100 139155 139844 gene locus_tag LOCUS_18110 139155 139844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 protein_id gnl|my_center|LOCUS_18110 140459 139875 gene locus_tag LOCUS_18120 140459 139875 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224218.1 protein_id gnl|my_center|LOCUS_18120 141509 140466 gene locus_tag LOCUS_18130 gene recA 141509 140466 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_18130 141875 141681 gene locus_tag LOCUS_18140 141875 141681 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224216.1 protein_id gnl|my_center|LOCUS_18140 142347 141886 gene locus_tag LOCUS_18150 142347 141886 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973501.1 protein_id gnl|my_center|LOCUS_18150 142419 143258 gene locus_tag LOCUS_18160 142419 143258 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 protein_id gnl|my_center|LOCUS_18160 143268 143393 gene locus_tag LOCUS_18170 143268 143393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 144611 143394 gene locus_tag LOCUS_18180 144611 143394 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234232.1 protein_id gnl|my_center|LOCUS_18180 146591 144663 gene locus_tag LOCUS_18190 146591 144663 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224215.1 protein_id gnl|my_center|LOCUS_18190 146803 151347 gene locus_tag LOCUS_18200 146803 151347 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742098.1 protein_id gnl|my_center|LOCUS_18200 152709 151714 gene locus_tag LOCUS_18210 152709 151714 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227851.1 protein_id gnl|my_center|LOCUS_18210 153355 152711 gene locus_tag LOCUS_18220 153355 152711 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074680.1 protein_id gnl|my_center|LOCUS_18220 154633 153512 gene locus_tag LOCUS_18230 154633 153512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 155390 154704 gene locus_tag LOCUS_18240 155390 154704 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224207.1 protein_id gnl|my_center|LOCUS_18240 155494 156663 gene locus_tag LOCUS_18250 155494 156663 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115262.1 protein_id gnl|my_center|LOCUS_18250 156691 158274 gene locus_tag LOCUS_18260 156691 158274 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 protein_id gnl|my_center|LOCUS_18260 159112 158348 gene locus_tag LOCUS_18270 159112 158348 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224206.1 protein_id gnl|my_center|LOCUS_18270 159522 159109 gene locus_tag LOCUS_18280 159522 159109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18280 159705 160220 gene locus_tag LOCUS_18290 159705 160220 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_18290 160217 160777 gene locus_tag LOCUS_18300 160217 160777 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_18300 161304 160795 gene locus_tag LOCUS_18310 161304 160795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 162080 161469 gene locus_tag LOCUS_18320 162080 161469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 163883 162192 gene locus_tag LOCUS_18330 163883 162192 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_18330 163980 164636 gene locus_tag LOCUS_18340 163980 164636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 165568 164723 gene locus_tag LOCUS_18350 165568 164723 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224200.1 protein_id gnl|my_center|LOCUS_18350 165723 166790 gene locus_tag LOCUS_18360 165723 166790 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_18360 166793 168286 gene locus_tag LOCUS_18370 gene crtI 166793 168286 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_18370 168475 169362 gene locus_tag LOCUS_18380 168475 169362 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026911.1 protein_id gnl|my_center|LOCUS_18380 169823 169449 gene locus_tag LOCUS_18390 169823 169449 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729669.1 protein_id gnl|my_center|LOCUS_18390 170021 172060 gene locus_tag LOCUS_18400 gene pknB 170021 172060 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224192.1 protein_id gnl|my_center|LOCUS_18400 173482 172118 gene locus_tag LOCUS_18410 173482 172118 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449604.1 protein_id gnl|my_center|LOCUS_18410 173571 173858 gene locus_tag LOCUS_18420 173571 173858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 175554 173845 gene locus_tag LOCUS_18430 175554 173845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 175654 175902 gene locus_tag LOCUS_18440 175654 175902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 175920 176276 gene locus_tag LOCUS_18450 175920 176276 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_18450 177366 176341 gene locus_tag LOCUS_18460 177366 176341 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_18460 177959 177447 gene locus_tag LOCUS_18470 177959 177447 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224331.1 protein_id gnl|my_center|LOCUS_18470 178713 177982 gene locus_tag LOCUS_18480 178713 177982 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224330.1 protein_id gnl|my_center|LOCUS_18480 178915 179403 gene locus_tag LOCUS_18490 178915 179403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224328.1 protein_id gnl|my_center|LOCUS_18490 180382 179450 gene locus_tag LOCUS_18500 180382 179450 CDS product anti-sigma factor RsbA family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228509.1 protein_id gnl|my_center|LOCUS_18500 181454 180483 gene locus_tag LOCUS_18510 181454 180483 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 protein_id gnl|my_center|LOCUS_18510 181783 181448 gene locus_tag LOCUS_18520 181783 181448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 182931 181789 gene locus_tag LOCUS_18530 182931 181789 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224322.1 protein_id gnl|my_center|LOCUS_18530 183431 182982 gene locus_tag LOCUS_18540 183431 182982 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_18540 184247 183459 gene locus_tag LOCUS_18550 184247 183459 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224320.1 protein_id gnl|my_center|LOCUS_18550 184657 184259 gene locus_tag LOCUS_18560 184657 184259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224319.1 protein_id gnl|my_center|LOCUS_18560 184688 186559 gene locus_tag LOCUS_18570 184688 186559 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_18570 186882 189779 gene locus_tag LOCUS_18580 186882 189779 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_18580 190915 189785 gene locus_tag LOCUS_18590 190915 189785 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742100.1 protein_id gnl|my_center|LOCUS_18590 192190 190925 gene locus_tag LOCUS_18600 192190 190925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869422.1 protein_id gnl|my_center|LOCUS_18600 193304 192261 gene locus_tag LOCUS_18610 193304 192261 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227670.1 protein_id gnl|my_center|LOCUS_18610 194953 193604 gene locus_tag LOCUS_18620 194953 193604 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224086.1 protein_id gnl|my_center|LOCUS_18620 195127 196830 gene locus_tag LOCUS_18630 195127 196830 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_18630 196874 197158 gene locus_tag LOCUS_18640 196874 197158 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224084.1 protein_id gnl|my_center|LOCUS_18640 197476 197171 gene locus_tag LOCUS_18650 197476 197171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 199189 197519 gene locus_tag LOCUS_18660 199189 197519 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184859936.1 protein_id gnl|my_center|LOCUS_18660 200310 199186 gene locus_tag LOCUS_18670 200310 199186 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224082.1 protein_id gnl|my_center|LOCUS_18670 201116 200307 gene locus_tag LOCUS_18680 201116 200307 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224081.1 protein_id gnl|my_center|LOCUS_18680 201727 201161 gene locus_tag LOCUS_18690 201727 201161 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284302.1 protein_id gnl|my_center|LOCUS_18690 201854 202246 gene locus_tag LOCUS_18700 201854 202246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224079.1 protein_id gnl|my_center|LOCUS_18700 202298 202708 gene locus_tag LOCUS_18710 202298 202708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224078.1 protein_id gnl|my_center|LOCUS_18710 202716 203768 gene locus_tag LOCUS_18720 gene trpD 202716 203768 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_18720 204223 204891 gene locus_tag LOCUS_18730 204223 204891 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_18730 205372 204956 gene locus_tag LOCUS_18740 205372 204956 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224074.1 protein_id gnl|my_center|LOCUS_18740 206317 205385 gene locus_tag LOCUS_18750 206317 205385 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 protein_id gnl|my_center|LOCUS_18750 206597 208450 gene locus_tag LOCUS_18760 gene asnB 206597 208450 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224072.1 protein_id gnl|my_center|LOCUS_18760 208922 208503 gene locus_tag LOCUS_18770 208922 208503 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969729.1 protein_id gnl|my_center|LOCUS_18770 209004 210182 gene locus_tag LOCUS_18780 209004 210182 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228549.1 protein_id gnl|my_center|LOCUS_18780 210256 210429 gene locus_tag LOCUS_18790 210256 210429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 210757 210434 gene locus_tag LOCUS_18800 210757 210434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 211206 210832 gene locus_tag LOCUS_18810 211206 210832 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224070.1 protein_id gnl|my_center|LOCUS_18810 212249 211296 gene locus_tag LOCUS_18820 212249 211296 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_18820 212133 212993 gene locus_tag LOCUS_18830 212133 212993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 213049 214035 gene locus_tag LOCUS_18840 213049 214035 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_18840 214129 215568 gene locus_tag LOCUS_18850 214129 215568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 215783 215583 gene locus_tag LOCUS_18860 215783 215583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_18860 215880 216419 gene locus_tag LOCUS_18870 215880 216419 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856625.1 protein_id gnl|my_center|LOCUS_18870 216416 217453 gene locus_tag LOCUS_18880 gene cobT 216416 217453 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224062.1 protein_id gnl|my_center|LOCUS_18880 217453 218157 gene locus_tag LOCUS_18890 217453 218157 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729695.1 protein_id gnl|my_center|LOCUS_18890 219316 218216 gene locus_tag LOCUS_18900 219316 218216 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_18900 220603 219392 gene locus_tag LOCUS_18910 220603 219392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 220799 222295 gene locus_tag LOCUS_18920 220799 222295 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224057.1 protein_id gnl|my_center|LOCUS_18920 222919 222311 gene locus_tag LOCUS_18930 222919 222311 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_18930 222969 223538 gene locus_tag LOCUS_18940 222969 223538 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 protein_id gnl|my_center|LOCUS_18940 223883 223563 gene locus_tag LOCUS_18950 223883 223563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_18950 224060 225430 gene locus_tag LOCUS_18960 gene lpdA 224060 225430 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_18960 225485 227239 gene locus_tag LOCUS_18970 225485 227239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 227381 228265 gene locus_tag LOCUS_18980 227381 228265 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110454.1 protein_id gnl|my_center|LOCUS_18980 228265 228861 gene locus_tag LOCUS_18990 228265 228861 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224048.1 protein_id gnl|my_center|LOCUS_18990 228848 229591 gene locus_tag LOCUS_19000 gene lipB 228848 229591 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_19000 229680 230534 gene locus_tag LOCUS_19010 229680 230534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 231515 230583 gene locus_tag LOCUS_19020 231515 230583 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_19020 232217 231564 gene locus_tag LOCUS_19030 232217 231564 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095816.1 protein_id gnl|my_center|LOCUS_19030 232340 232798 gene locus_tag LOCUS_19040 232340 232798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224045.1 protein_id gnl|my_center|LOCUS_19040 232820 233761 gene locus_tag LOCUS_19050 232820 233761 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224044.1 protein_id gnl|my_center|LOCUS_19050 233777 234781 gene locus_tag LOCUS_19060 gene lipA 233777 234781 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 protein_id gnl|my_center|LOCUS_19060 235778 234756 gene locus_tag LOCUS_19070 235778 234756 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093996.1 protein_id gnl|my_center|LOCUS_19070 236078 235812 gene locus_tag LOCUS_19080 236078 235812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 235972 236337 gene locus_tag LOCUS_19090 235972 236337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 236578 237111 gene locus_tag LOCUS_19100 236578 237111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 237166 237774 gene locus_tag LOCUS_19110 237166 237774 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_19110 238188 237739 gene locus_tag LOCUS_19120 238188 237739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 238859 238281 gene locus_tag LOCUS_19130 238859 238281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 239970 238876 gene locus_tag LOCUS_19140 239970 238876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 240802 240275 gene locus_tag LOCUS_19150 240802 240275 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_19150 242013 240799 gene locus_tag LOCUS_19160 242013 240799 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_19160 242147 242722 gene locus_tag LOCUS_19170 242147 242722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 242719 242976 gene locus_tag LOCUS_19180 242719 242976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 243213 243141 gene locus_tag LOCUS_t00160 243213 243141 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 243719 243261 gene locus_tag LOCUS_19190 243719 243261 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_19190 244260 243829 gene locus_tag LOCUS_19200 244260 243829 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 protein_id gnl|my_center|LOCUS_19200 244556 247306 gene locus_tag LOCUS_19210 gene aceE 244556 247306 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223999.1 protein_id gnl|my_center|LOCUS_19210 247465 249471 gene locus_tag LOCUS_19220 247465 249471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 249473 250702 gene locus_tag LOCUS_19230 249473 250702 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_19230 251343 250699 gene locus_tag LOCUS_19240 251343 250699 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223994.1 protein_id gnl|my_center|LOCUS_19240 251649 252896 gene locus_tag LOCUS_19250 251649 252896 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224155.1 protein_id gnl|my_center|LOCUS_19250 253802 252984 gene locus_tag LOCUS_19260 253802 252984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223993.1 protein_id gnl|my_center|LOCUS_19260 255510 254011 gene locus_tag LOCUS_19270 255510 254011 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030952.1 protein_id gnl|my_center|LOCUS_19270 255601 256815 gene locus_tag LOCUS_19280 255601 256815 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223990.1 protein_id gnl|my_center|LOCUS_19280 256988 257932 gene locus_tag LOCUS_19290 256988 257932 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878004.1 protein_id gnl|my_center|LOCUS_19290 257929 258906 gene locus_tag LOCUS_19300 257929 258906 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223987.1 protein_id gnl|my_center|LOCUS_19300 258968 259207 gene locus_tag LOCUS_19310 258968 259207 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559006.1 protein_id gnl|my_center|LOCUS_19310 259204 260439 gene locus_tag LOCUS_19320 259204 260439 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_19320 260477 261904 gene locus_tag LOCUS_19330 260477 261904 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_19330 262563 261985 gene locus_tag LOCUS_19340 262563 261985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 263061 265589 gene locus_tag LOCUS_19350 gene lanKC 263061 265589 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092529862.1 protein_id gnl|my_center|LOCUS_19350 265624 265788 gene locus_tag LOCUS_19360 265624 265788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 265925 267517 gene locus_tag LOCUS_19370 265925 267517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031101.1 protein_id gnl|my_center|LOCUS_19370 267517 269277 gene locus_tag LOCUS_19380 267517 269277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031102.1 protein_id gnl|my_center|LOCUS_19380 270165 269662 gene locus_tag LOCUS_19390 270165 269662 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223984.1 protein_id gnl|my_center|LOCUS_19390 271864 270431 gene locus_tag LOCUS_19400 271864 270431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 272039 273283 gene locus_tag LOCUS_19410 272039 273283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 273675 273319 gene locus_tag LOCUS_19420 273675 273319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 275188 273809 gene locus_tag LOCUS_19430 275188 273809 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284234.1 protein_id gnl|my_center|LOCUS_19430 275869 275225 gene locus_tag LOCUS_19440 275869 275225 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_19440 276719 276033 gene locus_tag LOCUS_19450 276719 276033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 276922 277761 gene locus_tag LOCUS_19460 276922 277761 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228716.1 protein_id gnl|my_center|LOCUS_19460 277989 280241 gene locus_tag LOCUS_19470 277989 280241 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_19470 280569 280231 gene locus_tag LOCUS_19480 gene crcB 280569 280231 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_19480 280919 280566 gene locus_tag LOCUS_19490 280919 280566 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224560.1 protein_id gnl|my_center|LOCUS_19490 281346 280909 gene locus_tag LOCUS_19500 281346 280909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 281400 282680 gene locus_tag LOCUS_19510 281400 282680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 282734 283540 gene locus_tag LOCUS_19520 282734 283540 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229628.1 protein_id gnl|my_center|LOCUS_19520 283537 285594 gene locus_tag LOCUS_19530 283537 285594 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226197.1 protein_id gnl|my_center|LOCUS_19530 286984 285617 gene locus_tag LOCUS_19540 286984 285617 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_19540 287304 286981 gene locus_tag LOCUS_19550 287304 286981 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_19550 288332 287301 gene locus_tag LOCUS_19560 288332 287301 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_19560 289651 288482 gene locus_tag LOCUS_19570 289651 288482 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_19570 290953 289853 gene locus_tag LOCUS_19580 290953 289853 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304720.1 protein_id gnl|my_center|LOCUS_19580 291016 291600 gene locus_tag LOCUS_19590 291016 291600 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143060529.1 protein_id gnl|my_center|LOCUS_19590 291736 292038 gene locus_tag LOCUS_19600 291736 292038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 292336 292097 gene locus_tag LOCUS_19610 292336 292097 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_19610 293184 292333 gene locus_tag LOCUS_19620 293184 292333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_19620 294080 293181 gene locus_tag LOCUS_19630 294080 293181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_19630 294241 295440 gene locus_tag LOCUS_19640 294241 295440 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_19640 295437 295631 gene locus_tag LOCUS_19650 295437 295631 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228784.1 protein_id gnl|my_center|LOCUS_19650 296064 295717 gene locus_tag LOCUS_19660 gene mazF9 296064 295717 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_19660 296281 296051 gene locus_tag LOCUS_19670 296281 296051 CDS product type II toxin-antitoxin system antitoxin MazE9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901465.1 protein_id gnl|my_center|LOCUS_19670 297708 296278 gene locus_tag LOCUS_19680 297708 296278 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089659.1 protein_id gnl|my_center|LOCUS_19680 298766 297720 gene locus_tag LOCUS_19690 298766 297720 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037062758.1 protein_id gnl|my_center|LOCUS_19690 300431 299268 gene locus_tag LOCUS_19700 300431 299268 CDS product DUF3578 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531669.1 protein_id gnl|my_center|LOCUS_19700 301104 300931 gene locus_tag LOCUS_19710 301104 300931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 301152 301298 gene locus_tag LOCUS_19720 301152 301298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 301330 301491 gene locus_tag LOCUS_19730 301330 301491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19730 301634 301559 gene locus_tag LOCUS_t00170 301634 301559 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 302622 301720 gene locus_tag LOCUS_19740 302622 301720 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_19740 302812 302740 gene locus_tag LOCUS_t00180 302812 302740 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 302950 303180 gene locus_tag LOCUS_19750 302950 303180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 303978 303232 gene locus_tag LOCUS_19760 303978 303232 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228360.1 protein_id gnl|my_center|LOCUS_19760 304533 304030 gene locus_tag LOCUS_19770 304533 304030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467493.1 protein_id gnl|my_center|LOCUS_19770 306422 304533 gene locus_tag LOCUS_19780 gene dnaG 306422 304533 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_19780 306451 307359 gene locus_tag LOCUS_19790 306451 307359 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228363.1 protein_id gnl|my_center|LOCUS_19790 307925 307356 gene locus_tag LOCUS_19800 307925 307356 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228365.1 protein_id gnl|my_center|LOCUS_19800 308133 308576 gene locus_tag LOCUS_19810 308133 308576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 308641 309228 gene locus_tag LOCUS_19820 308641 309228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 310317 309271 gene locus_tag LOCUS_19830 310317 309271 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228372.1 protein_id gnl|my_center|LOCUS_19830 310484 310296 gene locus_tag LOCUS_19840 310484 310296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 311833 310571 gene locus_tag LOCUS_19850 311833 310571 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228373.1 protein_id gnl|my_center|LOCUS_19850 312493 311855 gene locus_tag LOCUS_19860 312493 311855 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_19860 312547 313278 gene locus_tag LOCUS_19870 312547 313278 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_19870 313313 313516 gene locus_tag LOCUS_19880 313313 313516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 314445 313666 gene locus_tag LOCUS_19890 314445 313666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 316268 314442 gene locus_tag LOCUS_19900 316268 314442 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_19900 319747 316265 gene locus_tag LOCUS_19910 gene drmA 319747 316265 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_19910 320456 319818 gene locus_tag LOCUS_19920 320456 319818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 320766 324446 gene locus_tag LOCUS_19930 320766 324446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_19930 324581 325012 gene locus_tag LOCUS_19940 324581 325012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 325824 325000 gene locus_tag LOCUS_19950 325824 325000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 325950 326405 gene locus_tag LOCUS_19960 325950 326405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 327732 326446 gene locus_tag LOCUS_19970 327732 326446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 328496 328098 gene locus_tag LOCUS_19980 328496 328098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 328780 328493 gene locus_tag LOCUS_19990 328780 328493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 328893 329777 gene locus_tag LOCUS_20000 328893 329777 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_20000 329801 329980 gene locus_tag LOCUS_20010 329801 329980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 330101 331285 gene locus_tag LOCUS_20020 330101 331285 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_20020 335268 331327 gene locus_tag LOCUS_20030 335268 331327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_20030 338462 335265 gene locus_tag LOCUS_20040 gene drmD 338462 335265 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_20040 338531 340576 gene locus_tag LOCUS_20050 338531 340576 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_20050 340664 341113 gene locus_tag LOCUS_20060 340664 341113 CDS product DUF6194 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480128.1 protein_id gnl|my_center|LOCUS_20060 342591 341149 gene locus_tag LOCUS_20070 342591 341149 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_20070 343117 342791 gene locus_tag LOCUS_20080 343117 342791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 343296 343673 gene locus_tag LOCUS_20090 343296 343673 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782036.1 protein_id gnl|my_center|LOCUS_20090 343720 344718 gene locus_tag LOCUS_20100 343720 344718 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225780.1 protein_id gnl|my_center|LOCUS_20100 345155 344724 gene locus_tag LOCUS_20110 345155 344724 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529116.1 protein_id gnl|my_center|LOCUS_20110 345186 346166 gene locus_tag LOCUS_20120 345186 346166 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_20120 350071 346169 gene locus_tag LOCUS_20130 350071 346169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 351597 350212 gene locus_tag LOCUS_20140 351597 350212 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_20140 352093 351713 gene locus_tag LOCUS_20150 352093 351713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 352111 352377 gene locus_tag LOCUS_20160 352111 352377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 352423 352827 gene locus_tag LOCUS_20170 352423 352827 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060366.1 protein_id gnl|my_center|LOCUS_20170 352824 353246 gene locus_tag LOCUS_20180 352824 353246 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_20180 353982 353263 gene locus_tag LOCUS_20190 353982 353263 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228386.1 protein_id gnl|my_center|LOCUS_20190 354939 353989 gene locus_tag LOCUS_20200 354939 353989 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285799.1 protein_id gnl|my_center|LOCUS_20200 355113 355742 gene locus_tag LOCUS_20210 355113 355742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 356184 355750 gene locus_tag LOCUS_20220 356184 355750 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_20220 356614 356342 gene locus_tag LOCUS_20230 356614 356342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 357039 356614 gene locus_tag LOCUS_20240 357039 356614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228388.1 protein_id gnl|my_center|LOCUS_20240 357777 357040 gene locus_tag LOCUS_20250 357777 357040 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_20250 358653 357901 gene locus_tag LOCUS_20260 gene recO 358653 357901 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_20260 359549 358653 gene locus_tag LOCUS_20270 gene era 359549 358653 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_20270 359742 360596 gene locus_tag LOCUS_20280 359742 360596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 360932 360600 gene locus_tag LOCUS_20290 360932 360600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228397.1 protein_id gnl|my_center|LOCUS_20290 362223 360925 gene locus_tag LOCUS_20300 362223 360925 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_20300 362791 362237 gene locus_tag LOCUS_20310 gene ybeY 362791 362237 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228399.1 protein_id gnl|my_center|LOCUS_20310 363873 362797 gene locus_tag LOCUS_20320 363873 362797 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_20320 363985 364800 gene locus_tag LOCUS_20330 363985 364800 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029307.1 protein_id gnl|my_center|LOCUS_20330 365144 364803 gene locus_tag LOCUS_20340 365144 364803 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_20340 365935 365156 gene locus_tag LOCUS_20350 365935 365156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 366872 366138 gene locus_tag LOCUS_20360 366872 366138 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228402.1 protein_id gnl|my_center|LOCUS_20360 368020 366869 gene locus_tag LOCUS_20370 gene dnaJ 368020 366869 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228403.1 protein_id gnl|my_center|LOCUS_20370 369125 368103 gene locus_tag LOCUS_20380 gene hrcA 369125 368103 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228404.1 protein_id gnl|my_center|LOCUS_20380 369236 370030 gene locus_tag LOCUS_20390 369236 370030 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230740.1 protein_id gnl|my_center|LOCUS_20390 371377 370154 gene locus_tag LOCUS_20400 gene hemW 371377 370154 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_20400 371661 373343 gene locus_tag LOCUS_20410 371661 373343 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_20410 373340 373498 gene locus_tag LOCUS_20420 373340 373498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228432.1 protein_id gnl|my_center|LOCUS_20420 373495 374196 gene locus_tag LOCUS_20430 373495 374196 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228433.1 protein_id gnl|my_center|LOCUS_20430 374193 375098 gene locus_tag LOCUS_20440 gene cysD 374193 375098 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228434.1 protein_id gnl|my_center|LOCUS_20440 375099 376442 gene locus_tag LOCUS_20450 375099 376442 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228435.1 protein_id gnl|my_center|LOCUS_20450 376466 377539 gene locus_tag LOCUS_20460 376466 377539 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223440.1 protein_id gnl|my_center|LOCUS_20460 377561 378349 gene locus_tag LOCUS_20470 377561 378349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223441.1 protein_id gnl|my_center|LOCUS_20470 378336 379208 gene locus_tag LOCUS_20480 378336 379208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_20480 379205 379936 gene locus_tag LOCUS_20490 379205 379936 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 protein_id gnl|my_center|LOCUS_20490 380419 379964 gene locus_tag LOCUS_20500 380419 379964 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230342.1 protein_id gnl|my_center|LOCUS_20500 381039 380416 gene locus_tag LOCUS_20510 381039 380416 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 protein_id gnl|my_center|LOCUS_20510 381102 381878 gene locus_tag LOCUS_20520 381102 381878 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_20520 382137 381922 gene locus_tag LOCUS_20530 382137 381922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 383013 382141 gene locus_tag LOCUS_20540 383013 382141 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_20540 382985 383158 gene locus_tag LOCUS_20550 382985 383158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 383415 383146 gene locus_tag LOCUS_20560 383415 383146 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228442.1 protein_id gnl|my_center|LOCUS_20560 383846 383412 gene locus_tag LOCUS_20570 383846 383412 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228443.1 protein_id gnl|my_center|LOCUS_20570 384133 383858 gene locus_tag LOCUS_20580 384133 383858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 384163 385131 gene locus_tag LOCUS_20590 384163 385131 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228445.1 protein_id gnl|my_center|LOCUS_20590 385254 386687 gene locus_tag LOCUS_20600 385254 386687 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876237.1 protein_id gnl|my_center|LOCUS_20600 388301 386673 gene locus_tag LOCUS_20610 388301 386673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 389356 388319 gene locus_tag LOCUS_20620 389356 388319 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228448.1 protein_id gnl|my_center|LOCUS_20620 391011 389518 gene locus_tag LOCUS_20630 391011 389518 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223451.1 protein_id gnl|my_center|LOCUS_20630 391106 391546 gene locus_tag LOCUS_20640 391106 391546 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_20640 391668 391889 gene locus_tag LOCUS_20650 391668 391889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 392517 391948 gene locus_tag LOCUS_20660 392517 391948 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228455.1 protein_id gnl|my_center|LOCUS_20660 394479 392635 gene locus_tag LOCUS_20670 gene lepA 394479 392635 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228456.1 protein_id gnl|my_center|LOCUS_20670 394570 395016 gene locus_tag LOCUS_20680 394570 395016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 395098 395694 gene locus_tag LOCUS_20690 395098 395694 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228457.1 protein_id gnl|my_center|LOCUS_20690 396039 395671 gene locus_tag LOCUS_20700 396039 395671 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228458.1 protein_id gnl|my_center|LOCUS_20700 396511 396053 gene locus_tag LOCUS_20710 396511 396053 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223648.1 protein_id gnl|my_center|LOCUS_20710 397544 396516 gene locus_tag LOCUS_20720 397544 396516 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_20720 397494 397703 gene locus_tag LOCUS_20730 397494 397703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 397747 398670 gene locus_tag LOCUS_20740 397747 398670 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_20740 398672 398887 gene locus_tag LOCUS_20750 398672 398887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 399228 398884 gene locus_tag LOCUS_20760 399228 398884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 399230 399955 gene locus_tag LOCUS_20770 399230 399955 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222836.1 protein_id gnl|my_center|LOCUS_20770 400727 399924 gene locus_tag LOCUS_20780 400727 399924 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028380.1 protein_id gnl|my_center|LOCUS_20780 400873 403152 gene locus_tag LOCUS_20790 400873 403152 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_20790 403282 403542 gene locus_tag LOCUS_20800 gene rpsT 403282 403542 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228460.1 protein_id gnl|my_center|LOCUS_20800 404618 403635 gene locus_tag LOCUS_20810 gene holA 404618 403635 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228461.1 protein_id gnl|my_center|LOCUS_20810 404842 406104 gene locus_tag LOCUS_20820 gene thrC 404842 406104 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228462.1 protein_id gnl|my_center|LOCUS_20820 409048 406163 gene locus_tag LOCUS_20830 409048 406163 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_20830 409567 409301 gene locus_tag LOCUS_20840 409567 409301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 410317 409592 gene locus_tag LOCUS_20850 410317 409592 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228465.1 protein_id gnl|my_center|LOCUS_20850 411246 410404 gene locus_tag LOCUS_20860 411246 410404 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_20860 411989 411258 gene locus_tag LOCUS_20870 411989 411258 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228467.1 protein_id gnl|my_center|LOCUS_20870 412600 411986 gene locus_tag LOCUS_20880 412600 411986 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228468.1 protein_id gnl|my_center|LOCUS_20880 412983 412597 gene locus_tag LOCUS_20890 gene rsfS 412983 412597 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_20890 413622 413053 gene locus_tag LOCUS_20900 gene nadD 413622 413053 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_20900 414230 414009 gene locus_tag LOCUS_20910 414230 414009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 415527 414343 gene locus_tag LOCUS_20920 415527 414343 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_20920 416147 415587 gene locus_tag LOCUS_20930 416147 415587 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_20930 417409 416144 gene locus_tag LOCUS_20940 417409 416144 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729942.1 protein_id gnl|my_center|LOCUS_20940 417552 417406 gene locus_tag LOCUS_20950 417552 417406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 417605 419683 gene locus_tag LOCUS_20960 417605 419683 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_20960 419706 420251 gene locus_tag LOCUS_20970 419706 420251 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521511.1 protein_id gnl|my_center|LOCUS_20970 420345 421622 gene locus_tag LOCUS_20980 420345 421622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270331.1 protein_id gnl|my_center|LOCUS_20980 421959 421627 gene locus_tag LOCUS_20990 421959 421627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 423103 421973 gene locus_tag LOCUS_21000 gene proB 423103 421973 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228477.1 protein_id gnl|my_center|LOCUS_21000 424572 423100 gene locus_tag LOCUS_21010 gene obgE 424572 423100 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228478.1 protein_id gnl|my_center|LOCUS_21010 424931 424668 gene locus_tag LOCUS_21020 gene rpmA 424931 424668 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896001.1 protein_id gnl|my_center|LOCUS_21020 425260 424946 gene locus_tag LOCUS_21030 gene rplU 425260 424946 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067132.1 protein_id gnl|my_center|LOCUS_21030 428476 425522 gene locus_tag LOCUS_21040 428476 425522 CDS product translation initiation factor IF-2 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228480.1 protein_id gnl|my_center|LOCUS_21040 429412 428669 gene locus_tag LOCUS_21050 429412 428669 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_21050 429672 431153 gene locus_tag LOCUS_21060 429672 431153 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285809.1 protein_id gnl|my_center|LOCUS_21060 433851 431155 gene locus_tag LOCUS_21070 433851 431155 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223082.1 protein_id gnl|my_center|LOCUS_21070 434617 434108 gene locus_tag LOCUS_21080 434617 434108 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223084.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21080 434843 435646 gene locus_tag LOCUS_21090 434843 435646 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223086.1 protein_id gnl|my_center|LOCUS_21090 437615 435651 gene locus_tag LOCUS_21100 437615 435651 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_21100 438057 437647 gene locus_tag LOCUS_21110 438057 437647 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532413.1 protein_id gnl|my_center|LOCUS_21110 438963 438100 gene locus_tag LOCUS_21120 438963 438100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_21120 439748 438960 gene locus_tag LOCUS_21130 439748 438960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_21130 440700 439750 gene locus_tag LOCUS_21140 440700 439750 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_21140 440727 441317 gene locus_tag LOCUS_21150 440727 441317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 441776 441366 gene locus_tag LOCUS_21160 gene ndk 441776 441366 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228487.1 protein_id gnl|my_center|LOCUS_21160 441840 442481 gene locus_tag LOCUS_21170 441840 442481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 447997 442478 gene locus_tag LOCUS_21180 447997 442478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 449636 448125 gene locus_tag LOCUS_21190 449636 448125 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228488.1 protein_id gnl|my_center|LOCUS_21190 450124 449738 gene locus_tag LOCUS_21200 450124 449738 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228490.1 protein_id gnl|my_center|LOCUS_21200 451335 450121 gene locus_tag LOCUS_21210 451335 450121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 454118 451482 gene locus_tag LOCUS_21220 454118 451482 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228497.1 protein_id gnl|my_center|LOCUS_21220 454262 455161 gene locus_tag LOCUS_21230 454262 455161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 455407 457701 gene locus_tag LOCUS_21240 455407 457701 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_21240 457781 458245 gene locus_tag LOCUS_21250 457781 458245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 459769 458249 gene locus_tag LOCUS_21260 459769 458249 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 protein_id gnl|my_center|LOCUS_21260 461191 459884 gene locus_tag LOCUS_21270 461191 459884 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 protein_id gnl|my_center|LOCUS_21270 461259 462083 gene locus_tag LOCUS_21280 gene fdhD 461259 462083 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_21280 462080 463246 gene locus_tag LOCUS_21290 462080 463246 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838427.1 protein_id gnl|my_center|LOCUS_21290 463306 464172 gene locus_tag LOCUS_21300 463306 464172 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228508.1 protein_id gnl|my_center|LOCUS_21300 464223 464978 gene locus_tag LOCUS_21310 464223 464978 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142040.1 protein_id gnl|my_center|LOCUS_21310 465558 464965 gene locus_tag LOCUS_21320 465558 464965 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887590.1 protein_id gnl|my_center|LOCUS_21320 466840 465560 gene locus_tag LOCUS_21330 gene clpX 466840 465560 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_21330 467674 467048 gene locus_tag LOCUS_21340 467674 467048 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_21340 468281 467703 gene locus_tag LOCUS_21350 468281 467703 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228512.1 protein_id gnl|my_center|LOCUS_21350 469783 468425 gene locus_tag LOCUS_21360 gene tig 469783 468425 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_21360 470874 471836 gene locus_tag LOCUS_21370 470874 471836 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_21370 471926 472177 gene locus_tag LOCUS_21380 471926 472177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 472329 472174 gene locus_tag LOCUS_21390 472329 472174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177328924.1 protein_id gnl|my_center|LOCUS_21390 472461 472387 gene locus_tag LOCUS_t00190 472461 472387 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 472523 472594 gene locus_tag LOCUS_t00200 472523 472594 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 473800 472664 gene locus_tag LOCUS_21400 473800 472664 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_21400 473988 473800 gene locus_tag LOCUS_21410 473988 473800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 475608 474004 gene locus_tag LOCUS_21420 475608 474004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 protein_id gnl|my_center|LOCUS_21420 477074 475605 gene locus_tag LOCUS_21430 477074 475605 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110627.1 protein_id gnl|my_center|LOCUS_21430 477996 477418 gene locus_tag LOCUS_21440 477996 477418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 478193 477987 gene locus_tag LOCUS_21450 478193 477987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 478649 478197 gene locus_tag LOCUS_21460 478649 478197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 478810 479553 gene locus_tag LOCUS_21470 478810 479553 CDS product DUF5919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229650.1 protein_id gnl|my_center|LOCUS_21470 479566 480036 gene locus_tag LOCUS_21480 479566 480036 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229651.1 protein_id gnl|my_center|LOCUS_21480 480514 480029 gene locus_tag LOCUS_21490 480514 480029 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137208463.1 protein_id gnl|my_center|LOCUS_21490 482568 482260 gene locus_tag LOCUS_21500 482568 482260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 483678 484148 gene locus_tag LOCUS_21510 483678 484148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 484351 484154 gene locus_tag LOCUS_21520 484351 484154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 485018 484299 gene locus_tag LOCUS_21530 485018 484299 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224206.1 protein_id gnl|my_center|LOCUS_21530 485091 486311 gene locus_tag LOCUS_21540 485091 486311 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 protein_id gnl|my_center|LOCUS_21540 486375 487127 gene locus_tag LOCUS_21550 486375 487127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 487933 487130 gene locus_tag LOCUS_21560 487933 487130 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_21560 488439 487933 gene locus_tag LOCUS_21570 488439 487933 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467526.1 protein_id gnl|my_center|LOCUS_21570 488320 489135 gene locus_tag LOCUS_21580 488320 489135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 490630 489275 gene locus_tag LOCUS_21590 490630 489275 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_21590 491322 490699 gene locus_tag LOCUS_21600 491322 490699 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228584.1 protein_id gnl|my_center|LOCUS_21600 491542 494103 gene locus_tag LOCUS_21610 gene pepN 491542 494103 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_21610 495014 494136 gene locus_tag LOCUS_21620 495014 494136 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_21620 495228 496070 gene locus_tag LOCUS_21630 495228 496070 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224161.1 protein_id gnl|my_center|LOCUS_21630 496067 496228 gene locus_tag LOCUS_21640 496067 496228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 496766 496281 gene locus_tag LOCUS_21650 496766 496281 CDS product DUF5130 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228587.1 protein_id gnl|my_center|LOCUS_21650 496998 496753 gene locus_tag LOCUS_21660 496998 496753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228588.1 protein_id gnl|my_center|LOCUS_21660 497485 497850 gene locus_tag LOCUS_21670 497485 497850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 498532 497867 gene locus_tag LOCUS_21680 498532 497867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 498652 500778 gene locus_tag LOCUS_21690 498652 500778 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_21690 500795 501712 gene locus_tag LOCUS_21700 500795 501712 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_21700 503071 501737 gene locus_tag LOCUS_21710 503071 501737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031543.1 protein_id gnl|my_center|LOCUS_21710 503214 503600 gene locus_tag LOCUS_21720 503214 503600 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742154.1 protein_id gnl|my_center|LOCUS_21720 503658 505253 gene locus_tag LOCUS_21730 503658 505253 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228593.1 protein_id gnl|my_center|LOCUS_21730 506100 505474 gene locus_tag LOCUS_21740 506100 505474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228595.1 protein_id gnl|my_center|LOCUS_21740 506524 506093 gene locus_tag LOCUS_21750 506524 506093 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228596.1 protein_id gnl|my_center|LOCUS_21750 507495 506578 gene locus_tag LOCUS_21760 507495 506578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 508484 507492 gene locus_tag LOCUS_21770 508484 507492 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_21770 510046 508496 gene locus_tag LOCUS_21780 510046 508496 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_21780 510162 511826 gene locus_tag LOCUS_21790 510162 511826 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 protein_id gnl|my_center|LOCUS_21790 516866 512001 gene locus_tag LOCUS_21800 516866 512001 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228597.1 protein_id gnl|my_center|LOCUS_21800 520911 517156 gene locus_tag LOCUS_21810 520911 517156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 518159 518288 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gactgcggctcgggctgca 522606 520930 gene locus_tag LOCUS_21820 gene ettA 522606 520930 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_21820 523416 522925 gene locus_tag LOCUS_21830 523416 522925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 523580 524200 gene locus_tag LOCUS_21840 523580 524200 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230926.1 protein_id gnl|my_center|LOCUS_21840 524197 525126 gene locus_tag LOCUS_21850 524197 525126 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229376.1 protein_id gnl|my_center|LOCUS_21850 525140 525943 gene locus_tag LOCUS_21860 525140 525943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229377.1 protein_id gnl|my_center|LOCUS_21860 527895 525940 gene locus_tag LOCUS_21870 527895 525940 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_21870 528002 528547 gene locus_tag LOCUS_21880 528002 528547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 529700 528513 gene locus_tag LOCUS_21890 529700 528513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228603.1 protein_id gnl|my_center|LOCUS_21890 529764 530819 gene locus_tag LOCUS_21900 529764 530819 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889126.1 protein_id gnl|my_center|LOCUS_21900 530946 531019 gene locus_tag LOCUS_t00210 530946 531019 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 532355 531093 gene locus_tag LOCUS_21910 532355 531093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 533386 532595 gene locus_tag LOCUS_21920 533386 532595 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_21920 533534 534163 gene locus_tag LOCUS_21930 533534 534163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 535762 534167 gene locus_tag LOCUS_21940 535762 534167 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_21940 535830 536777 gene locus_tag LOCUS_21950 535830 536777 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027162.1 protein_id gnl|my_center|LOCUS_21950 537699 536761 gene locus_tag LOCUS_21960 537699 536761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 538412 537759 gene locus_tag LOCUS_21970 538412 537759 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228286.1 protein_id gnl|my_center|LOCUS_21970 539410 538409 gene locus_tag LOCUS_21980 539410 538409 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_21980 539575 540186 gene locus_tag LOCUS_21990 539575 540186 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222232.1 protein_id gnl|my_center|LOCUS_21990 541003 540212 gene locus_tag LOCUS_22000 541003 540212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 541165 542643 gene locus_tag LOCUS_22010 541165 542643 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_22010 542731 544314 gene locus_tag LOCUS_22020 542731 544314 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228450.1 protein_id gnl|my_center|LOCUS_22020 545628 544321 gene locus_tag LOCUS_22030 545628 544321 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 protein_id gnl|my_center|LOCUS_22030 545760 547172 gene locus_tag LOCUS_22040 545760 547172 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222293.1 protein_id gnl|my_center|LOCUS_22040 547178 547777 gene locus_tag LOCUS_22050 547178 547777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 547774 548388 gene locus_tag LOCUS_22060 547774 548388 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224090.1 protein_id gnl|my_center|LOCUS_22060 548403 548678 gene locus_tag LOCUS_22070 548403 548678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 548716 549384 gene locus_tag LOCUS_22080 gene yidC 548716 549384 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229420.1 protein_id gnl|my_center|LOCUS_22080 550282 549293 gene locus_tag LOCUS_22090 550282 549293 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230685.1 protein_id gnl|my_center|LOCUS_22090 551901 550360 gene locus_tag LOCUS_22100 551901 550360 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_22100 552016 553641 gene locus_tag LOCUS_22110 gene pruA 552016 553641 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_22110 553644 554567 gene locus_tag LOCUS_22120 553644 554567 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_22120 555893 554547 gene locus_tag LOCUS_22130 555893 554547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 556057 557730 gene locus_tag LOCUS_22140 556057 557730 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_22140 557825 559222 gene locus_tag LOCUS_22150 557825 559222 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222084.1 protein_id gnl|my_center|LOCUS_22150 559219 559950 gene locus_tag LOCUS_22160 559219 559950 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_22160 560771 559932 gene locus_tag LOCUS_22170 560771 559932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715181.1 protein_id gnl|my_center|LOCUS_22170 560946 561368 gene locus_tag LOCUS_22180 560946 561368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 561371 561976 gene locus_tag LOCUS_22190 561371 561976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 561981 563327 gene locus_tag LOCUS_22200 561981 563327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 563345 564163 gene locus_tag LOCUS_22210 563345 564163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 565310 564135 gene locus_tag LOCUS_22220 565310 564135 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228751.1 protein_id gnl|my_center|LOCUS_22220 565494 565327 gene locus_tag LOCUS_22230 565494 565327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 566033 565782 gene locus_tag LOCUS_22240 566033 565782 CDS product AMED_5909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072476545.1 protein_id gnl|my_center|LOCUS_22240 566349 566014 gene locus_tag LOCUS_22250 566349 566014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 566817 566353 gene locus_tag LOCUS_22260 566817 566353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043777067.1 protein_id gnl|my_center|LOCUS_22260 567057 567896 gene locus_tag LOCUS_22270 567057 567896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 567896 568708 gene locus_tag LOCUS_22280 567896 568708 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230072.1 protein_id gnl|my_center|LOCUS_22280 569667 568735 gene locus_tag LOCUS_22290 569667 568735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 571461 570292 gene locus_tag LOCUS_22300 571461 570292 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031626.1 protein_id gnl|my_center|LOCUS_22300 573611 571458 gene locus_tag LOCUS_22310 gene secD 573611 571458 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030698.1 protein_id gnl|my_center|LOCUS_22310 573980 573651 gene locus_tag LOCUS_22320 573980 573651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 574996 574004 gene locus_tag LOCUS_22330 574996 574004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 575696 575085 gene locus_tag LOCUS_22340 575696 575085 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 protein_id gnl|my_center|LOCUS_22340 575800 576270 gene locus_tag LOCUS_22350 575800 576270 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224731.1 protein_id gnl|my_center|LOCUS_22350 576637 576287 gene locus_tag LOCUS_22360 576637 576287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 576811 577014 gene locus_tag LOCUS_22370 576811 577014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223722.1 protein_id gnl|my_center|LOCUS_22370 577082 578944 gene locus_tag LOCUS_22380 577082 578944 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223721.1 protein_id gnl|my_center|LOCUS_22380 578941 580521 gene locus_tag LOCUS_22390 578941 580521 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227752.1 protein_id gnl|my_center|LOCUS_22390 580548 581873 gene locus_tag LOCUS_22400 580548 581873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 581914 582246 gene locus_tag LOCUS_22410 581914 582246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 582301 582801 gene locus_tag LOCUS_22420 582301 582801 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_22420 582798 584321 gene locus_tag LOCUS_22430 582798 584321 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_22430 585875 584349 gene locus_tag LOCUS_22440 585875 584349 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228844.1 protein_id gnl|my_center|LOCUS_22440 585974 586570 gene locus_tag LOCUS_22450 gene orn 585974 586570 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831683.1 protein_id gnl|my_center|LOCUS_22450 586633 586708 gene locus_tag LOCUS_t00220 586633 586708 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 586767 588398 gene locus_tag LOCUS_22460 586767 588398 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_22460 589423 588401 gene locus_tag LOCUS_22470 589423 588401 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_22470 589326 589634 gene locus_tag LOCUS_22480 589326 589634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 589835 589908 gene locus_tag LOCUS_t00230 589835 589908 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 593414 590433 gene locus_tag LOCUS_22490 593414 590433 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_22490 593628 594803 gene locus_tag LOCUS_22500 593628 594803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228145.1 protein_id gnl|my_center|LOCUS_22500 594800 595222 gene locus_tag LOCUS_22510 594800 595222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 597145 595148 gene locus_tag LOCUS_22520 597145 595148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 597066 597293 gene locus_tag LOCUS_22530 597066 597293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 598097 597465 gene locus_tag LOCUS_22540 598097 597465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 598226 599338 gene locus_tag LOCUS_22550 598226 599338 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223807.1 protein_id gnl|my_center|LOCUS_22550 599363 600103 gene locus_tag LOCUS_22560 599363 600103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 600145 600570 gene locus_tag LOCUS_22570 600145 600570 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_22570 600575 601672 gene locus_tag LOCUS_22580 gene dcm 600575 601672 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690264.1 protein_id gnl|my_center|LOCUS_22580 601722 602252 gene locus_tag LOCUS_22590 601722 602252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227840.1 protein_id gnl|my_center|LOCUS_22590 602292 602561 gene locus_tag LOCUS_22600 602292 602561 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971884.1 protein_id gnl|my_center|LOCUS_22600 602898 602626 gene locus_tag LOCUS_22610 602898 602626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 603562 605706 gene locus_tag LOCUS_22620 603562 605706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 605699 606511 gene locus_tag LOCUS_22630 605699 606511 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_22630 606598 608304 gene locus_tag LOCUS_22640 606598 608304 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223446.1 protein_id gnl|my_center|LOCUS_22640 608473 608892 gene locus_tag LOCUS_22650 608473 608892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 609184 608978 gene locus_tag LOCUS_22660 609184 608978 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_22660 609430 609762 gene locus_tag LOCUS_22670 609430 609762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 609786 610508 gene locus_tag LOCUS_22680 609786 610508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22680 610945 610505 gene locus_tag LOCUS_22690 610945 610505 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082660.1 protein_id gnl|my_center|LOCUS_22690 611608 610952 gene locus_tag LOCUS_22700 611608 610952 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228615.1 protein_id gnl|my_center|LOCUS_22700 611690 612181 gene locus_tag LOCUS_22710 611690 612181 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230339.1 protein_id gnl|my_center|LOCUS_22710 613283 612174 gene locus_tag LOCUS_22720 613283 612174 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224453.1 protein_id gnl|my_center|LOCUS_22720 613595 613768 gene locus_tag LOCUS_22730 613595 613768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 616795 613841 gene locus_tag LOCUS_22740 616795 613841 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_22740 616972 618924 gene locus_tag LOCUS_22750 616972 618924 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229437.1 protein_id gnl|my_center|LOCUS_22750 618946 619608 gene locus_tag LOCUS_22760 618946 619608 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_22760 619743 620225 gene locus_tag LOCUS_22770 619743 620225 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229438.1 protein_id gnl|my_center|LOCUS_22770 620267 621517 gene locus_tag LOCUS_22780 620267 621517 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742179.1 protein_id gnl|my_center|LOCUS_22780 621514 622230 gene locus_tag LOCUS_22790 621514 622230 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230360.1 protein_id gnl|my_center|LOCUS_22790 623888 622374 gene locus_tag LOCUS_22800 623888 622374 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_22800 623969 624547 gene locus_tag LOCUS_22810 623969 624547 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229440.1 protein_id gnl|my_center|LOCUS_22810 625129 624557 gene locus_tag LOCUS_22820 625129 624557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 625295 625555 gene locus_tag LOCUS_22830 625295 625555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 625650 626264 gene locus_tag LOCUS_22840 625650 626264 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244147.1 protein_id gnl|my_center|LOCUS_22840 626493 626272 gene locus_tag LOCUS_22850 626493 626272 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559246.1 protein_id gnl|my_center|LOCUS_22850 626658 626732 gene locus_tag LOCUS_t00240 626658 626732 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 627728 626778 gene locus_tag LOCUS_22860 627728 626778 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226002.1 protein_id gnl|my_center|LOCUS_22860 628294 627740 gene locus_tag LOCUS_22870 628294 627740 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228137.1 protein_id gnl|my_center|LOCUS_22870 628309 628752 gene locus_tag LOCUS_22880 628309 628752 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228136.1 protein_id gnl|my_center|LOCUS_22880 628821 629435 gene locus_tag LOCUS_22890 628821 629435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 630058 629420 gene locus_tag LOCUS_22900 630058 629420 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326115.1 protein_id gnl|my_center|LOCUS_22900 631122 630049 gene locus_tag LOCUS_22910 631122 630049 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976445.1 protein_id gnl|my_center|LOCUS_22910 631233 632525 gene locus_tag LOCUS_22920 631233 632525 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225709.1 protein_id gnl|my_center|LOCUS_22920 633531 632488 gene locus_tag LOCUS_22930 633531 632488 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_22930 633644 634669 gene locus_tag LOCUS_22940 633644 634669 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_22940 634960 635490 gene locus_tag LOCUS_22950 634960 635490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229448.1 protein_id gnl|my_center|LOCUS_22950 635510 635983 gene locus_tag LOCUS_22960 gene bcp 635510 635983 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412944.1 protein_id gnl|my_center|LOCUS_22960 636633 636031 gene locus_tag LOCUS_22970 gene rdgB 636633 636031 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_22970 637394 636630 gene locus_tag LOCUS_22980 gene rph 637394 636630 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229452.1 protein_id gnl|my_center|LOCUS_22980 637449 637967 gene locus_tag LOCUS_22990 637449 637967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 638492 638046 gene locus_tag LOCUS_23000 638492 638046 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_23000 639006 638503 gene locus_tag LOCUS_23010 639006 638503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 639808 638996 gene locus_tag LOCUS_23020 639808 638996 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_23020 640622 639948 gene locus_tag LOCUS_23030 640622 639948 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229455.1 protein_id gnl|my_center|LOCUS_23030 640821 641666 gene locus_tag LOCUS_23040 640821 641666 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_23040 642442 641672 gene locus_tag LOCUS_23050 642442 641672 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_23050 642818 644098 gene locus_tag LOCUS_23060 642818 644098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 645104 644154 gene locus_tag LOCUS_23070 645104 644154 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_23070 645399 645127 gene locus_tag LOCUS_23080 645399 645127 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559268.1 protein_id gnl|my_center|LOCUS_23080 645929 645474 gene locus_tag LOCUS_23090 645929 645474 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_23090 646475 645981 gene locus_tag LOCUS_23100 646475 645981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 647209 646646 gene locus_tag LOCUS_23110 647209 646646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 647766 647209 gene locus_tag LOCUS_23120 647766 647209 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229463.1 protein_id gnl|my_center|LOCUS_23120 648062 647763 gene locus_tag LOCUS_23130 gene clpS 648062 647763 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229464.1 protein_id gnl|my_center|LOCUS_23130 648139 649413 gene locus_tag LOCUS_23140 648139 649413 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229465.1 protein_id gnl|my_center|LOCUS_23140 649422 649991 gene locus_tag LOCUS_23150 649422 649991 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229466.1 protein_id gnl|my_center|LOCUS_23150 650823 650161 gene locus_tag LOCUS_23160 650823 650161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167384419.1 protein_id gnl|my_center|LOCUS_23160 652114 650951 gene locus_tag LOCUS_23170 gene wecB 652114 650951 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222665.1 protein_id gnl|my_center|LOCUS_23170 652357 652190 gene locus_tag LOCUS_23180 652357 652190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 653122 652361 gene locus_tag LOCUS_23190 653122 652361 CDS product choice-of-anchor P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222667.1 protein_id gnl|my_center|LOCUS_23190 653419 653898 gene locus_tag LOCUS_23200 gene xrtP 653419 653898 CDS product exosortase P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831449.1 protein_id gnl|my_center|LOCUS_23200 653895 655292 gene locus_tag LOCUS_23210 653895 655292 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222669.1 protein_id gnl|my_center|LOCUS_23210 655396 655971 gene locus_tag LOCUS_23220 655396 655971 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229469.1 protein_id gnl|my_center|LOCUS_23220 656099 658150 gene locus_tag LOCUS_23230 656099 658150 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_23230 659651 658242 gene locus_tag LOCUS_23240 659651 658242 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225960.1 protein_id gnl|my_center|LOCUS_23240 660380 659682 gene locus_tag LOCUS_23250 660380 659682 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229474.1 protein_id gnl|my_center|LOCUS_23250 661603 660377 gene locus_tag LOCUS_23260 gene serB 661603 660377 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229475.1 protein_id gnl|my_center|LOCUS_23260 663481 661694 gene locus_tag LOCUS_23270 gene ctaD 663481 661694 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_23270 664459 663749 gene locus_tag LOCUS_23280 664459 663749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 665392 664616 gene locus_tag LOCUS_23290 665392 664616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 665549 666289 gene locus_tag LOCUS_23300 665549 666289 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229477.1 protein_id gnl|my_center|LOCUS_23300 666312 666989 gene locus_tag LOCUS_23310 666312 666989 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228141.1 protein_id gnl|my_center|LOCUS_23310 666986 668266 gene locus_tag LOCUS_23320 666986 668266 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228142.1 protein_id gnl|my_center|LOCUS_23320 668266 668874 gene locus_tag LOCUS_23330 668266 668874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224446.1 protein_id gnl|my_center|LOCUS_23330 669421 668849 gene locus_tag LOCUS_23340 669421 668849 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 protein_id gnl|my_center|LOCUS_23340 670052 669435 gene locus_tag LOCUS_23350 670052 669435 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036990.1 protein_id gnl|my_center|LOCUS_23350 670714 670049 gene locus_tag LOCUS_23360 gene mtnC 670714 670049 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267285.1 protein_id gnl|my_center|LOCUS_23360 671714 670707 gene locus_tag LOCUS_23370 671714 670707 CDS product s-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679362.1 protein_id gnl|my_center|LOCUS_23370 672838 671714 gene locus_tag LOCUS_23380 672838 671714 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188478.1 protein_id gnl|my_center|LOCUS_23380 674059 672932 gene locus_tag LOCUS_23390 674059 672932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191307645.1 protein_id gnl|my_center|LOCUS_23390 674223 676478 gene locus_tag LOCUS_23400 674223 676478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 676518 677735 gene locus_tag LOCUS_23410 676518 677735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191307645.1 protein_id gnl|my_center|LOCUS_23410 678929 677724 gene locus_tag LOCUS_23420 678929 677724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191307645.1 protein_id gnl|my_center|LOCUS_23420 680020 678926 gene locus_tag LOCUS_23430 680020 678926 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228520.1 protein_id gnl|my_center|LOCUS_23430 680220 680456 gene locus_tag LOCUS_23440 680220 680456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 680524 681366 gene locus_tag LOCUS_23450 680524 681366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 683142 681412 gene locus_tag LOCUS_23460 683142 681412 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228450.1 protein_id gnl|my_center|LOCUS_23460 685805 683271 gene locus_tag LOCUS_23470 685805 683271 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225365.1 protein_id gnl|my_center|LOCUS_23470 685897 686220 gene locus_tag LOCUS_23480 685897 686220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 687336 686356 gene locus_tag LOCUS_23490 687336 686356 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_23490 687907 687338 gene locus_tag LOCUS_23500 687907 687338 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080770.1 protein_id gnl|my_center|LOCUS_23500 688212 687991 gene locus_tag LOCUS_23510 688212 687991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 688115 689377 gene locus_tag LOCUS_23520 688115 689377 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531249.1 protein_id gnl|my_center|LOCUS_23520 692019 689374 gene locus_tag LOCUS_23530 692019 689374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 692371 695313 gene locus_tag LOCUS_23540 692371 695313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 695445 695314 gene locus_tag LOCUS_23550 695445 695314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 697816 695561 gene locus_tag LOCUS_23560 697816 695561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 707338 697823 gene locus_tag LOCUS_23570 707338 697823 CDS product polymorphic toxin-type HINT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051754043.1 protein_id gnl|my_center|LOCUS_23570 710377 707534 gene locus_tag LOCUS_23580 710377 707534 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_23580 712683 710473 gene locus_tag LOCUS_23590 712683 710473 CDS product germacradienol/geosmin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630266.1 protein_id gnl|my_center|LOCUS_23590 712908 713357 gene locus_tag LOCUS_23600 712908 713357 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731118.1 protein_id gnl|my_center|LOCUS_23600 713448 714266 gene locus_tag LOCUS_23610 gene cdtA 713448 714266 CDS product siderophore ABC transporter ATP-binding protein CdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971743.1 protein_id gnl|my_center|LOCUS_23610 714301 715266 gene locus_tag LOCUS_23620 gene cdtB 714301 715266 CDS product siderophore ABC transporter substrate-binding protein CdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971744.1 protein_id gnl|my_center|LOCUS_23620 715266 717299 gene locus_tag LOCUS_23630 gene cdtC 715266 717299 CDS product siderophore ABC transporter permease CdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031636.1 protein_id gnl|my_center|LOCUS_23630 719107 717647 gene locus_tag LOCUS_23640 719107 717647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 719479 720006 gene locus_tag LOCUS_23650 719479 720006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 721284 720028 gene locus_tag LOCUS_23660 gene hisS 721284 720028 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_23660 721469 722050 gene locus_tag LOCUS_23670 721469 722050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 723455 722001 gene locus_tag LOCUS_23680 723455 722001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 723551 724090 gene locus_tag LOCUS_23690 723551 724090 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227754.1 protein_id gnl|my_center|LOCUS_23690 724068 724682 gene locus_tag LOCUS_23700 724068 724682 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_23700 726231 724696 gene locus_tag LOCUS_23710 726231 724696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028386.1 protein_id gnl|my_center|LOCUS_23710 726890 726228 gene locus_tag LOCUS_23720 726890 726228 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 protein_id gnl|my_center|LOCUS_23720 727653 727000 gene locus_tag LOCUS_23730 727653 727000 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227982.1 protein_id gnl|my_center|LOCUS_23730 728714 727650 gene locus_tag LOCUS_23740 728714 727650 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227983.1 protein_id gnl|my_center|LOCUS_23740 728862 729533 gene locus_tag LOCUS_23750 728862 729533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 729958 729515 gene locus_tag LOCUS_23760 729958 729515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 730673 729975 gene locus_tag LOCUS_23770 730673 729975 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 protein_id gnl|my_center|LOCUS_23770 730704 731669 gene locus_tag LOCUS_23780 730704 731669 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230079.1 protein_id gnl|my_center|LOCUS_23780 731656 732339 gene locus_tag LOCUS_23790 731656 732339 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485703.1 protein_id gnl|my_center|LOCUS_23790 733200 732268 gene locus_tag LOCUS_23800 733200 732268 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230075.1 protein_id gnl|my_center|LOCUS_23800 733976 733197 gene locus_tag LOCUS_23810 733976 733197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 734977 733973 gene locus_tag LOCUS_23820 734977 733973 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_23820 735342 734974 gene locus_tag LOCUS_23830 735342 734974 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_23830 735463 736107 gene locus_tag LOCUS_23840 735463 736107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 736243 736995 gene locus_tag LOCUS_23850 736243 736995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223290.1 protein_id gnl|my_center|LOCUS_23850 736992 739460 gene locus_tag LOCUS_23860 736992 739460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167338154.1 protein_id gnl|my_center|LOCUS_23860 739465 740700 gene locus_tag LOCUS_23870 739465 740700 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_23870 740688 741332 gene locus_tag LOCUS_23880 740688 741332 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225874.1 protein_id gnl|my_center|LOCUS_23880 741371 742624 gene locus_tag LOCUS_23890 741371 742624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 742962 744200 gene locus_tag LOCUS_23900 742962 744200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 745255 744239 gene locus_tag LOCUS_23910 745255 744239 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804052.1 protein_id gnl|my_center|LOCUS_23910 746096 745263 gene locus_tag LOCUS_23920 746096 745263 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804051.1 protein_id gnl|my_center|LOCUS_23920 746977 746093 gene locus_tag LOCUS_23930 746977 746093 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804050.1 protein_id gnl|my_center|LOCUS_23930 748314 747028 gene locus_tag LOCUS_23940 748314 747028 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804049.1 protein_id gnl|my_center|LOCUS_23940 748483 750522 gene locus_tag LOCUS_23950 748483 750522 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804048.1 protein_id gnl|my_center|LOCUS_23950 750647 750970 gene locus_tag LOCUS_23960 750647 750970 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223697.1 protein_id gnl|my_center|LOCUS_23960 750967 752094 gene locus_tag LOCUS_23970 750967 752094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223698.1 protein_id gnl|my_center|LOCUS_23970 752997 752110 gene locus_tag LOCUS_23980 752997 752110 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_23980 753181 753552 gene locus_tag LOCUS_23990 753181 753552 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_23990 753549 754805 gene locus_tag LOCUS_24000 753549 754805 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_24000 754875 755564 gene locus_tag LOCUS_24010 754875 755564 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229206.1 protein_id gnl|my_center|LOCUS_24010 756437 755574 gene locus_tag LOCUS_24020 756437 755574 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727063.1 protein_id gnl|my_center|LOCUS_24020 756535 757299 gene locus_tag LOCUS_24030 756535 757299 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389403.1 protein_id gnl|my_center|LOCUS_24030 759354 757342 gene locus_tag LOCUS_24040 759354 757342 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060585.1 protein_id gnl|my_center|LOCUS_24040 759469 759957 gene locus_tag LOCUS_24050 759469 759957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 760324 759962 gene locus_tag LOCUS_24060 760324 759962 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390276.1 protein_id gnl|my_center|LOCUS_24060 760405 760815 gene locus_tag LOCUS_24070 760405 760815 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223391.1 protein_id gnl|my_center|LOCUS_24070 760877 761209 gene locus_tag LOCUS_24080 760877 761209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 761702 761187 gene locus_tag LOCUS_24090 761702 761187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 761946 762410 gene locus_tag LOCUS_24100 761946 762410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 763017 762499 gene locus_tag LOCUS_24110 763017 762499 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847367.1 protein_id gnl|my_center|LOCUS_24110 763105 763785 gene locus_tag LOCUS_24120 763105 763785 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467764.1 protein_id gnl|my_center|LOCUS_24120 763778 764878 gene locus_tag LOCUS_24130 763778 764878 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230016.1 protein_id gnl|my_center|LOCUS_24130 765479 764847 gene locus_tag LOCUS_24140 gene vanX 765479 764847 CDS product D-Ala-D-Ala dipeptidase VanX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230017.1 protein_id gnl|my_center|LOCUS_24140 766507 765476 gene locus_tag LOCUS_24150 gene vanA-Sc 766507 765476 CDS product D-alanine--(R)-lactate ligase VanA-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029110.1 protein_id gnl|my_center|LOCUS_24150 767454 766504 gene locus_tag LOCUS_24160 767454 766504 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230019.1 protein_id gnl|my_center|LOCUS_24160 768078 767650 gene locus_tag LOCUS_24170 768078 767650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 768293 768664 gene locus_tag LOCUS_24180 768293 768664 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230611.1 protein_id gnl|my_center|LOCUS_24180 768661 769938 gene locus_tag LOCUS_24190 768661 769938 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228643.1 protein_id gnl|my_center|LOCUS_24190 770114 769890 gene locus_tag LOCUS_24200 770114 769890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 770390 771658 gene locus_tag LOCUS_24210 770390 771658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 772201 773214 gene locus_tag LOCUS_24220 772201 773214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 773608 773240 gene locus_tag LOCUS_24230 773608 773240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 774765 774109 gene locus_tag LOCUS_24240 774765 774109 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222406.1 protein_id gnl|my_center|LOCUS_24240 775976 774753 gene locus_tag LOCUS_24250 775976 774753 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222405.1 protein_id gnl|my_center|LOCUS_24250 776257 777387 gene locus_tag LOCUS_24260 776257 777387 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_24260 777668 778834 gene locus_tag LOCUS_24270 777668 778834 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_24270 779395 779057 gene locus_tag LOCUS_24280 779395 779057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 780669 779392 gene locus_tag LOCUS_24290 780669 779392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 780971 780783 gene locus_tag LOCUS_24300 780971 780783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24300 781595 781738 gene locus_tag LOCUS_24310 781595 781738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 782381 782668 gene locus_tag LOCUS_24320 782381 782668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 783266 782583 gene locus_tag LOCUS_24330 783266 782583 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209081.1 protein_id gnl|my_center|LOCUS_24330 784537 783263 gene locus_tag LOCUS_24340 784537 783263 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207706.1 protein_id gnl|my_center|LOCUS_24340 784634 784873 gene locus_tag LOCUS_24350 784634 784873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 786075 785635 gene locus_tag LOCUS_24360 786075 785635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 786882 786391 gene locus_tag LOCUS_24370 786882 786391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 786906 787244 gene locus_tag LOCUS_24380 786906 787244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 787270 788697 gene locus_tag LOCUS_24390 787270 788697 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207706.1 protein_id gnl|my_center|LOCUS_24390 788694 789425 gene locus_tag LOCUS_24400 788694 789425 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209081.1 protein_id gnl|my_center|LOCUS_24400 790786 790580 gene locus_tag LOCUS_24410 790786 790580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 791111 791677 gene locus_tag LOCUS_24420 791111 791677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 792239 792030 gene locus_tag LOCUS_24430 792239 792030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 792940 792236 gene locus_tag LOCUS_24440 792940 792236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 793128 792928 gene locus_tag LOCUS_24450 793128 792928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 793270 793136 gene locus_tag LOCUS_24460 793270 793136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 793360 793722 gene locus_tag LOCUS_24470 793360 793722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 793706 793891 gene locus_tag LOCUS_24480 793706 793891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 794428 795402 gene locus_tag LOCUS_24490 794428 795402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 796519 795311 gene locus_tag LOCUS_24500 796519 795311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 796799 797848 gene locus_tag LOCUS_24510 gene xerD 796799 797848 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970125.1 protein_id gnl|my_center|LOCUS_24510 797849 798175 gene locus_tag LOCUS_24520 797849 798175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 798182 799801 gene locus_tag LOCUS_24530 798182 799801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 800883 799717 gene locus_tag LOCUS_24540 800883 799717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 801419 802477 gene locus_tag LOCUS_24550 801419 802477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 802468 802995 gene locus_tag LOCUS_24560 802468 802995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 803129 805222 gene locus_tag LOCUS_24570 803129 805222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 805219 806463 gene locus_tag LOCUS_24580 805219 806463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 806463 808388 gene locus_tag LOCUS_24590 806463 808388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 808440 811088 gene locus_tag LOCUS_24600 808440 811088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 811177 812259 gene locus_tag LOCUS_24610 811177 812259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 812264 813262 gene locus_tag LOCUS_24620 812264 813262 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_24620 813707 815116 gene locus_tag LOCUS_24630 813707 815116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence04 355 1764 gene locus_tag LOCUS_24640 355 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1846 3708 gene locus_tag LOCUS_24650 1846 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 3853 5352 gene locus_tag LOCUS_24660 3853 5352 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_24660 6628 5402 gene locus_tag LOCUS_24670 6628 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 7589 6723 gene locus_tag LOCUS_24680 7589 6723 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_24680 7689 9332 gene locus_tag LOCUS_24690 7689 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 11317 9329 gene locus_tag LOCUS_24700 11317 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 11736 11329 gene locus_tag LOCUS_24710 11736 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 13049 11901 gene locus_tag LOCUS_24720 13049 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 14032 13046 gene locus_tag LOCUS_24730 14032 13046 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_24730 16235 14046 gene locus_tag LOCUS_24740 16235 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 16854 16360 gene locus_tag LOCUS_24750 16854 16360 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_24750 16948 17493 gene locus_tag LOCUS_24760 16948 17493 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 protein_id gnl|my_center|LOCUS_24760 17934 18434 gene locus_tag LOCUS_24770 17934 18434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227658.1 protein_id gnl|my_center|LOCUS_24770 19379 18522 gene locus_tag LOCUS_24780 19379 18522 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225560.1 protein_id gnl|my_center|LOCUS_24780 19518 20183 gene locus_tag LOCUS_24790 19518 20183 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225211.1 protein_id gnl|my_center|LOCUS_24790 20854 22122 gene locus_tag LOCUS_24800 20854 22122 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314712.1 protein_id gnl|my_center|LOCUS_24800 22190 29860 gene locus_tag LOCUS_24810 22190 29860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 29867 48667 gene locus_tag LOCUS_24820 29867 48667 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224968.1 protein_id gnl|my_center|LOCUS_24820 48664 49884 gene locus_tag LOCUS_24830 48664 49884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_24830 49881 50072 gene locus_tag LOCUS_24840 49881 50072 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224966.1 protein_id gnl|my_center|LOCUS_24840 51336 50110 gene locus_tag LOCUS_24850 51336 50110 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205325.1 protein_id gnl|my_center|LOCUS_24850 51305 51952 gene locus_tag LOCUS_24860 51305 51952 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228116.1 protein_id gnl|my_center|LOCUS_24860 52506 52015 gene locus_tag LOCUS_24870 52506 52015 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_24870 52775 52533 gene locus_tag LOCUS_24880 52775 52533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228333.1 protein_id gnl|my_center|LOCUS_24880 52955 54127 gene locus_tag LOCUS_24890 52955 54127 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_24890 54552 54145 gene locus_tag LOCUS_24900 54552 54145 CDS product DUF6292 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226102.1 protein_id gnl|my_center|LOCUS_24900 54955 54563 gene locus_tag LOCUS_24910 54955 54563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 54924 55286 gene locus_tag LOCUS_24920 54924 55286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 55401 55655 gene locus_tag LOCUS_24930 55401 55655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 55826 59992 gene locus_tag LOCUS_24940 55826 59992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 60627 60061 gene locus_tag LOCUS_24950 60627 60061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 60925 61476 gene locus_tag LOCUS_24960 60925 61476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 61599 61766 gene locus_tag LOCUS_24970 61599 61766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 61766 62797 gene locus_tag LOCUS_24980 61766 62797 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_24980 63004 64110 gene locus_tag LOCUS_24990 63004 64110 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224453.1 protein_id gnl|my_center|LOCUS_24990 65151 64150 gene locus_tag LOCUS_25000 65151 64150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 65392 66345 gene locus_tag LOCUS_25010 65392 66345 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257737.1 protein_id gnl|my_center|LOCUS_25010 66402 67445 gene locus_tag LOCUS_25020 gene hisC 66402 67445 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_25020 67474 68409 gene locus_tag LOCUS_25030 67474 68409 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031893.1 protein_id gnl|my_center|LOCUS_25030 68445 68948 gene locus_tag LOCUS_25040 68445 68948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 69024 69734 gene locus_tag LOCUS_25050 69024 69734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892876.1 protein_id gnl|my_center|LOCUS_25050 71694 69910 gene locus_tag LOCUS_25060 71694 69910 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098174.1 protein_id gnl|my_center|LOCUS_25060 72711 71713 gene locus_tag LOCUS_25070 72711 71713 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110699.1 protein_id gnl|my_center|LOCUS_25070 73677 73009 gene locus_tag LOCUS_25080 73677 73009 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_25080 73826 75043 gene locus_tag LOCUS_25090 73826 75043 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 protein_id gnl|my_center|LOCUS_25090 75141 77072 gene locus_tag LOCUS_25100 75141 77072 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226339.1 protein_id gnl|my_center|LOCUS_25100 77842 77069 gene locus_tag LOCUS_25110 77842 77069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 79157 77931 gene locus_tag LOCUS_25120 79157 77931 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_25120 79384 80964 gene locus_tag LOCUS_25130 79384 80964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_25130 80961 81956 gene locus_tag LOCUS_25140 80961 81956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_25140 81949 82836 gene locus_tag LOCUS_25150 81949 82836 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 protein_id gnl|my_center|LOCUS_25150 82830 83768 gene locus_tag LOCUS_25160 82830 83768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 protein_id gnl|my_center|LOCUS_25160 83762 84427 gene locus_tag LOCUS_25170 83762 84427 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972523.1 protein_id gnl|my_center|LOCUS_25170 86420 84441 gene locus_tag LOCUS_25180 86420 84441 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_25180 87439 86666 gene locus_tag LOCUS_25190 87439 86666 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391834.1 protein_id gnl|my_center|LOCUS_25190 88476 87436 gene locus_tag LOCUS_25200 88476 87436 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327137.1 protein_id gnl|my_center|LOCUS_25200 89532 88480 gene locus_tag LOCUS_25210 89532 88480 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531511.1 protein_id gnl|my_center|LOCUS_25210 89760 90806 gene locus_tag LOCUS_25220 89760 90806 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223494.1 protein_id gnl|my_center|LOCUS_25220 90881 91912 gene locus_tag LOCUS_25230 90881 91912 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258589.1 protein_id gnl|my_center|LOCUS_25230 91998 93299 gene locus_tag LOCUS_25240 91998 93299 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974524.1 protein_id gnl|my_center|LOCUS_25240 93388 94323 gene locus_tag LOCUS_25250 93388 94323 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942201.1 protein_id gnl|my_center|LOCUS_25250 94325 95212 gene locus_tag LOCUS_25260 94325 95212 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974523.1 protein_id gnl|my_center|LOCUS_25260 95236 96651 gene locus_tag LOCUS_25270 95236 96651 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_25270 97727 96693 gene locus_tag LOCUS_25280 97727 96693 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775815.1 protein_id gnl|my_center|LOCUS_25280 101172 97849 gene locus_tag LOCUS_25290 101172 97849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 101451 103931 gene locus_tag LOCUS_25300 101451 103931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 103990 104934 gene locus_tag LOCUS_25310 103990 104934 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_25310 105082 105747 gene locus_tag LOCUS_25320 105082 105747 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029635.1 protein_id gnl|my_center|LOCUS_25320 105795 107033 gene locus_tag LOCUS_25330 105795 107033 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_25330 107844 107119 gene locus_tag LOCUS_25340 107844 107119 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113058.1 protein_id gnl|my_center|LOCUS_25340 108715 107987 gene locus_tag LOCUS_25350 108715 107987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777027.1 protein_id gnl|my_center|LOCUS_25350 109655 108705 gene locus_tag LOCUS_25360 109655 108705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777026.1 protein_id gnl|my_center|LOCUS_25360 115598 109683 gene locus_tag LOCUS_25370 115598 109683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 118873 115601 gene locus_tag LOCUS_25380 118873 115601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 125718 118966 gene locus_tag LOCUS_25390 125718 118966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 130403 125715 gene locus_tag LOCUS_25400 130403 125715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 134950 130391 gene locus_tag LOCUS_25410 134950 130391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 136194 134947 gene locus_tag LOCUS_25420 136194 134947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 145652 136191 gene locus_tag LOCUS_25430 145652 136191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25430 147350 146202 gene locus_tag LOCUS_25440 147350 146202 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947657.1 protein_id gnl|my_center|LOCUS_25440 147615 147343 gene locus_tag LOCUS_25450 147615 147343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 148657 147632 gene locus_tag LOCUS_25460 148657 147632 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 protein_id gnl|my_center|LOCUS_25460 149528 148704 gene locus_tag LOCUS_25470 149528 148704 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_25470 150336 150076 gene locus_tag LOCUS_25480 150336 150076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 150979 151719 gene locus_tag LOCUS_25490 150979 151719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 151825 154281 gene locus_tag LOCUS_25500 151825 154281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 155244 154525 gene locus_tag LOCUS_25510 155244 154525 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_25510 155352 156131 gene locus_tag LOCUS_25520 155352 156131 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_25520 157365 156238 gene locus_tag LOCUS_25530 157365 156238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 158437 157451 gene locus_tag LOCUS_25540 158437 157451 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_25540 160017 158680 gene locus_tag LOCUS_25550 160017 158680 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027286.1 protein_id gnl|my_center|LOCUS_25550 160282 161313 gene locus_tag LOCUS_25560 160282 161313 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_25560 161644 161420 gene locus_tag LOCUS_25570 161644 161420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 162234 162728 gene locus_tag LOCUS_25580 162234 162728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 163353 164813 gene locus_tag LOCUS_25590 163353 164813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 165001 165504 gene locus_tag LOCUS_25600 165001 165504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 165643 166089 gene locus_tag LOCUS_25610 165643 166089 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383201.1 protein_id gnl|my_center|LOCUS_25610 166182 167627 gene locus_tag LOCUS_25620 166182 167627 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227543.1 protein_id gnl|my_center|LOCUS_25620 167657 168403 gene locus_tag LOCUS_25630 167657 168403 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224370.1 protein_id gnl|my_center|LOCUS_25630 168435 169268 gene locus_tag LOCUS_25640 168435 169268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 169301 170500 gene locus_tag LOCUS_25650 169301 170500 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_25650 170535 171320 gene locus_tag LOCUS_25660 gene fabG 170535 171320 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_25660 171880 172839 gene locus_tag LOCUS_25670 171880 172839 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225533.1 protein_id gnl|my_center|LOCUS_25670 172877 174358 gene locus_tag LOCUS_25680 172877 174358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 174898 174725 gene locus_tag LOCUS_25690 174898 174725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 175436 175023 gene locus_tag LOCUS_25700 175436 175023 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222741.1 protein_id gnl|my_center|LOCUS_25700 175486 176286 gene locus_tag LOCUS_25710 175486 176286 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222740.1 protein_id gnl|my_center|LOCUS_25710 176933 176283 gene locus_tag LOCUS_25720 176933 176283 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228655.1 protein_id gnl|my_center|LOCUS_25720 178843 177149 gene locus_tag LOCUS_25730 gene hutH 178843 177149 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256862.1 protein_id gnl|my_center|LOCUS_25730 178943 180511 gene locus_tag LOCUS_25740 178943 180511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 180916 180515 gene locus_tag LOCUS_25750 180916 180515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 181062 181877 gene locus_tag LOCUS_25760 181062 181877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 181948 182724 gene locus_tag LOCUS_25770 181948 182724 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_25770 182721 183902 gene locus_tag LOCUS_25780 182721 183902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 protein_id gnl|my_center|LOCUS_25780 184130 184306 gene locus_tag LOCUS_25790 184130 184306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 184327 185019 gene locus_tag LOCUS_25800 184327 185019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 185016 185921 gene locus_tag LOCUS_25810 185016 185921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978028.1 protein_id gnl|my_center|LOCUS_25810 185918 187000 gene locus_tag LOCUS_25820 185918 187000 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978029.1 protein_id gnl|my_center|LOCUS_25820 187923 186949 gene locus_tag LOCUS_25830 187923 186949 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015101.1 protein_id gnl|my_center|LOCUS_25830 188474 188040 gene locus_tag LOCUS_25840 188474 188040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 191863 188600 gene locus_tag LOCUS_25850 191863 188600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224182.1 protein_id gnl|my_center|LOCUS_25850 193230 192097 gene locus_tag LOCUS_25860 193230 192097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 193291 194241 gene locus_tag LOCUS_25870 193291 194241 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226156.1 protein_id gnl|my_center|LOCUS_25870 194507 196048 gene locus_tag LOCUS_25880 194507 196048 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975714.1 protein_id gnl|my_center|LOCUS_25880 196177 198531 gene locus_tag LOCUS_25890 196177 198531 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_25890 198528 199373 gene locus_tag LOCUS_25900 198528 199373 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_25900 199370 199867 gene locus_tag LOCUS_25910 199370 199867 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242999.1 protein_id gnl|my_center|LOCUS_25910 200470 200021 gene locus_tag LOCUS_25920 gene cynS 200470 200021 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_25920 200650 201504 gene locus_tag LOCUS_25930 200650 201504 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_25930 204278 201603 gene locus_tag LOCUS_25940 204278 201603 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729639.1 protein_id gnl|my_center|LOCUS_25940 204480 205907 gene locus_tag LOCUS_25950 204480 205907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 206121 207785 gene locus_tag LOCUS_25960 206121 207785 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198349.1 protein_id gnl|my_center|LOCUS_25960 207782 208336 gene locus_tag LOCUS_25970 207782 208336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 208359 209846 gene locus_tag LOCUS_25980 208359 209846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 209827 211821 gene locus_tag LOCUS_25990 209827 211821 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132113460.1 protein_id gnl|my_center|LOCUS_25990 211808 213517 gene locus_tag LOCUS_26000 211808 213517 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 protein_id gnl|my_center|LOCUS_26000 213702 214709 gene locus_tag LOCUS_26010 gene adhP 213702 214709 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258663.1 protein_id gnl|my_center|LOCUS_26010 214838 215164 gene locus_tag LOCUS_26020 214838 215164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 215161 215862 gene locus_tag LOCUS_26030 215161 215862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 215873 216469 gene locus_tag LOCUS_26040 215873 216469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 216474 216905 gene locus_tag LOCUS_26050 216474 216905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 219726 216916 gene locus_tag LOCUS_26060 219726 216916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 219929 220354 gene locus_tag LOCUS_26070 219929 220354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 220391 222523 gene locus_tag LOCUS_26080 220391 222523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 222520 223245 gene locus_tag LOCUS_26090 222520 223245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 223431 223919 gene locus_tag LOCUS_26100 223431 223919 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_26100 223933 224841 gene locus_tag LOCUS_26110 223933 224841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 225275 226693 gene locus_tag LOCUS_26120 225275 226693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 226690 230694 gene locus_tag LOCUS_26130 226690 230694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 236681 230976 gene locus_tag LOCUS_26140 236681 230976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 236751 237149 gene locus_tag LOCUS_26150 236751 237149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 237146 237961 gene locus_tag LOCUS_26160 237146 237961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 238127 239779 gene locus_tag LOCUS_26170 238127 239779 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_26170 243254 239811 gene locus_tag LOCUS_26180 243254 239811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 244769 243363 gene locus_tag LOCUS_26190 244769 243363 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284325.1 protein_id gnl|my_center|LOCUS_26190 246202 244988 gene locus_tag LOCUS_26200 246202 244988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_26200 246276 246929 gene locus_tag LOCUS_26210 246276 246929 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228774.1 protein_id gnl|my_center|LOCUS_26210 247049 248446 gene locus_tag LOCUS_26220 247049 248446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 248463 249914 gene locus_tag LOCUS_26230 248463 249914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 251146 249962 gene locus_tag LOCUS_26240 251146 249962 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359867.1 protein_id gnl|my_center|LOCUS_26240 251846 251187 gene locus_tag LOCUS_26250 251846 251187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 252754 251852 gene locus_tag LOCUS_26260 252754 251852 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776867.1 protein_id gnl|my_center|LOCUS_26260 253680 252754 gene locus_tag LOCUS_26270 253680 252754 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 protein_id gnl|my_center|LOCUS_26270 255049 253745 gene locus_tag LOCUS_26280 255049 253745 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776865.1 protein_id gnl|my_center|LOCUS_26280 257037 255109 gene locus_tag LOCUS_26290 257037 255109 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225053.1 protein_id gnl|my_center|LOCUS_26290 257290 258390 gene locus_tag LOCUS_26300 257290 258390 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316201.1 protein_id gnl|my_center|LOCUS_26300 259167 258397 gene locus_tag LOCUS_26310 gene kduD 259167 258397 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393179.1 protein_id gnl|my_center|LOCUS_26310 259994 259164 gene locus_tag LOCUS_26320 gene kduI 259994 259164 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383257.1 protein_id gnl|my_center|LOCUS_26320 260129 261232 gene locus_tag LOCUS_26330 260129 261232 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316201.1 protein_id gnl|my_center|LOCUS_26330 262887 261928 gene locus_tag LOCUS_26340 262887 261928 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227854.1 protein_id gnl|my_center|LOCUS_26340 263035 265098 gene locus_tag LOCUS_26350 263035 265098 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031639.1 protein_id gnl|my_center|LOCUS_26350 265124 266455 gene locus_tag LOCUS_26360 265124 266455 CDS product BNR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229191.1 protein_id gnl|my_center|LOCUS_26360 266613 266464 gene locus_tag LOCUS_26370 266613 266464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 266648 267490 gene locus_tag LOCUS_26380 266648 267490 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467636.1 protein_id gnl|my_center|LOCUS_26380 267487 268362 gene locus_tag LOCUS_26390 267487 268362 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229243.1 protein_id gnl|my_center|LOCUS_26390 268396 269742 gene locus_tag LOCUS_26400 268396 269742 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 protein_id gnl|my_center|LOCUS_26400 269830 271590 gene locus_tag LOCUS_26410 269830 271590 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229240.1 protein_id gnl|my_center|LOCUS_26410 272317 273375 gene locus_tag LOCUS_26420 272317 273375 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051005886.1 protein_id gnl|my_center|LOCUS_26420 273600 274727 gene locus_tag LOCUS_26430 273600 274727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 275083 276192 gene locus_tag LOCUS_26440 275083 276192 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229171.1 protein_id gnl|my_center|LOCUS_26440 278198 276243 gene locus_tag LOCUS_26450 278198 276243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 278580 278969 gene locus_tag LOCUS_26460 278580 278969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 278966 279136 gene locus_tag LOCUS_26470 278966 279136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 280388 279189 gene locus_tag LOCUS_26480 280388 279189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 280635 281258 gene locus_tag LOCUS_26490 280635 281258 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226659.1 protein_id gnl|my_center|LOCUS_26490 281381 284416 gene locus_tag LOCUS_26500 281381 284416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 284466 285134 gene locus_tag LOCUS_26510 284466 285134 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 protein_id gnl|my_center|LOCUS_26510 285854 287923 gene locus_tag LOCUS_26520 285854 287923 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_26520 288145 289662 gene locus_tag LOCUS_26530 288145 289662 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 protein_id gnl|my_center|LOCUS_26530 289684 290127 gene locus_tag LOCUS_26540 289684 290127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 290127 290633 gene locus_tag LOCUS_26550 290127 290633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 290630 290788 gene locus_tag LOCUS_26560 290630 290788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098516.1 protein_id gnl|my_center|LOCUS_26560 290793 293132 gene locus_tag LOCUS_26570 290793 293132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26570 293160 293585 gene locus_tag LOCUS_26580 293160 293585 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974727.1 protein_id gnl|my_center|LOCUS_26580 293603 294304 gene locus_tag LOCUS_26590 293603 294304 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974728.1 protein_id gnl|my_center|LOCUS_26590 294301 296079 gene locus_tag LOCUS_26600 294301 296079 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029529.1 protein_id gnl|my_center|LOCUS_26600 296096 296401 gene locus_tag LOCUS_26610 296096 296401 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226666.1 protein_id gnl|my_center|LOCUS_26610 296401 296808 gene locus_tag LOCUS_26620 296401 296808 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_26620 296808 298742 gene locus_tag LOCUS_26630 296808 298742 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 protein_id gnl|my_center|LOCUS_26630 298739 299287 gene locus_tag LOCUS_26640 298739 299287 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_26640 299289 300176 gene locus_tag LOCUS_26650 299289 300176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26650 300307 301338 gene locus_tag LOCUS_26660 300307 301338 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_26660 301489 302109 gene locus_tag LOCUS_26670 301489 302109 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229858.1 protein_id gnl|my_center|LOCUS_26670 302111 302290 gene locus_tag LOCUS_26680 302111 302290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 306582 303151 gene locus_tag LOCUS_26690 306582 303151 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316076.1 protein_id gnl|my_center|LOCUS_26690 310053 306655 gene locus_tag LOCUS_26700 310053 306655 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316076.1 protein_id gnl|my_center|LOCUS_26700 312529 310376 gene locus_tag LOCUS_26710 312529 310376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 313188 312583 gene locus_tag LOCUS_26720 313188 312583 CDS product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027533.1 protein_id gnl|my_center|LOCUS_26720 313796 313218 gene locus_tag LOCUS_26730 313796 313218 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228192.1 protein_id gnl|my_center|LOCUS_26730 315244 313877 gene locus_tag LOCUS_26740 315244 313877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 315603 315241 gene locus_tag LOCUS_26750 315603 315241 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_26750 315789 316478 gene locus_tag LOCUS_26760 315789 316478 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222808.1 protein_id gnl|my_center|LOCUS_26760 316475 317740 gene locus_tag LOCUS_26770 316475 317740 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222809.1 protein_id gnl|my_center|LOCUS_26770 319217 317721 gene locus_tag LOCUS_26780 319217 317721 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403486.1 protein_id gnl|my_center|LOCUS_26780 319281 320831 gene locus_tag LOCUS_26790 319281 320831 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_26790 320818 322284 gene locus_tag LOCUS_26800 320818 322284 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224111.1 protein_id gnl|my_center|LOCUS_26800 322297 323877 gene locus_tag LOCUS_26810 322297 323877 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_26810 323874 324968 gene locus_tag LOCUS_26820 323874 324968 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_26820 324959 326350 gene locus_tag LOCUS_26830 324959 326350 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222806.1 protein_id gnl|my_center|LOCUS_26830 326347 327630 gene locus_tag LOCUS_26840 326347 327630 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731523.1 protein_id gnl|my_center|LOCUS_26840 327759 327929 gene locus_tag LOCUS_26850 327759 327929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 328047 329315 gene locus_tag LOCUS_26860 328047 329315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 330027 330242 gene locus_tag LOCUS_26870 330027 330242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 330513 331919 gene locus_tag LOCUS_26880 330513 331919 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028961.1 protein_id gnl|my_center|LOCUS_26880 331924 333102 gene locus_tag LOCUS_26890 331924 333102 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173501.1 protein_id gnl|my_center|LOCUS_26890 333475 334716 gene locus_tag LOCUS_26900 333475 334716 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031678.1 protein_id gnl|my_center|LOCUS_26900 334713 335135 gene locus_tag LOCUS_26910 334713 335135 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971678.1 protein_id gnl|my_center|LOCUS_26910 335132 335485 gene locus_tag LOCUS_26920 335132 335485 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971677.1 protein_id gnl|my_center|LOCUS_26920 335463 336089 gene locus_tag LOCUS_26930 335463 336089 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971676.1 protein_id gnl|my_center|LOCUS_26930 336086 337462 gene locus_tag LOCUS_26940 336086 337462 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972616.1 protein_id gnl|my_center|LOCUS_26940 337459 338550 gene locus_tag LOCUS_26950 337459 338550 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_26950 338859 338602 gene locus_tag LOCUS_26960 338859 338602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 339489 338983 gene locus_tag LOCUS_26970 339489 338983 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224849.1 protein_id gnl|my_center|LOCUS_26970 340352 339486 gene locus_tag LOCUS_26980 340352 339486 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731219.1 protein_id gnl|my_center|LOCUS_26980 340575 341573 gene locus_tag LOCUS_26990 340575 341573 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_26990 341790 343430 gene locus_tag LOCUS_27000 341790 343430 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 protein_id gnl|my_center|LOCUS_27000 344390 343434 gene locus_tag LOCUS_27010 344390 343434 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_27010 345256 344411 gene locus_tag LOCUS_27020 345256 344411 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728224.1 protein_id gnl|my_center|LOCUS_27020 345413 347167 gene locus_tag LOCUS_27030 345413 347167 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_27030 347173 349185 gene locus_tag LOCUS_27040 347173 349185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 350027 349269 gene locus_tag LOCUS_27050 350027 349269 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228326.1 protein_id gnl|my_center|LOCUS_27050 350291 350118 gene locus_tag LOCUS_27060 350291 350118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 350477 350728 gene locus_tag LOCUS_27070 350477 350728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 350955 351305 gene locus_tag LOCUS_27080 350955 351305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 352031 351369 gene locus_tag LOCUS_27090 352031 351369 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229632.1 protein_id gnl|my_center|LOCUS_27090 353134 352028 gene locus_tag LOCUS_27100 353134 352028 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229631.1 protein_id gnl|my_center|LOCUS_27100 353469 353197 gene locus_tag LOCUS_27110 353469 353197 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_27110 354019 353567 gene locus_tag LOCUS_27120 354019 353567 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 protein_id gnl|my_center|LOCUS_27120 354125 354712 gene locus_tag LOCUS_27130 354125 354712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 355451 354702 gene locus_tag LOCUS_27140 355451 354702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 355579 356322 gene locus_tag LOCUS_27150 355579 356322 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_27150 356664 356308 gene locus_tag LOCUS_27160 356664 356308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 356768 357319 gene locus_tag LOCUS_27170 356768 357319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 357492 358637 gene locus_tag LOCUS_27180 357492 358637 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229126.1 protein_id gnl|my_center|LOCUS_27180 359564 358638 gene locus_tag LOCUS_27190 359564 358638 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028905.1 protein_id gnl|my_center|LOCUS_27190 359657 360274 gene locus_tag LOCUS_27200 359657 360274 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123667195.1 protein_id gnl|my_center|LOCUS_27200 361136 360318 gene locus_tag LOCUS_27210 361136 360318 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_27210 362421 361330 gene locus_tag LOCUS_27220 362421 361330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 362971 362645 gene locus_tag LOCUS_27230 362971 362645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 363149 363769 gene locus_tag LOCUS_27240 363149 363769 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_27240 363911 364687 gene locus_tag LOCUS_27250 363911 364687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 364865 366361 gene locus_tag LOCUS_27260 gene metG 364865 366361 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_27260 367899 366406 gene locus_tag LOCUS_27270 367899 366406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 368042 368230 gene locus_tag LOCUS_27280 368042 368230 CDS product DUF3072 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227672.1 protein_id gnl|my_center|LOCUS_27280 368505 368305 gene locus_tag LOCUS_27290 368505 368305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 368640 371102 gene locus_tag LOCUS_27300 368640 371102 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226690.1 protein_id gnl|my_center|LOCUS_27300 371095 371760 gene locus_tag LOCUS_27310 371095 371760 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226691.1 protein_id gnl|my_center|LOCUS_27310 371757 372455 gene locus_tag LOCUS_27320 371757 372455 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226692.1 protein_id gnl|my_center|LOCUS_27320 372462 373505 gene locus_tag LOCUS_27330 372462 373505 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_27330 374106 373480 gene locus_tag LOCUS_27340 374106 373480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 374368 374117 gene locus_tag LOCUS_27350 374368 374117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 374957 374376 gene locus_tag LOCUS_27360 374957 374376 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_27360 376266 375034 gene locus_tag LOCUS_27370 376266 375034 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229325.1 protein_id gnl|my_center|LOCUS_27370 377257 376259 gene locus_tag LOCUS_27380 377257 376259 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229326.1 protein_id gnl|my_center|LOCUS_27380 378327 377254 gene locus_tag LOCUS_27390 gene pdhA 378327 377254 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_27390 378522 378950 gene locus_tag LOCUS_27400 378522 378950 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229328.1 protein_id gnl|my_center|LOCUS_27400 379642 378932 gene locus_tag LOCUS_27410 379642 378932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 381165 379885 gene locus_tag LOCUS_27420 381165 379885 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_27420 381851 381162 gene locus_tag LOCUS_27430 381851 381162 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_27430 382436 381879 gene locus_tag LOCUS_27440 382436 381879 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225664.1 protein_id gnl|my_center|LOCUS_27440 382548 383357 gene locus_tag LOCUS_27450 382548 383357 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_27450 383554 384102 gene locus_tag LOCUS_27460 383554 384102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 384395 385099 gene locus_tag LOCUS_27470 384395 385099 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230540.1 protein_id gnl|my_center|LOCUS_27470 385240 385452 gene locus_tag LOCUS_27480 385240 385452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 385837 390327 gene locus_tag LOCUS_27490 gene gltB 385837 390327 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742213.1 protein_id gnl|my_center|LOCUS_27490 390320 391771 gene locus_tag LOCUS_27500 390320 391771 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_27500 392445 391927 gene locus_tag LOCUS_27510 gene ywaE 392445 391927 CDS product tyrZ transcriptional regulator YwaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243598.1 protein_id gnl|my_center|LOCUS_27510 392505 394016 gene locus_tag LOCUS_27520 392505 394016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 394975 394334 gene locus_tag LOCUS_27530 394975 394334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 396000 395083 gene locus_tag LOCUS_27540 396000 395083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 396221 397528 gene locus_tag LOCUS_27550 396221 397528 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225012.1 protein_id gnl|my_center|LOCUS_27550 397550 398602 gene locus_tag LOCUS_27560 397550 398602 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815985.1 protein_id gnl|my_center|LOCUS_27560 399653 398658 gene locus_tag LOCUS_27570 gene ppk2 399653 398658 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_27570 399897 399706 gene locus_tag LOCUS_27580 399897 399706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 400123 399914 gene locus_tag LOCUS_27590 400123 399914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 400836 400246 gene locus_tag LOCUS_27600 400836 400246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 401921 400929 gene locus_tag LOCUS_27610 401921 400929 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896541.1 protein_id gnl|my_center|LOCUS_27610 402028 403944 gene locus_tag LOCUS_27620 402028 403944 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_27620 404192 405640 gene locus_tag LOCUS_27630 404192 405640 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 protein_id gnl|my_center|LOCUS_27630 405795 405616 gene locus_tag LOCUS_27640 405795 405616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 405764 405916 gene locus_tag LOCUS_27650 405764 405916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 406792 405965 gene locus_tag LOCUS_27660 406792 405965 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229271.1 protein_id gnl|my_center|LOCUS_27660 407952 406852 gene locus_tag LOCUS_27670 407952 406852 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_27670 408365 407949 gene locus_tag LOCUS_27680 408365 407949 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222286.1 protein_id gnl|my_center|LOCUS_27680 410871 408379 gene locus_tag LOCUS_27690 410871 408379 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 protein_id gnl|my_center|LOCUS_27690 411030 411908 gene locus_tag LOCUS_27700 411030 411908 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229249.1 protein_id gnl|my_center|LOCUS_27700 412339 413745 gene locus_tag LOCUS_27710 412339 413745 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_27710 413776 415185 gene locus_tag LOCUS_27720 413776 415185 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_27720 415394 416434 gene locus_tag LOCUS_27730 415394 416434 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134732678.1 protein_id gnl|my_center|LOCUS_27730 417005 418009 gene locus_tag LOCUS_27740 gene ispH 417005 418009 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417912.1 protein_id gnl|my_center|LOCUS_27740 420697 418160 gene locus_tag LOCUS_27750 420697 418160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_27750 421455 420697 gene locus_tag LOCUS_27760 421455 420697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_27760 421617 421820 gene locus_tag LOCUS_27770 421617 421820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 421855 422199 gene locus_tag LOCUS_27780 421855 422199 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230882.1 protein_id gnl|my_center|LOCUS_27780 423060 422152 gene locus_tag LOCUS_27790 423060 422152 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523300.1 protein_id gnl|my_center|LOCUS_27790 423979 423248 gene locus_tag LOCUS_27800 423979 423248 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224413.1 protein_id gnl|my_center|LOCUS_27800 424547 423984 gene locus_tag LOCUS_27810 424547 423984 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 protein_id gnl|my_center|LOCUS_27810 424724 425305 gene locus_tag LOCUS_27820 424724 425305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 425318 426070 gene locus_tag LOCUS_27830 425318 426070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 426238 427077 gene locus_tag LOCUS_27840 426238 427077 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223086.1 protein_id gnl|my_center|LOCUS_27840 427092 428717 gene locus_tag LOCUS_27850 427092 428717 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223087.1 protein_id gnl|my_center|LOCUS_27850 428785 429636 gene locus_tag LOCUS_27860 428785 429636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 429842 434254 gene locus_tag LOCUS_27870 429842 434254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 protein_id gnl|my_center|LOCUS_27870 434259 435071 gene locus_tag LOCUS_27880 434259 435071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 435611 435081 gene locus_tag LOCUS_27890 435611 435081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 437109 435682 gene locus_tag LOCUS_27900 437109 435682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 437705 437109 gene locus_tag LOCUS_27910 437705 437109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 438558 437935 gene locus_tag LOCUS_27920 438558 437935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 438680 439153 gene locus_tag LOCUS_27930 438680 439153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 440209 439127 gene locus_tag LOCUS_27940 440209 439127 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726945.1 protein_id gnl|my_center|LOCUS_27940 441154 440378 gene locus_tag LOCUS_27950 441154 440378 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228699.1 protein_id gnl|my_center|LOCUS_27950 441220 442380 gene locus_tag LOCUS_27960 441220 442380 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229351.1 protein_id gnl|my_center|LOCUS_27960 442380 443873 gene locus_tag LOCUS_27970 442380 443873 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027406.1 protein_id gnl|my_center|LOCUS_27970 443870 444307 gene locus_tag LOCUS_27980 443870 444307 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_27980 444319 445074 gene locus_tag LOCUS_27990 444319 445074 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_27990 446065 445067 gene locus_tag LOCUS_28000 446065 445067 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_28000 447343 446075 gene locus_tag LOCUS_28010 447343 446075 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217160422.1 protein_id gnl|my_center|LOCUS_28010 448547 447333 gene locus_tag LOCUS_28020 448547 447333 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217160422.1 protein_id gnl|my_center|LOCUS_28020 450243 448555 gene locus_tag LOCUS_28030 gene mptB 450243 448555 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226496.1 protein_id gnl|my_center|LOCUS_28030 450884 450621 gene locus_tag LOCUS_28040 450884 450621 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_28040 450948 451970 gene locus_tag LOCUS_28050 450948 451970 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228108.1 protein_id gnl|my_center|LOCUS_28050 452212 452024 gene locus_tag LOCUS_28060 452212 452024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 454281 452260 gene locus_tag LOCUS_28070 gene helR 454281 452260 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230689.1 protein_id gnl|my_center|LOCUS_28070 454408 455190 gene locus_tag LOCUS_28080 454408 455190 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876909.1 protein_id gnl|my_center|LOCUS_28080 455193 456020 gene locus_tag LOCUS_28090 455193 456020 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226448.1 protein_id gnl|my_center|LOCUS_28090 456933 456136 gene locus_tag LOCUS_28100 456933 456136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_28100 457958 456930 gene locus_tag LOCUS_28110 457958 456930 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_28110 458956 457955 gene locus_tag LOCUS_28120 458956 457955 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_28120 459921 459304 gene locus_tag LOCUS_28130 459921 459304 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226698.1 protein_id gnl|my_center|LOCUS_28130 460649 460011 gene locus_tag LOCUS_28140 460649 460011 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_28140 460704 461354 gene locus_tag LOCUS_28150 460704 461354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 461266 462753 gene locus_tag LOCUS_28160 461266 462753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225898.1 protein_id gnl|my_center|LOCUS_28160 462801 463739 gene locus_tag LOCUS_28170 462801 463739 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231049.1 protein_id gnl|my_center|LOCUS_28170 464079 463636 gene locus_tag LOCUS_28180 464079 463636 CDS product DUF4267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726623.1 protein_id gnl|my_center|LOCUS_28180 464584 464177 gene locus_tag LOCUS_28190 464584 464177 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973901.1 protein_id gnl|my_center|LOCUS_28190 464700 465452 gene locus_tag LOCUS_28200 464700 465452 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_28200 465446 466432 gene locus_tag LOCUS_28210 465446 466432 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_28210 466751 466524 gene locus_tag LOCUS_28220 466751 466524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 470092 466991 gene locus_tag LOCUS_28230 470092 466991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 470364 470936 gene locus_tag LOCUS_28240 470364 470936 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 protein_id gnl|my_center|LOCUS_28240 473841 470983 gene locus_tag LOCUS_28250 473841 470983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 474132 473953 gene locus_tag LOCUS_28260 474132 473953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 474261 474572 gene locus_tag LOCUS_28270 474261 474572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 474830 474633 gene locus_tag LOCUS_28280 474830 474633 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_28280 488152 474827 gene locus_tag LOCUS_28290 488152 474827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 489250 488240 gene locus_tag LOCUS_28300 489250 488240 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259666.1 protein_id gnl|my_center|LOCUS_28300 490672 489332 gene locus_tag LOCUS_28310 490672 489332 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226866.1 protein_id gnl|my_center|LOCUS_28310 490871 492487 gene locus_tag LOCUS_28320 490871 492487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226856.1 protein_id gnl|my_center|LOCUS_28320 492564 494288 gene locus_tag LOCUS_28330 492564 494288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226857.1 protein_id gnl|my_center|LOCUS_28330 494556 494368 gene locus_tag LOCUS_28340 494556 494368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 495820 494657 gene locus_tag LOCUS_28350 495820 494657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106206.1 protein_id gnl|my_center|LOCUS_28350 496470 495883 gene locus_tag LOCUS_28360 496470 495883 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226476.1 protein_id gnl|my_center|LOCUS_28360 497355 496564 gene locus_tag LOCUS_28370 497355 496564 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119643.1 protein_id gnl|my_center|LOCUS_28370 498527 497391 gene locus_tag LOCUS_28380 498527 497391 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531207.1 protein_id gnl|my_center|LOCUS_28380 498770 498531 gene locus_tag LOCUS_28390 498770 498531 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106204.1 protein_id gnl|my_center|LOCUS_28390 499779 498784 gene locus_tag LOCUS_28400 499779 498784 CDS product beta-ketoacyl-ACP synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091712.1 protein_id gnl|my_center|LOCUS_28400 500205 499783 gene locus_tag LOCUS_28410 500205 499783 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091711.1 protein_id gnl|my_center|LOCUS_28410 501425 500202 gene locus_tag LOCUS_28420 501425 500202 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106199.1 protein_id gnl|my_center|LOCUS_28420 502329 501412 gene locus_tag LOCUS_28430 502329 501412 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_28430 503650 502337 gene locus_tag LOCUS_28440 503650 502337 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119646.1 protein_id gnl|my_center|LOCUS_28440 504810 503650 gene locus_tag LOCUS_28450 504810 503650 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 protein_id gnl|my_center|LOCUS_28450 511781 504807 gene locus_tag LOCUS_28460 511781 504807 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113143.1 protein_id gnl|my_center|LOCUS_28460 512707 511979 gene locus_tag LOCUS_28470 512707 511979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 513882 512896 gene locus_tag LOCUS_28480 513882 512896 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_28480 514296 514060 gene locus_tag LOCUS_28490 514296 514060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223616.1 protein_id gnl|my_center|LOCUS_28490 514382 514921 gene locus_tag LOCUS_28500 514382 514921 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480299.1 protein_id gnl|my_center|LOCUS_28500 514997 516031 gene locus_tag LOCUS_28510 514997 516031 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226829.1 protein_id gnl|my_center|LOCUS_28510 516028 517650 gene locus_tag LOCUS_28520 516028 517650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226828.1 protein_id gnl|my_center|LOCUS_28520 517703 518431 gene locus_tag LOCUS_28530 517703 518431 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_28530 518583 518930 gene locus_tag LOCUS_28540 518583 518930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 519121 519807 gene locus_tag LOCUS_28550 519121 519807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28550 519794 520279 gene locus_tag LOCUS_28560 519794 520279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 520255 520953 gene locus_tag LOCUS_28570 520255 520953 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224979.1 protein_id gnl|my_center|LOCUS_28570 521313 521008 gene locus_tag LOCUS_28580 521313 521008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 521520 522722 gene locus_tag LOCUS_28590 521520 522722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 523092 522724 gene locus_tag LOCUS_28600 gene pcaC 523092 522724 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462297.1 protein_id gnl|my_center|LOCUS_28600 523838 523089 gene locus_tag LOCUS_28610 gene pcaD 523838 523089 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_28610 525208 523835 gene locus_tag LOCUS_28620 525208 523835 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112675.1 protein_id gnl|my_center|LOCUS_28620 525800 525183 gene locus_tag LOCUS_28630 gene pcaG 525800 525183 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 protein_id gnl|my_center|LOCUS_28630 526500 525793 gene locus_tag LOCUS_28640 gene pcaH 526500 525793 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223753.1 protein_id gnl|my_center|LOCUS_28640 527282 526539 gene locus_tag LOCUS_28650 527282 526539 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_28650 528076 527279 gene locus_tag LOCUS_28660 528076 527279 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223750.1 protein_id gnl|my_center|LOCUS_28660 528264 529835 gene locus_tag LOCUS_28670 528264 529835 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_28670 529902 531161 gene locus_tag LOCUS_28680 529902 531161 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_28680 531158 532468 gene locus_tag LOCUS_28690 531158 532468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 532474 532848 gene locus_tag LOCUS_28700 532474 532848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 533510 532830 gene locus_tag LOCUS_28710 533510 532830 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_28710 534981 533584 gene locus_tag LOCUS_28720 534981 533584 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228556.1 protein_id gnl|my_center|LOCUS_28720 535078 539535 gene locus_tag LOCUS_28730 535078 539535 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228557.1 protein_id gnl|my_center|LOCUS_28730 540502 539639 gene locus_tag LOCUS_28740 540502 539639 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222982.1 protein_id gnl|my_center|LOCUS_28740 540822 540499 gene locus_tag LOCUS_28750 540822 540499 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971571.1 protein_id gnl|my_center|LOCUS_28750 540969 541355 gene locus_tag LOCUS_28760 540969 541355 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030058.1 protein_id gnl|my_center|LOCUS_28760 541515 541751 gene locus_tag LOCUS_28770 541515 541751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228349.1 protein_id gnl|my_center|LOCUS_28770 542006 541806 gene locus_tag LOCUS_28780 542006 541806 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226967.1 protein_id gnl|my_center|LOCUS_28780 542808 542512 gene locus_tag LOCUS_28790 542808 542512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 543150 543983 gene locus_tag LOCUS_28800 543150 543983 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 protein_id gnl|my_center|LOCUS_28800 544070 545041 gene locus_tag LOCUS_28810 544070 545041 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 protein_id gnl|my_center|LOCUS_28810 545410 545078 gene locus_tag LOCUS_28820 545410 545078 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224704.1 protein_id gnl|my_center|LOCUS_28820 545508 546317 gene locus_tag LOCUS_28830 545508 546317 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222875.1 protein_id gnl|my_center|LOCUS_28830 546327 546536 gene locus_tag LOCUS_28840 546327 546536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 546544 547125 gene locus_tag LOCUS_28850 546544 547125 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191019.1 protein_id gnl|my_center|LOCUS_28850 547163 549187 gene locus_tag LOCUS_28860 gene tcrA 547163 549187 CDS product AfsR-like transcriptional regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030244.1 protein_id gnl|my_center|LOCUS_28860 550953 549406 gene locus_tag LOCUS_28870 550953 549406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 552144 551071 gene locus_tag LOCUS_28880 gene ackA 552144 551071 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_28880 554479 552146 gene locus_tag LOCUS_28890 554479 552146 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_28890 554820 557171 gene locus_tag LOCUS_28900 554820 557171 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_28900 559256 557172 gene locus_tag LOCUS_28910 559256 557172 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033262674.1 protein_id gnl|my_center|LOCUS_28910 559821 559315 gene locus_tag LOCUS_28920 559821 559315 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_28920 559965 561095 gene locus_tag LOCUS_28930 559965 561095 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_28930 561270 565112 gene locus_tag LOCUS_28940 561270 565112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 565212 565808 gene locus_tag LOCUS_28950 565212 565808 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224746.1 protein_id gnl|my_center|LOCUS_28950 567044 565845 gene locus_tag LOCUS_28960 567044 565845 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_28960 567243 568832 gene locus_tag LOCUS_28970 567243 568832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 569829 569200 gene locus_tag LOCUS_28980 569829 569200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 569965 570222 gene locus_tag LOCUS_28990 569965 570222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 570311 572824 gene locus_tag LOCUS_29000 570311 572824 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966619.1 protein_id gnl|my_center|LOCUS_29000 573789 572821 gene locus_tag LOCUS_29010 573789 572821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 protein_id gnl|my_center|LOCUS_29010 575152 573848 gene locus_tag LOCUS_29020 575152 573848 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466721.1 protein_id gnl|my_center|LOCUS_29020 575249 576031 gene locus_tag LOCUS_29030 575249 576031 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_29030 576866 575994 gene locus_tag LOCUS_29040 576866 575994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 577952 577017 gene locus_tag LOCUS_29050 577952 577017 CDS product lysyl oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229163.1 protein_id gnl|my_center|LOCUS_29050 578180 579352 gene locus_tag LOCUS_29060 gene wecB 578180 579352 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229162.1 protein_id gnl|my_center|LOCUS_29060 580577 579270 gene locus_tag LOCUS_29070 580577 579270 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 protein_id gnl|my_center|LOCUS_29070 581383 580577 gene locus_tag LOCUS_29080 581383 580577 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229160.1 protein_id gnl|my_center|LOCUS_29080 581690 583156 gene locus_tag LOCUS_29090 581690 583156 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_29090 583138 584625 gene locus_tag LOCUS_29100 583138 584625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 585790 584657 gene locus_tag LOCUS_29110 585790 584657 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229157.1 protein_id gnl|my_center|LOCUS_29110 586875 585787 gene locus_tag LOCUS_29120 586875 585787 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229156.1 protein_id gnl|my_center|LOCUS_29120 588278 586872 gene locus_tag LOCUS_29130 588278 586872 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845897.1 protein_id gnl|my_center|LOCUS_29130 589537 588275 gene locus_tag LOCUS_29140 589537 588275 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177242394.1 protein_id gnl|my_center|LOCUS_29140 590442 589531 gene locus_tag LOCUS_29150 590442 589531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229153.1 protein_id gnl|my_center|LOCUS_29150 591512 590442 gene locus_tag LOCUS_29160 591512 590442 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468451.1 protein_id gnl|my_center|LOCUS_29160 592653 591487 gene locus_tag LOCUS_29170 592653 591487 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229151.1 protein_id gnl|my_center|LOCUS_29170 593603 592650 gene locus_tag LOCUS_29180 593603 592650 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_29180 594424 593600 gene locus_tag LOCUS_29190 594424 593600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229149.1 protein_id gnl|my_center|LOCUS_29190 594730 595473 gene locus_tag LOCUS_29200 594730 595473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 595470 597353 gene locus_tag LOCUS_29210 595470 597353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 597392 597784 gene locus_tag LOCUS_29220 597392 597784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 597851 598474 gene locus_tag LOCUS_29230 597851 598474 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978024.1 protein_id gnl|my_center|LOCUS_29230 599534 598623 gene locus_tag LOCUS_29240 599534 598623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 600657 599776 gene locus_tag LOCUS_29250 600657 599776 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226056.1 protein_id gnl|my_center|LOCUS_29250 601693 600659 gene locus_tag LOCUS_29260 601693 600659 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027128.1 protein_id gnl|my_center|LOCUS_29260 601762 603699 gene locus_tag LOCUS_29270 601762 603699 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027129.1 protein_id gnl|my_center|LOCUS_29270 603696 604925 gene locus_tag LOCUS_29280 603696 604925 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_29280 604951 605520 gene locus_tag LOCUS_29290 604951 605520 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_29290 606178 606309 gene locus_tag LOCUS_29300 606178 606309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 606293 607729 gene locus_tag LOCUS_29310 606293 607729 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223174.1 protein_id gnl|my_center|LOCUS_29310 609882 607690 gene locus_tag LOCUS_29320 609882 607690 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_29320 609940 610890 gene locus_tag LOCUS_29330 609940 610890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 612508 610910 gene locus_tag LOCUS_29340 612508 610910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 612848 613711 gene locus_tag LOCUS_29350 612848 613711 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226194.1 protein_id gnl|my_center|LOCUS_29350 613712 614881 gene locus_tag LOCUS_29360 613712 614881 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222787.1 protein_id gnl|my_center|LOCUS_29360 615635 614871 gene locus_tag LOCUS_29370 615635 614871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 616787 615783 gene locus_tag LOCUS_29380 616787 615783 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225829.1 protein_id gnl|my_center|LOCUS_29380 617923 616784 gene locus_tag LOCUS_29390 617923 616784 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_29390 619001 617955 gene locus_tag LOCUS_29400 619001 617955 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225827.1 protein_id gnl|my_center|LOCUS_29400 620060 619053 gene locus_tag LOCUS_29410 620060 619053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225826.1 protein_id gnl|my_center|LOCUS_29410 621574 620057 gene locus_tag LOCUS_29420 621574 620057 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225825.1 protein_id gnl|my_center|LOCUS_29420 622761 621571 gene locus_tag LOCUS_29430 622761 621571 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776795.1 protein_id gnl|my_center|LOCUS_29430 624409 623240 gene locus_tag LOCUS_29440 624409 623240 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_29440 624576 625205 gene locus_tag LOCUS_29450 624576 625205 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229694.1 protein_id gnl|my_center|LOCUS_29450 625512 628502 gene locus_tag LOCUS_29460 625512 628502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 628512 630065 gene locus_tag LOCUS_29470 628512 630065 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878169.1 protein_id gnl|my_center|LOCUS_29470 633046 630059 gene locus_tag LOCUS_29480 633046 630059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 635833 633113 gene locus_tag LOCUS_29490 635833 633113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 636059 637402 gene locus_tag LOCUS_29500 636059 637402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 637651 638460 gene locus_tag LOCUS_29510 637651 638460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 639903 638509 gene locus_tag LOCUS_29520 639903 638509 CDS product BNR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229191.1 protein_id gnl|my_center|LOCUS_29520 640942 639971 gene locus_tag LOCUS_29530 640942 639971 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_29530 641073 641432 gene locus_tag LOCUS_29540 641073 641432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 642454 641480 gene locus_tag LOCUS_29550 642454 641480 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079997.1 protein_id gnl|my_center|LOCUS_29550 643514 642507 gene locus_tag LOCUS_29560 643514 642507 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226641.1 protein_id gnl|my_center|LOCUS_29560 644185 643508 gene locus_tag LOCUS_29570 644185 643508 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742149.1 protein_id gnl|my_center|LOCUS_29570 644374 644847 gene locus_tag LOCUS_29580 644374 644847 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_29580 644844 646859 gene locus_tag LOCUS_29590 644844 646859 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_29590 646909 647571 gene locus_tag LOCUS_29600 646909 647571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 647760 651062 gene locus_tag LOCUS_29610 647760 651062 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_29610 651348 651100 gene locus_tag LOCUS_29620 651348 651100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 651930 651439 gene locus_tag LOCUS_29630 651930 651439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 652050 653447 gene locus_tag LOCUS_29640 652050 653447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 653509 654555 gene locus_tag LOCUS_29650 653509 654555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 655796 654558 gene locus_tag LOCUS_29660 655796 654558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 655908 658628 gene locus_tag LOCUS_29670 655908 658628 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_29670 660277 658664 gene locus_tag LOCUS_29680 660277 658664 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085144103.1 protein_id gnl|my_center|LOCUS_29680 660696 660274 gene locus_tag LOCUS_29690 660696 660274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 660845 661681 gene locus_tag LOCUS_29700 660845 661681 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030711.1 protein_id gnl|my_center|LOCUS_29700 661779 663428 gene locus_tag LOCUS_29710 661779 663428 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228262.1 protein_id gnl|my_center|LOCUS_29710 663557 664237 gene locus_tag LOCUS_29720 663557 664237 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225350.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29720 664331 665119 gene locus_tag LOCUS_29730 664331 665119 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223025.1 protein_id gnl|my_center|LOCUS_29730 666014 665094 gene locus_tag LOCUS_29740 666014 665094 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 protein_id gnl|my_center|LOCUS_29740 666132 666668 gene locus_tag LOCUS_29750 666132 666668 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978343.1 protein_id gnl|my_center|LOCUS_29750 668171 666672 gene locus_tag LOCUS_29760 668171 666672 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227763.1 protein_id gnl|my_center|LOCUS_29760 669245 670111 gene locus_tag LOCUS_29770 669245 670111 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090078.1 protein_id gnl|my_center|LOCUS_29770 670935 670081 gene locus_tag LOCUS_29780 670935 670081 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222871.1 protein_id gnl|my_center|LOCUS_29780 671689 670994 gene locus_tag LOCUS_29790 671689 670994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 671799 673208 gene locus_tag LOCUS_29800 671799 673208 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_29800 673658 673272 gene locus_tag LOCUS_29810 673658 673272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 675415 673670 gene locus_tag LOCUS_29820 675415 673670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 676334 675642 gene locus_tag LOCUS_29830 676334 675642 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727054.1 protein_id gnl|my_center|LOCUS_29830 676403 677131 gene locus_tag LOCUS_29840 676403 677131 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_29840 677128 678528 gene locus_tag LOCUS_29850 677128 678528 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_29850 678525 679367 gene locus_tag LOCUS_29860 678525 679367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 679520 683107 gene locus_tag LOCUS_29870 gene metH 679520 683107 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227000.1 protein_id gnl|my_center|LOCUS_29870 683251 685977 gene locus_tag LOCUS_29880 683251 685977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 689374 686171 gene locus_tag LOCUS_29890 689374 686171 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_29890 689609 693184 gene locus_tag LOCUS_29900 689609 693184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 693594 693151 gene locus_tag LOCUS_29910 693594 693151 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_29910 693973 693587 gene locus_tag LOCUS_29920 693973 693587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 694391 694140 gene locus_tag LOCUS_29930 694391 694140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 694397 694552 gene locus_tag LOCUS_29940 694397 694552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 697056 694549 gene locus_tag LOCUS_29950 697056 694549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226575.1 protein_id gnl|my_center|LOCUS_29950 697272 698687 gene locus_tag LOCUS_29960 697272 698687 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_29960 699963 698698 gene locus_tag LOCUS_29970 699963 698698 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_29970 700077 700994 gene locus_tag LOCUS_29980 700077 700994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852866.1 protein_id gnl|my_center|LOCUS_29980 702986 700998 gene locus_tag LOCUS_29990 702986 700998 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226449.1 protein_id gnl|my_center|LOCUS_29990 703096 703617 gene locus_tag LOCUS_30000 703096 703617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 703607 704032 gene locus_tag LOCUS_30010 703607 704032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 704364 703948 gene locus_tag LOCUS_30020 704364 703948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 705900 704722 gene locus_tag LOCUS_30030 705900 704722 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225012.1 protein_id gnl|my_center|LOCUS_30030 707226 706279 gene locus_tag LOCUS_30040 707226 706279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 707684 708010 gene locus_tag LOCUS_30050 707684 708010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 protein_id gnl|my_center|LOCUS_30050 708026 709849 gene locus_tag LOCUS_30060 gene glmS 708026 709849 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_30060 709872 710705 gene locus_tag LOCUS_30070 709872 710705 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223219.1 protein_id gnl|my_center|LOCUS_30070 712044 710710 gene locus_tag LOCUS_30080 712044 710710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 713560 712127 gene locus_tag LOCUS_30090 713560 712127 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224607.1 protein_id gnl|my_center|LOCUS_30090 713973 713749 gene locus_tag LOCUS_30100 713973 713749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence05 280 1107 gene locus_tag LOCUS_30110 280 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1109 1468 gene locus_tag LOCUS_30120 1109 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3402 1555 gene locus_tag LOCUS_30130 gene iolD 3402 1555 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 protein_id gnl|my_center|LOCUS_30130 4280 3399 gene locus_tag LOCUS_30140 gene iolB 4280 3399 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223775.1 protein_id gnl|my_center|LOCUS_30140 5230 4277 gene locus_tag LOCUS_30150 5230 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223776.1 protein_id gnl|my_center|LOCUS_30150 5339 5515 gene locus_tag LOCUS_30160 5339 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 6602 5673 gene locus_tag LOCUS_30170 gene iolC 6602 5673 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223777.1 protein_id gnl|my_center|LOCUS_30170 7378 6599 gene locus_tag LOCUS_30180 7378 6599 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_30180 8421 7375 gene locus_tag LOCUS_30190 8421 7375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223779.1 protein_id gnl|my_center|LOCUS_30190 9416 8424 gene locus_tag LOCUS_30200 9416 8424 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_30200 10301 9441 gene locus_tag LOCUS_30210 10301 9441 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_30210 11281 10298 gene locus_tag LOCUS_30220 11281 10298 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 protein_id gnl|my_center|LOCUS_30220 11440 12435 gene locus_tag LOCUS_30230 11440 12435 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_30230 12730 12422 gene locus_tag LOCUS_30240 gene sugE 12730 12422 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118477.1 protein_id gnl|my_center|LOCUS_30240 13506 12733 gene locus_tag LOCUS_30250 13506 12733 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975316.1 protein_id gnl|my_center|LOCUS_30250 13550 14107 gene locus_tag LOCUS_30260 13550 14107 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_30260 15618 14104 gene locus_tag LOCUS_30270 15618 14104 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027604.1 protein_id gnl|my_center|LOCUS_30270 16168 15620 gene locus_tag LOCUS_30280 16168 15620 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027603.1 protein_id gnl|my_center|LOCUS_30280 17163 16183 gene locus_tag LOCUS_30290 17163 16183 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715268.1 protein_id gnl|my_center|LOCUS_30290 17278 18825 gene locus_tag LOCUS_30300 17278 18825 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027601.1 protein_id gnl|my_center|LOCUS_30300 18822 19484 gene locus_tag LOCUS_30310 18822 19484 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977695.1 protein_id gnl|my_center|LOCUS_30310 20131 19466 gene locus_tag LOCUS_30320 20131 19466 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_30320 20553 20143 gene locus_tag LOCUS_30330 gene arfB 20553 20143 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_30330 21948 20872 gene locus_tag LOCUS_30340 gene purM 21948 20872 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230742.1 protein_id gnl|my_center|LOCUS_30340 23453 21999 gene locus_tag LOCUS_30350 gene purF 23453 21999 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 protein_id gnl|my_center|LOCUS_30350 24379 23648 gene locus_tag LOCUS_30360 24379 23648 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_30360 25338 24529 gene locus_tag LOCUS_30370 25338 24529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 25499 25813 gene locus_tag LOCUS_30380 25499 25813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 25810 27804 gene locus_tag LOCUS_30390 25810 27804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 28143 27805 gene locus_tag LOCUS_30400 28143 27805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 28535 28158 gene locus_tag LOCUS_30410 28535 28158 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_30410 29404 28592 gene locus_tag LOCUS_30420 29404 28592 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_30420 30819 29473 gene locus_tag LOCUS_30430 30819 29473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 31247 30855 gene locus_tag LOCUS_30440 31247 30855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 31939 31355 gene locus_tag LOCUS_30450 31939 31355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 32039 33886 gene locus_tag LOCUS_30460 32039 33886 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_30460 33883 34908 gene locus_tag LOCUS_30470 33883 34908 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_30470 37040 34905 gene locus_tag LOCUS_30480 gene rmdA 37040 34905 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_30480 37982 37161 gene locus_tag LOCUS_30490 37982 37161 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226194.1 protein_id gnl|my_center|LOCUS_30490 38130 39248 gene locus_tag LOCUS_30500 38130 39248 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230753.1 protein_id gnl|my_center|LOCUS_30500 39250 40212 gene locus_tag LOCUS_30510 39250 40212 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230753.1 protein_id gnl|my_center|LOCUS_30510 41040 40156 gene locus_tag LOCUS_30520 41040 40156 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 protein_id gnl|my_center|LOCUS_30520 41147 41992 gene locus_tag LOCUS_30530 41147 41992 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_30530 42063 42887 gene locus_tag LOCUS_30540 42063 42887 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230750.1 protein_id gnl|my_center|LOCUS_30540 43000 43794 gene locus_tag LOCUS_30550 43000 43794 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230751.1 protein_id gnl|my_center|LOCUS_30550 46107 43840 gene locus_tag LOCUS_30560 gene purL 46107 43840 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230755.1 protein_id gnl|my_center|LOCUS_30560 46778 46107 gene locus_tag LOCUS_30570 gene purQ 46778 46107 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 protein_id gnl|my_center|LOCUS_30570 47014 46775 gene locus_tag LOCUS_30580 gene purS 47014 46775 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230759.1 protein_id gnl|my_center|LOCUS_30580 47784 47242 gene locus_tag LOCUS_30590 47784 47242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 48072 49043 gene locus_tag LOCUS_30600 48072 49043 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_30600 49070 49681 gene locus_tag LOCUS_30610 49070 49681 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230765.1 protein_id gnl|my_center|LOCUS_30610 50322 49603 gene locus_tag LOCUS_30620 50322 49603 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208608267.1 protein_id gnl|my_center|LOCUS_30620 51300 50395 gene locus_tag LOCUS_30630 51300 50395 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897243.1 protein_id gnl|my_center|LOCUS_30630 51364 52215 gene locus_tag LOCUS_30640 51364 52215 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_30640 52212 53042 gene locus_tag LOCUS_30650 52212 53042 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_30650 53039 53788 gene locus_tag LOCUS_30660 53039 53788 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_30660 53824 54282 gene locus_tag LOCUS_30670 53824 54282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 55712 54279 gene locus_tag LOCUS_30680 gene purB 55712 54279 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_30680 56545 55760 gene locus_tag LOCUS_30690 56545 55760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 57072 56542 gene locus_tag LOCUS_30700 57072 56542 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_30700 57705 57121 gene locus_tag LOCUS_30710 57705 57121 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230780.1 protein_id gnl|my_center|LOCUS_30710 58042 57719 gene locus_tag LOCUS_30720 58042 57719 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973762.1 protein_id gnl|my_center|LOCUS_30720 58884 58129 gene locus_tag LOCUS_30730 58884 58129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 59420 58902 gene locus_tag LOCUS_30740 59420 58902 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_30740 59573 60592 gene locus_tag LOCUS_30750 59573 60592 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230783.1 protein_id gnl|my_center|LOCUS_30750 60594 61175 gene locus_tag LOCUS_30760 60594 61175 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230784.1 protein_id gnl|my_center|LOCUS_30760 61924 61172 gene locus_tag LOCUS_30770 61924 61172 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_30770 62158 61985 gene locus_tag LOCUS_30780 62158 61985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 63287 62226 gene locus_tag LOCUS_30790 63287 62226 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230787.1 protein_id gnl|my_center|LOCUS_30790 64123 63584 gene locus_tag LOCUS_30800 64123 63584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 64996 64229 gene locus_tag LOCUS_30810 64996 64229 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_30810 66287 64998 gene locus_tag LOCUS_30820 66287 64998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 66908 66297 gene locus_tag LOCUS_30830 66908 66297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 67347 66892 gene locus_tag LOCUS_30840 67347 66892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 68674 67499 gene locus_tag LOCUS_30850 gene purD 68674 67499 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230794.1 protein_id gnl|my_center|LOCUS_30850 69776 68784 gene locus_tag LOCUS_30860 69776 68784 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_30860 71745 69757 gene locus_tag LOCUS_30870 71745 69757 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316996.1 protein_id gnl|my_center|LOCUS_30870 72120 71860 gene locus_tag LOCUS_30880 72120 71860 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727177.1 protein_id gnl|my_center|LOCUS_30880 72149 73702 gene locus_tag LOCUS_30890 72149 73702 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892189.1 protein_id gnl|my_center|LOCUS_30890 73828 74931 gene locus_tag LOCUS_30900 73828 74931 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230795.1 protein_id gnl|my_center|LOCUS_30900 76186 74984 gene locus_tag LOCUS_30910 76186 74984 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 protein_id gnl|my_center|LOCUS_30910 77133 76183 gene locus_tag LOCUS_30920 77133 76183 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026153082.1 protein_id gnl|my_center|LOCUS_30920 77833 77117 gene locus_tag LOCUS_30930 77833 77117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226850.1 protein_id gnl|my_center|LOCUS_30930 78642 77818 gene locus_tag LOCUS_30940 78642 77818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226851.1 protein_id gnl|my_center|LOCUS_30940 80082 78796 gene locus_tag LOCUS_30950 80082 78796 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230806.1 protein_id gnl|my_center|LOCUS_30950 80255 80845 gene locus_tag LOCUS_30960 80255 80845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230807.1 protein_id gnl|my_center|LOCUS_30960 80957 81616 gene locus_tag LOCUS_30970 80957 81616 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878199.1 protein_id gnl|my_center|LOCUS_30970 81623 81874 gene locus_tag LOCUS_30980 81623 81874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 82992 81916 gene locus_tag LOCUS_30990 82992 81916 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_30990 83404 82997 gene locus_tag LOCUS_31000 83404 82997 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230816.1 protein_id gnl|my_center|LOCUS_31000 83697 84812 gene locus_tag LOCUS_31010 83697 84812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467860.1 protein_id gnl|my_center|LOCUS_31010 84877 86043 gene locus_tag LOCUS_31020 84877 86043 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 protein_id gnl|my_center|LOCUS_31020 87159 86125 gene locus_tag LOCUS_31030 gene fbaA 87159 86125 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_31030 87254 87541 gene locus_tag LOCUS_31040 87254 87541 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_31040 88385 87528 gene locus_tag LOCUS_31050 88385 87528 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418604.1 protein_id gnl|my_center|LOCUS_31050 88495 89427 gene locus_tag LOCUS_31060 88495 89427 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_31060 89500 90354 gene locus_tag LOCUS_31070 89500 90354 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230821.1 protein_id gnl|my_center|LOCUS_31070 90637 90359 gene locus_tag LOCUS_31080 90637 90359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 90704 91282 gene locus_tag LOCUS_31090 90704 91282 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284396.1 protein_id gnl|my_center|LOCUS_31090 91654 92511 gene locus_tag LOCUS_31100 91654 92511 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228804.1 protein_id gnl|my_center|LOCUS_31100 92508 93665 gene locus_tag LOCUS_31110 gene nagA 92508 93665 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_31110 93670 93855 gene locus_tag LOCUS_31120 93670 93855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 93866 94618 gene locus_tag LOCUS_31130 93866 94618 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_31130 96105 94732 gene locus_tag LOCUS_31140 96105 94732 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467865.1 protein_id gnl|my_center|LOCUS_31140 96305 96913 gene locus_tag LOCUS_31150 96305 96913 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230838.1 protein_id gnl|my_center|LOCUS_31150 97553 96918 gene locus_tag LOCUS_31160 97553 96918 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_31160 98368 97535 gene locus_tag LOCUS_31170 98368 97535 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230843.1 protein_id gnl|my_center|LOCUS_31170 98438 99394 gene locus_tag LOCUS_31180 98438 99394 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230847.1 protein_id gnl|my_center|LOCUS_31180 100466 99396 gene locus_tag LOCUS_31190 100466 99396 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230849.1 protein_id gnl|my_center|LOCUS_31190 101178 100492 gene locus_tag LOCUS_31200 101178 100492 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229887.1 protein_id gnl|my_center|LOCUS_31200 101715 101329 gene locus_tag LOCUS_31210 101715 101329 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728279.1 protein_id gnl|my_center|LOCUS_31210 102473 101781 gene locus_tag LOCUS_31220 102473 101781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 103029 102475 gene locus_tag LOCUS_31230 gene pyrE 103029 102475 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230857.1 protein_id gnl|my_center|LOCUS_31230 103053 103652 gene locus_tag LOCUS_31240 103053 103652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 104416 103982 gene locus_tag LOCUS_31250 104416 103982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 105330 104413 gene locus_tag LOCUS_31260 105330 104413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 105680 105327 gene locus_tag LOCUS_31270 105680 105327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 106538 105759 gene locus_tag LOCUS_31280 106538 105759 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085720.1 protein_id gnl|my_center|LOCUS_31280 107260 106535 gene locus_tag LOCUS_31290 107260 106535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230862.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31290 107615 107268 gene locus_tag LOCUS_31300 107615 107268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 110458 107876 gene locus_tag LOCUS_31310 gene clpB 110458 107876 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230863.1 protein_id gnl|my_center|LOCUS_31310 110668 111048 gene locus_tag LOCUS_31320 110668 111048 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_31320 111559 112662 gene locus_tag LOCUS_31330 111559 112662 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_31330 113627 112950 gene locus_tag LOCUS_31340 113627 112950 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222233.1 protein_id gnl|my_center|LOCUS_31340 114198 113770 gene locus_tag LOCUS_31350 114198 113770 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_31350 115364 114195 gene locus_tag LOCUS_31360 gene dnaJ 115364 114195 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_31360 116104 115382 gene locus_tag LOCUS_31370 gene grpE 116104 115382 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230873.1 protein_id gnl|my_center|LOCUS_31370 117954 116101 gene locus_tag LOCUS_31380 gene dnaK 117954 116101 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230874.1 protein_id gnl|my_center|LOCUS_31380 118124 118687 gene locus_tag LOCUS_31390 118124 118687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 119472 118684 gene locus_tag LOCUS_31400 119472 118684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 120299 119703 gene locus_tag LOCUS_31410 120299 119703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 120826 120296 gene locus_tag LOCUS_31420 120826 120296 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449652.1 protein_id gnl|my_center|LOCUS_31420 121142 120816 gene locus_tag LOCUS_31430 gene hsmR 121142 120816 CDS product multidrug efflux SMR transporter protein HsmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903382.1 protein_id gnl|my_center|LOCUS_31430 121288 123561 gene locus_tag LOCUS_31440 121288 123561 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230881.1 protein_id gnl|my_center|LOCUS_31440 124069 123692 gene locus_tag LOCUS_31450 124069 123692 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_31450 125387 124104 gene locus_tag LOCUS_31460 125387 124104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 125513 126499 gene locus_tag LOCUS_31470 125513 126499 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230883.1 protein_id gnl|my_center|LOCUS_31470 127077 126496 gene locus_tag LOCUS_31480 gene dcd 127077 126496 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003058109.1 protein_id gnl|my_center|LOCUS_31480 127149 127222 gene locus_tag LOCUS_t00250 127149 127222 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 127555 128652 gene locus_tag LOCUS_31490 127555 128652 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075004273.1 protein_id gnl|my_center|LOCUS_31490 128786 129508 gene locus_tag LOCUS_31500 128786 129508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 129511 129930 gene locus_tag LOCUS_31510 129511 129930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 130126 129965 gene locus_tag LOCUS_31520 130126 129965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31520 130788 130378 gene locus_tag LOCUS_31530 130788 130378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31530 131026 130826 gene locus_tag LOCUS_31540 131026 130826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 131939 131181 gene locus_tag LOCUS_31550 131939 131181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 132156 132533 gene locus_tag LOCUS_31560 132156 132533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 132782 133801 gene locus_tag LOCUS_31570 132782 133801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 134126 133896 gene locus_tag LOCUS_31580 134126 133896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 135390 134374 gene locus_tag LOCUS_31590 135390 134374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 135758 135360 gene locus_tag LOCUS_31600 135758 135360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 136207 135755 gene locus_tag LOCUS_31610 136207 135755 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225292.1 protein_id gnl|my_center|LOCUS_31610 137021 136230 gene locus_tag LOCUS_31620 137021 136230 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_31620 137386 137051 gene locus_tag LOCUS_31630 137386 137051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222910.1 protein_id gnl|my_center|LOCUS_31630 139044 137530 gene locus_tag LOCUS_31640 139044 137530 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_31640 139462 139232 gene locus_tag LOCUS_31650 139462 139232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 139376 140008 gene locus_tag LOCUS_31660 139376 140008 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230902.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31660 140202 142040 gene locus_tag LOCUS_31670 140202 142040 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_31670 143006 142236 gene locus_tag LOCUS_31680 143006 142236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 145330 143093 gene locus_tag LOCUS_31690 145330 143093 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_31690 145751 145431 gene locus_tag LOCUS_31700 145751 145431 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_31700 147620 145761 gene locus_tag LOCUS_31710 147620 145761 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230910.1 protein_id gnl|my_center|LOCUS_31710 148058 147702 gene locus_tag LOCUS_31720 148058 147702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_31720 147954 148244 gene locus_tag LOCUS_31730 147954 148244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 148649 148503 gene locus_tag LOCUS_31740 148649 148503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 150095 148902 gene locus_tag LOCUS_31750 150095 148902 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_31750 150218 150841 gene locus_tag LOCUS_31760 150218 150841 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965070.1 protein_id gnl|my_center|LOCUS_31760 151951 150908 gene locus_tag LOCUS_31770 151951 150908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 151902 152078 gene locus_tag LOCUS_31780 151902 152078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 153372 152104 gene locus_tag LOCUS_31790 153372 152104 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_31790 153460 154776 gene locus_tag LOCUS_31800 153460 154776 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_31800 154776 155576 gene locus_tag LOCUS_31810 154776 155576 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_31810 155997 155566 gene locus_tag LOCUS_31820 155997 155566 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222264.1 protein_id gnl|my_center|LOCUS_31820 156125 157051 gene locus_tag LOCUS_31830 156125 157051 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222265.1 protein_id gnl|my_center|LOCUS_31830 157761 157048 gene locus_tag LOCUS_31840 157761 157048 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230938.1 protein_id gnl|my_center|LOCUS_31840 157863 158507 gene locus_tag LOCUS_31850 157863 158507 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467881.1 protein_id gnl|my_center|LOCUS_31850 158515 159729 gene locus_tag LOCUS_31860 158515 159729 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_31860 160011 159751 gene locus_tag LOCUS_31870 160011 159751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 161066 160332 gene locus_tag LOCUS_31880 161066 160332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 161261 162103 gene locus_tag LOCUS_31890 161261 162103 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974781.1 protein_id gnl|my_center|LOCUS_31890 162100 162831 gene locus_tag LOCUS_31900 162100 162831 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_31900 162821 163375 gene locus_tag LOCUS_31910 162821 163375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 163735 163980 gene locus_tag LOCUS_31920 163735 163980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 164275 164643 gene locus_tag LOCUS_31930 164275 164643 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224578.1 protein_id gnl|my_center|LOCUS_31930 165555 164647 gene locus_tag LOCUS_31940 165555 164647 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230463.1 protein_id gnl|my_center|LOCUS_31940 165679 167061 gene locus_tag LOCUS_31950 165679 167061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 168437 167079 gene locus_tag LOCUS_31960 168437 167079 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230925.1 protein_id gnl|my_center|LOCUS_31960 169470 168448 gene locus_tag LOCUS_31970 169470 168448 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230924.1 protein_id gnl|my_center|LOCUS_31970 170573 169470 gene locus_tag LOCUS_31980 gene pdhA 170573 169470 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_31980 171105 172517 gene locus_tag LOCUS_31990 171105 172517 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467877.1 protein_id gnl|my_center|LOCUS_31990 172894 172565 gene locus_tag LOCUS_32000 172894 172565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 172996 175641 gene locus_tag LOCUS_32010 172996 175641 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_32010 175798 176616 gene locus_tag LOCUS_32020 175798 176616 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_32020 176690 177514 gene locus_tag LOCUS_32030 176690 177514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 177511 178275 gene locus_tag LOCUS_32040 177511 178275 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_32040 178333 180513 gene locus_tag LOCUS_32050 178333 180513 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230913.1 protein_id gnl|my_center|LOCUS_32050 180542 181444 gene locus_tag LOCUS_32060 180542 181444 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_32060 183075 181441 gene locus_tag LOCUS_32070 183075 181441 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230949.1 protein_id gnl|my_center|LOCUS_32070 183341 183075 gene locus_tag LOCUS_32080 183341 183075 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230950.1 protein_id gnl|my_center|LOCUS_32080 184160 183459 gene locus_tag LOCUS_32090 184160 183459 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230108.1 protein_id gnl|my_center|LOCUS_32090 184243 185016 gene locus_tag LOCUS_32100 184243 185016 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230111.1 protein_id gnl|my_center|LOCUS_32100 185832 185020 gene locus_tag LOCUS_32110 185832 185020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 186956 185835 gene locus_tag LOCUS_32120 186956 185835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225989.1 protein_id gnl|my_center|LOCUS_32120 187298 186975 gene locus_tag LOCUS_32130 187298 186975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225988.1 protein_id gnl|my_center|LOCUS_32130 187989 187306 gene locus_tag LOCUS_32140 187989 187306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 188168 189403 gene locus_tag LOCUS_32150 188168 189403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224630.1 protein_id gnl|my_center|LOCUS_32150 189433 190239 gene locus_tag LOCUS_32160 189433 190239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 190758 190291 gene locus_tag LOCUS_32170 190758 190291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 192686 190875 gene locus_tag LOCUS_32180 192686 190875 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230959.1 protein_id gnl|my_center|LOCUS_32180 193591 193112 gene locus_tag LOCUS_32190 193591 193112 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143400.1 protein_id gnl|my_center|LOCUS_32190 194335 193661 gene locus_tag LOCUS_32200 194335 193661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230960.1 protein_id gnl|my_center|LOCUS_32200 196252 194435 gene locus_tag LOCUS_32210 196252 194435 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_32210 196626 196249 gene locus_tag LOCUS_32220 gene grpE 196626 196249 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831423.1 protein_id gnl|my_center|LOCUS_32220 198140 196623 gene locus_tag LOCUS_32230 198140 196623 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742061.1 protein_id gnl|my_center|LOCUS_32230 198227 198721 gene locus_tag LOCUS_32240 198227 198721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 198810 199994 gene locus_tag LOCUS_32250 198810 199994 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230965.1 protein_id gnl|my_center|LOCUS_32250 200024 200680 gene locus_tag LOCUS_32260 200024 200680 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_32260 201613 200702 gene locus_tag LOCUS_32270 201613 200702 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230967.1 protein_id gnl|my_center|LOCUS_32270 202251 201610 gene locus_tag LOCUS_32280 202251 201610 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230968.1 protein_id gnl|my_center|LOCUS_32280 202236 203030 gene locus_tag LOCUS_32290 202236 203030 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_32290 204481 203027 gene locus_tag LOCUS_32300 204481 203027 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_32300 204657 205790 gene locus_tag LOCUS_32310 204657 205790 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_32310 205787 206437 gene locus_tag LOCUS_32320 205787 206437 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_32320 206933 206499 gene locus_tag LOCUS_32330 206933 206499 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_32330 207147 208067 gene locus_tag LOCUS_32340 207147 208067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_32340 208074 208835 gene locus_tag LOCUS_32350 208074 208835 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225510.1 protein_id gnl|my_center|LOCUS_32350 208970 209878 gene locus_tag LOCUS_32360 208970 209878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_32360 211117 209933 gene locus_tag LOCUS_32370 gene mycP 211117 209933 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_32370 211363 211944 gene locus_tag LOCUS_32380 211363 211944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230973.1 protein_id gnl|my_center|LOCUS_32380 212037 212669 gene locus_tag LOCUS_32390 gene trmB 212037 212669 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230974.1 protein_id gnl|my_center|LOCUS_32390 212770 213954 gene locus_tag LOCUS_32400 212770 213954 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_32400 214256 215416 gene locus_tag LOCUS_32410 214256 215416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 216315 215449 gene locus_tag LOCUS_32420 216315 215449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 216489 217790 gene locus_tag LOCUS_32430 216489 217790 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_32430 218472 217792 gene locus_tag LOCUS_32440 218472 217792 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_32440 220766 218685 gene locus_tag LOCUS_32450 220766 218685 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230984.1 protein_id gnl|my_center|LOCUS_32450 220988 221641 gene locus_tag LOCUS_32460 220988 221641 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 protein_id gnl|my_center|LOCUS_32460 221828 222538 gene locus_tag LOCUS_32470 221828 222538 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 protein_id gnl|my_center|LOCUS_32470 223685 222594 gene locus_tag LOCUS_32480 223685 222594 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_32480 224271 223726 gene locus_tag LOCUS_32490 224271 223726 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230991.1 protein_id gnl|my_center|LOCUS_32490 224440 224844 gene locus_tag LOCUS_32500 224440 224844 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_32500 224939 227806 gene locus_tag LOCUS_32510 224939 227806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 227936 229531 gene locus_tag LOCUS_32520 227936 229531 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230997.1 protein_id gnl|my_center|LOCUS_32520 230910 229528 gene locus_tag LOCUS_32530 230910 229528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 231731 230934 gene locus_tag LOCUS_32540 231731 230934 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_32540 231860 232861 gene locus_tag LOCUS_32550 231860 232861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 232983 233339 gene locus_tag LOCUS_32560 gene rpsF 232983 233339 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742059.1 protein_id gnl|my_center|LOCUS_32560 233353 233850 gene locus_tag LOCUS_32570 233353 233850 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_32570 233904 234143 gene locus_tag LOCUS_32580 gene rpsR 233904 234143 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_32580 234160 234615 gene locus_tag LOCUS_32590 gene rplI 234160 234615 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231004.1 protein_id gnl|my_center|LOCUS_32590 235030 236391 gene locus_tag LOCUS_32600 gene dnaB 235030 236391 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231009.1 protein_id gnl|my_center|LOCUS_32600 240212 236424 gene locus_tag LOCUS_32610 240212 236424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 242436 240259 gene locus_tag LOCUS_32620 242436 240259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 243770 242439 gene locus_tag LOCUS_32630 243770 242439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 243983 244540 gene locus_tag LOCUS_32640 243983 244540 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_32640 244566 245450 gene locus_tag LOCUS_32650 244566 245450 CDS product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027997.1 protein_id gnl|my_center|LOCUS_32650 245518 246300 gene locus_tag LOCUS_32660 245518 246300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 249720 246379 gene locus_tag LOCUS_32670 249720 246379 CDS product PE-PGRS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838671.1 protein_id gnl|my_center|LOCUS_32670 250789 249980 gene locus_tag LOCUS_32680 250789 249980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 253150 250958 gene locus_tag LOCUS_32690 253150 250958 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230913.1 protein_id gnl|my_center|LOCUS_32690 253418 253164 gene locus_tag LOCUS_32700 253418 253164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 253315 254514 gene locus_tag LOCUS_32710 253315 254514 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_32710 255713 254517 gene locus_tag LOCUS_32720 255713 254517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 255988 257043 gene locus_tag LOCUS_32730 255988 257043 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231016.1 protein_id gnl|my_center|LOCUS_32730 257040 257690 gene locus_tag LOCUS_32740 257040 257690 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231017.1 protein_id gnl|my_center|LOCUS_32740 257694 258269 gene locus_tag LOCUS_32750 257694 258269 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467889.1 protein_id gnl|my_center|LOCUS_32750 258312 259772 gene locus_tag LOCUS_32760 258312 259772 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862091.1 protein_id gnl|my_center|LOCUS_32760 259809 260843 gene locus_tag LOCUS_32770 gene tdh 259809 260843 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_32770 260843 262021 gene locus_tag LOCUS_32780 260843 262021 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_32780 262220 262026 gene locus_tag LOCUS_32790 262220 262026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 262272 263144 gene locus_tag LOCUS_32800 262272 263144 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_32800 264769 263138 gene locus_tag LOCUS_32810 gene ptsP 264769 263138 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 protein_id gnl|my_center|LOCUS_32810 265637 264846 gene locus_tag LOCUS_32820 265637 264846 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231023.1 protein_id gnl|my_center|LOCUS_32820 265813 267903 gene locus_tag LOCUS_32830 265813 267903 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230694.1 protein_id gnl|my_center|LOCUS_32830 268097 267858 gene locus_tag LOCUS_32840 268097 267858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 268190 269203 gene locus_tag LOCUS_32850 268190 269203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 271339 269213 gene locus_tag LOCUS_32860 gene mmpL3 271339 269213 CDS product trehalose monomycolate RND transporter MmpL3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950361.1 protein_id gnl|my_center|LOCUS_32860 271461 272198 gene locus_tag LOCUS_32870 271461 272198 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_32870 272342 272983 gene locus_tag LOCUS_32880 272342 272983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 275836 273017 gene locus_tag LOCUS_32890 gene leuS 275836 273017 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 protein_id gnl|my_center|LOCUS_32890 277065 275968 gene locus_tag LOCUS_32900 277065 275968 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231036.1 protein_id gnl|my_center|LOCUS_32900 277196 277594 gene locus_tag LOCUS_32910 277196 277594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 278172 277591 gene locus_tag LOCUS_32920 278172 277591 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231038.1 protein_id gnl|my_center|LOCUS_32920 278443 279771 gene locus_tag LOCUS_32930 278443 279771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087403.1 protein_id gnl|my_center|LOCUS_32930 280173 279916 gene locus_tag LOCUS_32940 280173 279916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 281728 280271 gene locus_tag LOCUS_32950 281728 280271 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231051.1 protein_id gnl|my_center|LOCUS_32950 281847 282365 gene locus_tag LOCUS_32960 281847 282365 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_32960 282362 284626 gene locus_tag LOCUS_32970 282362 284626 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231053.1 protein_id gnl|my_center|LOCUS_32970 284623 286254 gene locus_tag LOCUS_32980 gene murJ 284623 286254 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 protein_id gnl|my_center|LOCUS_32980 286292 287821 gene locus_tag LOCUS_32990 286292 287821 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231055.1 protein_id gnl|my_center|LOCUS_32990 287967 288584 gene locus_tag LOCUS_33000 gene sigM 287967 288584 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_33000 288581 289339 gene locus_tag LOCUS_33010 288581 289339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231057.1 protein_id gnl|my_center|LOCUS_33010 289459 290457 gene locus_tag LOCUS_33020 gene trxB 289459 290457 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_33020 290488 290814 gene locus_tag LOCUS_33030 gene trxA 290488 290814 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_33030 290969 292126 gene locus_tag LOCUS_33040 290969 292126 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 protein_id gnl|my_center|LOCUS_33040 292466 292242 gene locus_tag LOCUS_33050 292466 292242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 292508 292927 gene locus_tag LOCUS_33060 292508 292927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 293676 292924 gene locus_tag LOCUS_33070 293676 292924 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113386.1 protein_id gnl|my_center|LOCUS_33070 294383 293745 gene locus_tag LOCUS_33080 294383 293745 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231060.1 protein_id gnl|my_center|LOCUS_33080 294663 295844 gene locus_tag LOCUS_33090 294663 295844 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_33090 295858 296802 gene locus_tag LOCUS_33100 295858 296802 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_33100 298189 297197 gene locus_tag LOCUS_33110 298189 297197 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_33110 299214 298186 gene locus_tag LOCUS_33120 299214 298186 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225439919.1 protein_id gnl|my_center|LOCUS_33120 299888 299211 gene locus_tag LOCUS_33130 gene rsmG 299888 299211 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231065.1 protein_id gnl|my_center|LOCUS_33130 300511 300053 gene locus_tag LOCUS_33140 300511 300053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 300557 301546 gene locus_tag LOCUS_33150 300557 301546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 302155 301613 gene locus_tag LOCUS_33160 302155 301613 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467902.1 protein_id gnl|my_center|LOCUS_33160 303205 302174 gene locus_tag LOCUS_33170 gene yidC 303205 302174 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231068.1 protein_id gnl|my_center|LOCUS_33170 303481 303209 gene locus_tag LOCUS_33180 303481 303209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 303897 303478 gene locus_tag LOCUS_33190 gene rnpA 303897 303478 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_33190 304054 303911 gene locus_tag LOCUS_33200 gene rpmH 304054 303911 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231070.1 protein_id gnl|my_center|LOCUS_33200 304520 306073 gene locus_tag LOCUS_33210 304520 306073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 307525 308661 gene locus_tag LOCUS_33220 gene dnaN 307525 308661 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221956.1 protein_id gnl|my_center|LOCUS_33220 308704 309618 gene locus_tag LOCUS_33230 gene gnd 308704 309618 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 protein_id gnl|my_center|LOCUS_33230 309623 310765 gene locus_tag LOCUS_33240 gene recF 309623 310765 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221958.1 protein_id gnl|my_center|LOCUS_33240 310758 311384 gene locus_tag LOCUS_33250 310758 311384 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221959.1 protein_id gnl|my_center|LOCUS_33250 311621 313591 gene locus_tag LOCUS_33260 gene gyrB 311621 313591 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_33260 313627 317478 gene locus_tag LOCUS_33270 gene gyrA 313627 317478 CDS product intein-containing DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012634405.1 protein_id gnl|my_center|LOCUS_33270 317506 318390 gene locus_tag LOCUS_33280 317506 318390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 318454 318529 gene locus_tag LOCUS_t00260 318454 318529 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 318542 318682 gene locus_tag LOCUS_33290 318542 318682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 318716 318789 gene locus_tag LOCUS_t00270 318716 318789 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 319479 319102 gene locus_tag LOCUS_33300 319479 319102 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976454.1 protein_id gnl|my_center|LOCUS_33300 319645 320199 gene locus_tag LOCUS_33310 319645 320199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 320910 320257 gene locus_tag LOCUS_33320 320910 320257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 320958 321506 gene locus_tag LOCUS_33330 320958 321506 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 protein_id gnl|my_center|LOCUS_33330 321507 322391 gene locus_tag LOCUS_33340 321507 322391 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_33340 322872 322459 gene locus_tag LOCUS_33350 322872 322459 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091389441.1 protein_id gnl|my_center|LOCUS_33350 323355 323089 gene locus_tag LOCUS_33360 gene crgA 323355 323089 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221990.1 protein_id gnl|my_center|LOCUS_33360 323493 325541 gene locus_tag LOCUS_33370 323493 325541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 325541 325699 gene locus_tag LOCUS_33380 325541 325699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221992.1 protein_id gnl|my_center|LOCUS_33380 327058 325703 gene locus_tag LOCUS_33390 327058 325703 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 protein_id gnl|my_center|LOCUS_33390 327124 327771 gene locus_tag LOCUS_33400 327124 327771 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221999.1 protein_id gnl|my_center|LOCUS_33400 329843 327843 gene locus_tag LOCUS_33410 gene pknB 329843 327843 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_33410 331343 329916 gene locus_tag LOCUS_33420 331343 329916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 332806 331343 gene locus_tag LOCUS_33430 332806 331343 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222005.1 protein_id gnl|my_center|LOCUS_33430 334266 332803 gene locus_tag LOCUS_33440 334266 332803 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222006.1 protein_id gnl|my_center|LOCUS_33440 335650 334271 gene locus_tag LOCUS_33450 335650 334271 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_33450 336108 335647 gene locus_tag LOCUS_33460 336108 335647 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_33460 337345 336164 gene locus_tag LOCUS_33470 337345 336164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 337462 337547 gene locus_tag LOCUS_t00280 337462 337547 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 337995 338612 gene locus_tag LOCUS_33480 337995 338612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222031.1 protein_id gnl|my_center|LOCUS_33480 338627 339259 gene locus_tag LOCUS_33490 338627 339259 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_33490 340707 339430 gene locus_tag LOCUS_33500 340707 339430 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_33500 340781 341968 gene locus_tag LOCUS_33510 340781 341968 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222035.1 protein_id gnl|my_center|LOCUS_33510 342597 341983 gene locus_tag LOCUS_33520 342597 341983 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_33520 342717 343943 gene locus_tag LOCUS_33530 342717 343943 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222037.1 protein_id gnl|my_center|LOCUS_33530 343940 345163 gene locus_tag LOCUS_33540 343940 345163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_33540 345174 345965 gene locus_tag LOCUS_33550 345174 345965 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_33550 346594 346232 gene locus_tag LOCUS_33560 346594 346232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 346934 346608 gene locus_tag LOCUS_33570 346934 346608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 347205 348527 gene locus_tag LOCUS_33580 347205 348527 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222041.1 protein_id gnl|my_center|LOCUS_33580 348583 349437 gene locus_tag LOCUS_33590 348583 349437 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222042.1 protein_id gnl|my_center|LOCUS_33590 349528 349821 gene locus_tag LOCUS_33600 349528 349821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 350548 349868 gene locus_tag LOCUS_33610 350548 349868 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_33610 350982 350545 gene locus_tag LOCUS_33620 350982 350545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 352029 351007 gene locus_tag LOCUS_33630 352029 351007 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222043.1 protein_id gnl|my_center|LOCUS_33630 352589 352026 gene locus_tag LOCUS_33640 352589 352026 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284846.1 protein_id gnl|my_center|LOCUS_33640 353344 352586 gene locus_tag LOCUS_33650 353344 352586 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222045.1 protein_id gnl|my_center|LOCUS_33650 353918 353394 gene locus_tag LOCUS_33660 353918 353394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222046.1 protein_id gnl|my_center|LOCUS_33660 354089 355693 gene locus_tag LOCUS_33670 354089 355693 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 protein_id gnl|my_center|LOCUS_33670 356105 355674 gene locus_tag LOCUS_33680 356105 355674 CDS product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222051.1 protein_id gnl|my_center|LOCUS_33680 356291 357847 gene locus_tag LOCUS_33690 356291 357847 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284849.1 protein_id gnl|my_center|LOCUS_33690 358616 357864 gene locus_tag LOCUS_33700 358616 357864 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222055.1 protein_id gnl|my_center|LOCUS_33700 358836 358645 gene locus_tag LOCUS_33710 358836 358645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 358923 360197 gene locus_tag LOCUS_33720 358923 360197 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_33720 360283 362079 gene locus_tag LOCUS_33730 360283 362079 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284852.1 protein_id gnl|my_center|LOCUS_33730 362630 362361 gene locus_tag LOCUS_33740 362630 362361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 362934 363371 gene locus_tag LOCUS_33750 362934 363371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 363417 363704 gene locus_tag LOCUS_33760 363417 363704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 363701 364111 gene locus_tag LOCUS_33770 363701 364111 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230831.1 protein_id gnl|my_center|LOCUS_33770 364177 365079 gene locus_tag LOCUS_33780 364177 365079 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742181.1 protein_id gnl|my_center|LOCUS_33780 364976 365635 gene locus_tag LOCUS_33790 364976 365635 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222065.1 protein_id gnl|my_center|LOCUS_33790 366152 365778 gene locus_tag LOCUS_33800 366152 365778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 366487 367803 gene locus_tag LOCUS_33810 366487 367803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222070.1 protein_id gnl|my_center|LOCUS_33810 367817 369223 gene locus_tag LOCUS_33820 367817 369223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 369220 370581 gene locus_tag LOCUS_33830 369220 370581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 374078 370590 gene locus_tag LOCUS_33840 374078 370590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 375271 374078 gene locus_tag LOCUS_33850 375271 374078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 377708 375330 gene locus_tag LOCUS_33860 377708 375330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 378835 377705 gene locus_tag LOCUS_33870 378835 377705 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331367.1 protein_id gnl|my_center|LOCUS_33870 379797 378829 gene locus_tag LOCUS_33880 379797 378829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 380399 379794 gene locus_tag LOCUS_33890 380399 379794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 380663 382414 gene locus_tag LOCUS_33900 380663 382414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_33900 382899 382441 gene locus_tag LOCUS_33910 382899 382441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 382823 383593 gene locus_tag LOCUS_33920 382823 383593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 383993 383568 gene locus_tag LOCUS_33930 383993 383568 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_33930 384181 384108 gene locus_tag LOCUS_t00290 384181 384108 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 384525 384208 gene locus_tag LOCUS_33940 384525 384208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 384854 386209 gene locus_tag LOCUS_33950 384854 386209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 386296 386730 gene locus_tag LOCUS_33960 386296 386730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222080.1 protein_id gnl|my_center|LOCUS_33960 386758 387621 gene locus_tag LOCUS_33970 386758 387621 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222081.1 protein_id gnl|my_center|LOCUS_33970 387716 387982 gene locus_tag LOCUS_33980 387716 387982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 388181 389440 gene locus_tag LOCUS_33990 388181 389440 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222082.1 protein_id gnl|my_center|LOCUS_33990 389613 389446 gene locus_tag LOCUS_34000 389613 389446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 389667 390533 gene locus_tag LOCUS_34010 389667 390533 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222083.1 protein_id gnl|my_center|LOCUS_34010 390595 391440 gene locus_tag LOCUS_34020 390595 391440 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284934.1 protein_id gnl|my_center|LOCUS_34020 391437 391877 gene locus_tag LOCUS_34030 391437 391877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 391874 393682 gene locus_tag LOCUS_34040 391874 393682 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222087.1 protein_id gnl|my_center|LOCUS_34040 394054 394404 gene locus_tag LOCUS_34050 394054 394404 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223484.1 protein_id gnl|my_center|LOCUS_34050 394401 395987 gene locus_tag LOCUS_34060 394401 395987 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223483.1 protein_id gnl|my_center|LOCUS_34060 396093 396431 gene locus_tag LOCUS_34070 396093 396431 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_34070 396433 397338 gene locus_tag LOCUS_34080 396433 397338 CDS product DUF4328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222089.1 protein_id gnl|my_center|LOCUS_34080 398107 397340 gene locus_tag LOCUS_34090 398107 397340 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974027.1 protein_id gnl|my_center|LOCUS_34090 398172 399074 gene locus_tag LOCUS_34100 gene sigJ 398172 399074 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_34100 399322 399534 gene locus_tag LOCUS_34110 399322 399534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 399559 400575 gene locus_tag LOCUS_34120 399559 400575 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_34120 401765 400572 gene locus_tag LOCUS_34130 401765 400572 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222093.1 protein_id gnl|my_center|LOCUS_34130 401898 402605 gene locus_tag LOCUS_34140 401898 402605 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897832.1 protein_id gnl|my_center|LOCUS_34140 402623 403570 gene locus_tag LOCUS_34150 402623 403570 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222094.1 protein_id gnl|my_center|LOCUS_34150 403632 403955 gene locus_tag LOCUS_34160 403632 403955 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091383635.1 protein_id gnl|my_center|LOCUS_34160 404041 404562 gene locus_tag LOCUS_34170 404041 404562 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222096.1 protein_id gnl|my_center|LOCUS_34170 404586 405293 gene locus_tag LOCUS_34180 404586 405293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 405558 405256 gene locus_tag LOCUS_34190 405558 405256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 405500 405889 gene locus_tag LOCUS_34200 405500 405889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 405928 406431 gene locus_tag LOCUS_34210 405928 406431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 407067 406507 gene locus_tag LOCUS_34220 407067 406507 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897831.1 protein_id gnl|my_center|LOCUS_34220 408421 407174 gene locus_tag LOCUS_34230 408421 407174 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466510.1 protein_id gnl|my_center|LOCUS_34230 408594 408980 gene locus_tag LOCUS_34240 408594 408980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 408982 411039 gene locus_tag LOCUS_34250 408982 411039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 411911 411147 gene locus_tag LOCUS_34260 411911 411147 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222100.1 protein_id gnl|my_center|LOCUS_34260 412695 411934 gene locus_tag LOCUS_34270 412695 411934 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222102.1 protein_id gnl|my_center|LOCUS_34270 412935 413408 gene locus_tag LOCUS_34280 412935 413408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 413453 413932 gene locus_tag LOCUS_34290 413453 413932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 414863 413940 gene locus_tag LOCUS_34300 414863 413940 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_34300 417948 415696 gene locus_tag LOCUS_34310 417948 415696 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_34310 419036 417948 gene locus_tag LOCUS_34320 419036 417948 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_34320 420460 419033 gene locus_tag LOCUS_34330 420460 419033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 420768 420457 gene locus_tag LOCUS_34340 420768 420457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 422042 420765 gene locus_tag LOCUS_34350 422042 420765 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 protein_id gnl|my_center|LOCUS_34350 423260 422082 gene locus_tag LOCUS_34360 423260 422082 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222108.1 protein_id gnl|my_center|LOCUS_34360 423435 424196 gene locus_tag LOCUS_34370 423435 424196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222109.1 protein_id gnl|my_center|LOCUS_34370 424193 425365 gene locus_tag LOCUS_34380 gene fahA 424193 425365 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 protein_id gnl|my_center|LOCUS_34380 425369 426037 gene locus_tag LOCUS_34390 425369 426037 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222110.1 protein_id gnl|my_center|LOCUS_34390 426083 426679 gene locus_tag LOCUS_34400 426083 426679 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230158.1 protein_id gnl|my_center|LOCUS_34400 427486 426887 gene locus_tag LOCUS_34410 427486 426887 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222112.1 protein_id gnl|my_center|LOCUS_34410 427806 429296 gene locus_tag LOCUS_34420 427806 429296 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222114.1 protein_id gnl|my_center|LOCUS_34420 429308 430309 gene locus_tag LOCUS_34430 gene cydB 429308 430309 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222115.1 protein_id gnl|my_center|LOCUS_34430 430411 433398 gene locus_tag LOCUS_34440 gene cydC 430411 433398 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222116.1 protein_id gnl|my_center|LOCUS_34440 433395 434516 gene locus_tag LOCUS_34450 433395 434516 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839508.1 protein_id gnl|my_center|LOCUS_34450 435310 434720 gene locus_tag LOCUS_34460 435310 434720 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222118.1 protein_id gnl|my_center|LOCUS_34460 435410 435892 gene locus_tag LOCUS_34470 435410 435892 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675008.1 protein_id gnl|my_center|LOCUS_34470 436564 435950 gene locus_tag LOCUS_34480 436564 435950 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_34480 436668 437561 gene locus_tag LOCUS_34490 gene pheA 436668 437561 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222131.1 protein_id gnl|my_center|LOCUS_34490 437558 438172 gene locus_tag LOCUS_34500 437558 438172 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222132.1 protein_id gnl|my_center|LOCUS_34500 438748 438398 gene locus_tag LOCUS_34510 438748 438398 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_34510 439778 438753 gene locus_tag LOCUS_34520 439778 438753 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222137.1 protein_id gnl|my_center|LOCUS_34520 439944 440621 gene locus_tag LOCUS_34530 439944 440621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 440622 441785 gene locus_tag LOCUS_34540 440622 441785 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222139.1 protein_id gnl|my_center|LOCUS_34540 441933 442385 gene locus_tag LOCUS_34550 441933 442385 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222140.1 protein_id gnl|my_center|LOCUS_34550 443045 442443 gene locus_tag LOCUS_34560 443045 442443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 443127 444380 gene locus_tag LOCUS_34570 gene serS 443127 444380 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_34570 445777 444605 gene locus_tag LOCUS_34580 gene lhgO 445777 444605 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222145.1 protein_id gnl|my_center|LOCUS_34580 446637 445804 gene locus_tag LOCUS_34590 446637 445804 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 protein_id gnl|my_center|LOCUS_34590 446731 447531 gene locus_tag LOCUS_34600 446731 447531 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222171.1 protein_id gnl|my_center|LOCUS_34600 447584 448519 gene locus_tag LOCUS_34610 447584 448519 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113113.1 protein_id gnl|my_center|LOCUS_34610 449121 448582 gene locus_tag LOCUS_34620 449121 448582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 450257 449142 gene locus_tag LOCUS_34630 450257 449142 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_34630 450969 450262 gene locus_tag LOCUS_34640 450969 450262 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_34640 452099 450966 gene locus_tag LOCUS_34650 452099 450966 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 protein_id gnl|my_center|LOCUS_34650 453058 452096 gene locus_tag LOCUS_34660 453058 452096 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_34660 454083 453058 gene locus_tag LOCUS_34670 454083 453058 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_34670 454250 454936 gene locus_tag LOCUS_34680 454250 454936 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113115.1 protein_id gnl|my_center|LOCUS_34680 454939 455304 gene locus_tag LOCUS_34690 454939 455304 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113114.1 protein_id gnl|my_center|LOCUS_34690 455301 456188 gene locus_tag LOCUS_34700 455301 456188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 457557 456235 gene locus_tag LOCUS_34710 457557 456235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 459652 457601 gene locus_tag LOCUS_34720 459652 457601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 459922 461109 gene locus_tag LOCUS_34730 gene glf 459922 461109 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897813.1 protein_id gnl|my_center|LOCUS_34730 461117 462988 gene locus_tag LOCUS_34740 461117 462988 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222182.1 protein_id gnl|my_center|LOCUS_34740 463075 464931 gene locus_tag LOCUS_34750 463075 464931 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731265.1 protein_id gnl|my_center|LOCUS_34750 465267 465055 gene locus_tag LOCUS_34760 465267 465055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 466251 465352 gene locus_tag LOCUS_34770 466251 465352 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466521.1 protein_id gnl|my_center|LOCUS_34770 467073 466258 gene locus_tag LOCUS_34780 467073 466258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222189.1 protein_id gnl|my_center|LOCUS_34780 468019 467093 gene locus_tag LOCUS_34790 468019 467093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284954.1 protein_id gnl|my_center|LOCUS_34790 468942 468079 gene locus_tag LOCUS_34800 468942 468079 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222956.1 protein_id gnl|my_center|LOCUS_34800 469586 469035 gene locus_tag LOCUS_34810 469586 469035 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222191.1 protein_id gnl|my_center|LOCUS_34810 469700 470899 gene locus_tag LOCUS_34820 469700 470899 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222192.1 protein_id gnl|my_center|LOCUS_34820 470896 471555 gene locus_tag LOCUS_34830 470896 471555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 472582 471566 gene locus_tag LOCUS_34840 472582 471566 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222193.1 protein_id gnl|my_center|LOCUS_34840 472591 473238 gene locus_tag LOCUS_34850 472591 473238 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_34850 473302 474831 gene locus_tag LOCUS_34860 473302 474831 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_34860 475031 476602 gene locus_tag LOCUS_34870 475031 476602 CDS product SdrD B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947305.1 protein_id gnl|my_center|LOCUS_34870 476661 477347 gene locus_tag LOCUS_34880 476661 477347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 477533 478882 gene locus_tag LOCUS_34890 477533 478882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 479060 479147 gene locus_tag LOCUS_t00300 479060 479147 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 479637 479206 gene locus_tag LOCUS_34900 479637 479206 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742106.1 protein_id gnl|my_center|LOCUS_34900 479810 481543 gene locus_tag LOCUS_34910 479810 481543 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230897.1 protein_id gnl|my_center|LOCUS_34910 482096 482998 gene locus_tag LOCUS_34920 482096 482998 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222195.1 protein_id gnl|my_center|LOCUS_34920 483103 483858 gene locus_tag LOCUS_34930 483103 483858 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222221.1 protein_id gnl|my_center|LOCUS_34930 484915 483848 gene locus_tag LOCUS_34940 gene hisC 484915 483848 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222222.1 protein_id gnl|my_center|LOCUS_34940 485037 485711 gene locus_tag LOCUS_34950 485037 485711 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222223.1 protein_id gnl|my_center|LOCUS_34950 485846 486493 gene locus_tag LOCUS_34960 485846 486493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 486527 486724 gene locus_tag LOCUS_34970 486527 486724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 486721 487905 gene locus_tag LOCUS_34980 486721 487905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 487902 488666 gene locus_tag LOCUS_34990 487902 488666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 488726 490723 gene locus_tag LOCUS_35000 488726 490723 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222224.1 protein_id gnl|my_center|LOCUS_35000 490841 490931 gene locus_tag LOCUS_t00310 490841 490931 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 490970 491043 gene locus_tag LOCUS_t00320 490970 491043 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 491446 492120 gene locus_tag LOCUS_35010 gene cmk 491446 492120 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408441.1 protein_id gnl|my_center|LOCUS_35010 492289 492729 gene locus_tag LOCUS_35020 492289 492729 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_35020 493349 492714 gene locus_tag LOCUS_35030 493349 492714 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974444.1 protein_id gnl|my_center|LOCUS_35030 494113 493346 gene locus_tag LOCUS_35040 494113 493346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 495186 494110 gene locus_tag LOCUS_35050 gene thiL 495186 494110 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_35050 495885 495190 gene locus_tag LOCUS_35060 495885 495190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 496132 496449 gene locus_tag LOCUS_35070 496132 496449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 497154 497573 gene locus_tag LOCUS_35080 497154 497573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223906.1 protein_id gnl|my_center|LOCUS_35080 497574 497795 gene locus_tag LOCUS_35090 497574 497795 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_35090 497795 498757 gene locus_tag LOCUS_35100 497795 498757 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_35100 500737 498758 gene locus_tag LOCUS_35110 500737 498758 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201368745.1 protein_id gnl|my_center|LOCUS_35110 500926 501195 gene locus_tag LOCUS_35120 500926 501195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 501180 501938 gene locus_tag LOCUS_35130 501180 501938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 502737 501895 gene locus_tag LOCUS_35140 502737 501895 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028315.1 protein_id gnl|my_center|LOCUS_35140 502776 503654 gene locus_tag LOCUS_35150 502776 503654 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_35150 504769 503879 gene locus_tag LOCUS_35160 gene galE 504769 503879 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975319.1 protein_id gnl|my_center|LOCUS_35160 504887 505099 gene locus_tag LOCUS_35170 504887 505099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 505250 506680 gene locus_tag LOCUS_35180 505250 506680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 507434 506694 gene locus_tag LOCUS_35190 507434 506694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 507576 508787 gene locus_tag LOCUS_35200 507576 508787 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_35200 509179 510444 gene locus_tag LOCUS_35210 509179 510444 CDS product thioester domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316091.1 protein_id gnl|my_center|LOCUS_35210 510594 510767 gene locus_tag LOCUS_35220 510594 510767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 510764 511390 gene locus_tag LOCUS_35230 510764 511390 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063076.1 protein_id gnl|my_center|LOCUS_35230 511577 512134 gene locus_tag LOCUS_35240 511577 512134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 513448 512264 gene locus_tag LOCUS_35250 513448 512264 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031117.1 protein_id gnl|my_center|LOCUS_35250 515267 513462 gene locus_tag LOCUS_35260 515267 513462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 517097 515334 gene locus_tag LOCUS_35270 517097 515334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 518057 517107 gene locus_tag LOCUS_35280 518057 517107 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222259.1 protein_id gnl|my_center|LOCUS_35280 519443 518208 gene locus_tag LOCUS_35290 519443 518208 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_35290 519608 520021 gene locus_tag LOCUS_35300 519608 520021 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199198884.1 protein_id gnl|my_center|LOCUS_35300 520035 520496 gene locus_tag LOCUS_35310 520035 520496 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112945.1 protein_id gnl|my_center|LOCUS_35310 520579 520664 gene locus_tag LOCUS_t00330 520579 520664 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 523633 520721 gene locus_tag LOCUS_35320 523633 520721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 523871 526348 gene locus_tag LOCUS_35330 523871 526348 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230662.1 protein_id gnl|my_center|LOCUS_35330 527032 526415 gene locus_tag LOCUS_35340 527032 526415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 527245 527160 gene locus_tag LOCUS_t00340 527245 527160 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 527342 528259 gene locus_tag LOCUS_35350 527342 528259 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 protein_id gnl|my_center|LOCUS_35350 528545 528270 gene locus_tag LOCUS_35360 528545 528270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 528835 528539 gene locus_tag LOCUS_35370 528835 528539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 529031 531220 gene locus_tag LOCUS_35380 529031 531220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 531274 531621 gene locus_tag LOCUS_35390 531274 531621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 531621 532214 gene locus_tag LOCUS_35400 gene recR 531621 532214 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230626.1 protein_id gnl|my_center|LOCUS_35400 532211 532699 gene locus_tag LOCUS_35410 532211 532699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 535979 532710 gene locus_tag LOCUS_35420 535979 532710 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_35420 536209 537891 gene locus_tag LOCUS_35430 536209 537891 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_35430 537929 538933 gene locus_tag LOCUS_35440 537929 538933 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_35440 538940 539872 gene locus_tag LOCUS_35450 538940 539872 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 protein_id gnl|my_center|LOCUS_35450 539876 540871 gene locus_tag LOCUS_35460 539876 540871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 protein_id gnl|my_center|LOCUS_35460 540868 542019 gene locus_tag LOCUS_35470 540868 542019 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230613.1 protein_id gnl|my_center|LOCUS_35470 542764 542063 gene locus_tag LOCUS_35480 542764 542063 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 protein_id gnl|my_center|LOCUS_35480 542846 543277 gene locus_tag LOCUS_35490 542846 543277 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898000.1 protein_id gnl|my_center|LOCUS_35490 543504 543274 gene locus_tag LOCUS_35500 543504 543274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 544241 543678 gene locus_tag LOCUS_35510 544241 543678 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284350.1 protein_id gnl|my_center|LOCUS_35510 544310 544930 gene locus_tag LOCUS_35520 544310 544930 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229995.1 protein_id gnl|my_center|LOCUS_35520 545454 544894 gene locus_tag LOCUS_35530 545454 544894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 545845 545528 gene locus_tag LOCUS_35540 545845 545528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 545768 546691 gene locus_tag LOCUS_35550 545768 546691 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_35550 546705 546890 gene locus_tag LOCUS_35560 546705 546890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 547833 546874 gene locus_tag LOCUS_35570 547833 546874 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_35570 547885 549030 gene locus_tag LOCUS_35580 547885 549030 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_35580 550945 549155 gene locus_tag LOCUS_35590 gene leuA 550945 549155 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_35590 551242 551469 gene locus_tag LOCUS_35600 551242 551469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 552057 551485 gene locus_tag LOCUS_35610 552057 551485 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849840.1 protein_id gnl|my_center|LOCUS_35610 553263 552088 gene locus_tag LOCUS_35620 553263 552088 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_35620 553389 554654 gene locus_tag LOCUS_35630 553389 554654 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_35630 554651 555742 gene locus_tag LOCUS_35640 554651 555742 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_35640 555753 557180 gene locus_tag LOCUS_35650 555753 557180 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101332.1 protein_id gnl|my_center|LOCUS_35650 558338 557163 gene locus_tag LOCUS_35660 558338 557163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 protein_id gnl|my_center|LOCUS_35660 558424 558840 gene locus_tag LOCUS_35670 gene furA3 558424 558840 CDS product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_35670 558871 560319 gene locus_tag LOCUS_35680 558871 560319 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729105.1 protein_id gnl|my_center|LOCUS_35680 562032 560965 gene locus_tag LOCUS_35690 562032 560965 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_35690 562112 562672 gene locus_tag LOCUS_35700 562112 562672 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742094.1 protein_id gnl|my_center|LOCUS_35700 562788 563210 gene locus_tag LOCUS_35710 562788 563210 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230586.1 protein_id gnl|my_center|LOCUS_35710 563234 563719 gene locus_tag LOCUS_35720 563234 563719 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230585.1 protein_id gnl|my_center|LOCUS_35720 565770 563962 gene locus_tag LOCUS_35730 565770 563962 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230572.1 protein_id gnl|my_center|LOCUS_35730 566543 565767 gene locus_tag LOCUS_35740 566543 565767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 566591 566770 gene locus_tag LOCUS_35750 566591 566770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 566982 566767 gene locus_tag LOCUS_35760 566982 566767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 567225 567425 gene locus_tag LOCUS_35770 567225 567425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 567529 568284 gene locus_tag LOCUS_35780 567529 568284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 568382 568579 gene locus_tag LOCUS_35790 568382 568579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 569297 568950 gene locus_tag LOCUS_35800 569297 568950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 569259 571547 gene locus_tag LOCUS_35810 gene fxsT 569259 571547 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030349.1 protein_id gnl|my_center|LOCUS_35810 571718 572896 gene locus_tag LOCUS_35820 571718 572896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 573096 573022 gene locus_tag LOCUS_t00350 573096 573022 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 574084 573125 gene locus_tag LOCUS_35830 574084 573125 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467832.1 protein_id gnl|my_center|LOCUS_35830 574149 574616 gene locus_tag LOCUS_35840 574149 574616 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_35840 577932 575479 gene locus_tag LOCUS_35850 577932 575479 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 protein_id gnl|my_center|LOCUS_35850 578207 578497 gene locus_tag LOCUS_35860 578207 578497 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230567.1 protein_id gnl|my_center|LOCUS_35860 579630 578512 gene locus_tag LOCUS_35870 579630 578512 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_35870 580619 579627 gene locus_tag LOCUS_35880 580619 579627 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 protein_id gnl|my_center|LOCUS_35880 580926 580675 gene locus_tag LOCUS_35890 580926 580675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230564.1 protein_id gnl|my_center|LOCUS_35890 581225 580959 gene locus_tag LOCUS_35900 581225 580959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 581321 582178 gene locus_tag LOCUS_35910 581321 582178 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028631.1 protein_id gnl|my_center|LOCUS_35910 582175 582357 gene locus_tag LOCUS_35920 582175 582357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 582427 582582 gene locus_tag LOCUS_35930 582427 582582 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003068074.1 protein_id gnl|my_center|LOCUS_35930 582579 583037 gene locus_tag LOCUS_35940 582579 583037 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 protein_id gnl|my_center|LOCUS_35940 583039 583641 gene locus_tag LOCUS_35950 583039 583641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230562.1 protein_id gnl|my_center|LOCUS_35950 583680 584948 gene locus_tag LOCUS_35960 583680 584948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 585988 584945 gene locus_tag LOCUS_35970 585988 584945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35970 586884 585985 gene locus_tag LOCUS_35980 586884 585985 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230738.1 protein_id gnl|my_center|LOCUS_35980 587285 586893 gene locus_tag LOCUS_35990 587285 586893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 587338 588117 gene locus_tag LOCUS_36000 587338 588117 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_36000 588114 588887 gene locus_tag LOCUS_36010 588114 588887 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230559.1 protein_id gnl|my_center|LOCUS_36010 589284 588913 gene locus_tag LOCUS_36020 589284 588913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 589232 589639 gene locus_tag LOCUS_36030 589232 589639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 591081 589975 gene locus_tag LOCUS_36040 591081 589975 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230553.1 protein_id gnl|my_center|LOCUS_36040 592367 591129 gene locus_tag LOCUS_36050 592367 591129 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230552.1 protein_id gnl|my_center|LOCUS_36050 592115 592031 gene locus_tag LOCUS_t00360 592115 592031 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 593468 592794 gene locus_tag LOCUS_36060 593468 592794 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081747.1 protein_id gnl|my_center|LOCUS_36060 593919 593668 gene locus_tag LOCUS_36070 593919 593668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 594204 594971 gene locus_tag LOCUS_36080 gene nth 594204 594971 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_36080 594968 595567 gene locus_tag LOCUS_36090 594968 595567 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230549.1 protein_id gnl|my_center|LOCUS_36090 595564 596235 gene locus_tag LOCUS_36100 595564 596235 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230548.1 protein_id gnl|my_center|LOCUS_36100 596232 597419 gene locus_tag LOCUS_36110 596232 597419 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_36110 598364 597438 gene locus_tag LOCUS_36120 598364 597438 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230544.1 protein_id gnl|my_center|LOCUS_36120 598843 598373 gene locus_tag LOCUS_36130 598843 598373 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230543.1 protein_id gnl|my_center|LOCUS_36130 600099 598903 gene locus_tag LOCUS_36140 gene nhaA 600099 598903 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230542.1 protein_id gnl|my_center|LOCUS_36140 602222 600246 gene locus_tag LOCUS_36150 gene acs 602222 600246 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230537.1 protein_id gnl|my_center|LOCUS_36150 602994 602425 gene locus_tag LOCUS_36160 602994 602425 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_36160 603053 603811 gene locus_tag LOCUS_36170 603053 603811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 protein_id gnl|my_center|LOCUS_36170 604952 603831 gene locus_tag LOCUS_36180 gene kynU 604952 603831 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029138.1 protein_id gnl|my_center|LOCUS_36180 605764 604949 gene locus_tag LOCUS_36190 605764 604949 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_36190 605865 606320 gene locus_tag LOCUS_36200 605865 606320 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222590.1 protein_id gnl|my_center|LOCUS_36200 607224 606289 gene locus_tag LOCUS_36210 607224 606289 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230532.1 protein_id gnl|my_center|LOCUS_36210 608138 607221 gene locus_tag LOCUS_36220 608138 607221 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_36220 609900 608248 gene locus_tag LOCUS_36230 609900 608248 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230530.1 protein_id gnl|my_center|LOCUS_36230 611161 609914 gene locus_tag LOCUS_36240 611161 609914 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_36240 612879 611167 gene locus_tag LOCUS_36250 612879 611167 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230528.1 protein_id gnl|my_center|LOCUS_36250 614283 613471 gene locus_tag LOCUS_36260 614283 613471 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083519.1 protein_id gnl|my_center|LOCUS_36260 614766 615818 gene locus_tag LOCUS_36270 614766 615818 CDS product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510600.1 protein_id gnl|my_center|LOCUS_36270 616501 617655 gene locus_tag LOCUS_36280 616501 617655 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230525.1 protein_id gnl|my_center|LOCUS_36280 617652 618413 gene locus_tag LOCUS_36290 617652 618413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 618410 619330 gene locus_tag LOCUS_36300 618410 619330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 619362 619538 gene locus_tag LOCUS_36310 619362 619538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 619535 619876 gene locus_tag LOCUS_36320 619535 619876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 619873 620214 gene locus_tag LOCUS_36330 619873 620214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 620484 621086 gene locus_tag LOCUS_36340 620484 621086 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230520.1 protein_id gnl|my_center|LOCUS_36340 623068 621056 gene locus_tag LOCUS_36350 623068 621056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 622953 623540 gene locus_tag LOCUS_36360 622953 623540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 623670 625973 gene locus_tag LOCUS_36370 623670 625973 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_36370 626129 626716 gene locus_tag LOCUS_36380 626129 626716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 626759 627364 gene locus_tag LOCUS_36390 626759 627364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 627455 628366 gene locus_tag LOCUS_36400 627455 628366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 628557 631256 gene locus_tag LOCUS_36410 gene topA 628557 631256 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_36410 631270 631725 gene locus_tag LOCUS_36420 631270 631725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 631867 633837 gene locus_tag LOCUS_36430 631867 633837 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230508.1 protein_id gnl|my_center|LOCUS_36430 633870 635057 gene locus_tag LOCUS_36440 633870 635057 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_36440 636636 635062 gene locus_tag LOCUS_36450 636636 635062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742225.1 protein_id gnl|my_center|LOCUS_36450 636762 636836 gene locus_tag LOCUS_t00370 636762 636836 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 636952 637260 gene locus_tag LOCUS_36460 636952 637260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 637257 637931 gene locus_tag LOCUS_36470 637257 637931 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224281.1 protein_id gnl|my_center|LOCUS_36470 637946 638860 gene locus_tag LOCUS_36480 637946 638860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 639141 639314 gene locus_tag LOCUS_36490 639141 639314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 640251 639301 gene locus_tag LOCUS_36500 640251 639301 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_36500 641116 640262 gene locus_tag LOCUS_36510 641116 640262 CDS product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222122.1 protein_id gnl|my_center|LOCUS_36510 641575 641123 gene locus_tag LOCUS_36520 641575 641123 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_36520 641703 642218 gene locus_tag LOCUS_36530 641703 642218 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230835.1 protein_id gnl|my_center|LOCUS_36530 642218 643882 gene locus_tag LOCUS_36540 642218 643882 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 protein_id gnl|my_center|LOCUS_36540 644452 643949 gene locus_tag LOCUS_36550 644452 643949 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230477.1 protein_id gnl|my_center|LOCUS_36550 644567 646183 gene locus_tag LOCUS_36560 644567 646183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 646363 647376 gene locus_tag LOCUS_36570 646363 647376 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230475.1 protein_id gnl|my_center|LOCUS_36570 647373 648299 gene locus_tag LOCUS_36580 gene tilS 647373 648299 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230474.1 protein_id gnl|my_center|LOCUS_36580 648317 648868 gene locus_tag LOCUS_36590 gene hpt 648317 648868 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_36590 650620 648920 gene locus_tag LOCUS_36600 650620 648920 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 protein_id gnl|my_center|LOCUS_36600 651039 653312 gene locus_tag LOCUS_36610 gene ftsH 651039 653312 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230468.1 protein_id gnl|my_center|LOCUS_36610 653309 653953 gene locus_tag LOCUS_36620 gene folE 653309 653953 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467817.1 protein_id gnl|my_center|LOCUS_36620 653950 654771 gene locus_tag LOCUS_36630 gene folP 653950 654771 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_36630 654761 655162 gene locus_tag LOCUS_36640 gene folB 654761 655162 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_36640 655155 655637 gene locus_tag LOCUS_36650 gene folK 655155 655637 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230464.1 protein_id gnl|my_center|LOCUS_36650 655693 656349 gene locus_tag LOCUS_36660 655693 656349 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_36660 656367 656819 gene locus_tag LOCUS_36670 656367 656819 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230462.1 protein_id gnl|my_center|LOCUS_36670 656951 658633 gene locus_tag LOCUS_36680 656951 658633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36680 659698 658634 gene locus_tag LOCUS_36690 659698 658634 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_36690 660187 659735 gene locus_tag LOCUS_36700 660187 659735 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028474.1 protein_id gnl|my_center|LOCUS_36700 661414 660257 gene locus_tag LOCUS_36710 661414 660257 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_36710 661818 661411 gene locus_tag LOCUS_36720 661818 661411 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_36720 662335 661937 gene locus_tag LOCUS_36730 662335 661937 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977090.1 protein_id gnl|my_center|LOCUS_36730 662427 662750 gene locus_tag LOCUS_36740 662427 662750 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977089.1 protein_id gnl|my_center|LOCUS_36740 663824 662778 gene locus_tag LOCUS_36750 663824 662778 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_36750 663855 665027 gene locus_tag LOCUS_36760 663855 665027 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_36760 665119 666009 gene locus_tag LOCUS_36770 665119 666009 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_36770 666006 666896 gene locus_tag LOCUS_36780 gene panC 666006 666896 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230458.1 protein_id gnl|my_center|LOCUS_36780 666907 667401 gene locus_tag LOCUS_36790 666907 667401 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_36790 667430 668215 gene locus_tag LOCUS_36800 667430 668215 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_36800 668956 668216 gene locus_tag LOCUS_36810 668956 668216 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831617.1 protein_id gnl|my_center|LOCUS_36810 669097 670545 gene locus_tag LOCUS_36820 gene lysS 669097 670545 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_36820 670660 671007 gene locus_tag LOCUS_36830 670660 671007 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_36830 671271 672260 gene locus_tag LOCUS_36840 671271 672260 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226862.1 protein_id gnl|my_center|LOCUS_36840 672257 673306 gene locus_tag LOCUS_36850 672257 673306 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_36850 673303 674109 gene locus_tag LOCUS_36860 673303 674109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_36860 674918 674118 gene locus_tag LOCUS_36870 674918 674118 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230450.1 protein_id gnl|my_center|LOCUS_36870 >Feature sequence06 1209 523 gene locus_tag LOCUS_36880 1209 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 1453 1611 gene locus_tag LOCUS_36890 1453 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 2618 1695 gene locus_tag LOCUS_36900 2618 1695 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_36900 3872 2661 gene locus_tag LOCUS_36910 gene manA 3872 2661 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229748.1 protein_id gnl|my_center|LOCUS_36910 4959 3883 gene locus_tag LOCUS_36920 4959 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283989.1 protein_id gnl|my_center|LOCUS_36920 5172 4966 gene locus_tag LOCUS_36930 5172 4966 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229750.1 protein_id gnl|my_center|LOCUS_36930 6527 5169 gene locus_tag LOCUS_36940 6527 5169 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_36940 6969 6610 gene locus_tag LOCUS_36950 6969 6610 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677666.1 protein_id gnl|my_center|LOCUS_36950 7073 7561 gene locus_tag LOCUS_36960 7073 7561 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559274.1 protein_id gnl|my_center|LOCUS_36960 10952 7683 gene locus_tag LOCUS_36970 10952 7683 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229754.1 protein_id gnl|my_center|LOCUS_36970 11345 11040 gene locus_tag LOCUS_36980 11345 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 11614 12366 gene locus_tag LOCUS_36990 11614 12366 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229755.1 protein_id gnl|my_center|LOCUS_36990 12391 13356 gene locus_tag LOCUS_37000 gene cofD 12391 13356 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222933.1 protein_id gnl|my_center|LOCUS_37000 13340 14683 gene locus_tag LOCUS_37010 13340 14683 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222932.1 protein_id gnl|my_center|LOCUS_37010 14680 15225 gene locus_tag LOCUS_37020 14680 15225 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_37020 15837 15445 gene locus_tag LOCUS_37030 15837 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 15994 17070 gene locus_tag LOCUS_37040 15994 17070 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222926.1 protein_id gnl|my_center|LOCUS_37040 17088 17978 gene locus_tag LOCUS_37050 17088 17978 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222927.1 protein_id gnl|my_center|LOCUS_37050 21151 17963 gene locus_tag LOCUS_37060 21151 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224774.1 protein_id gnl|my_center|LOCUS_37060 22043 21192 gene locus_tag LOCUS_37070 22043 21192 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742156.1 protein_id gnl|my_center|LOCUS_37070 23180 22107 gene locus_tag LOCUS_37080 23180 22107 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_37080 24348 23314 gene locus_tag LOCUS_37090 24348 23314 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222922.1 protein_id gnl|my_center|LOCUS_37090 24399 25289 gene locus_tag LOCUS_37100 24399 25289 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742155.1 protein_id gnl|my_center|LOCUS_37100 25455 25856 gene locus_tag LOCUS_37110 25455 25856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 25904 28396 gene locus_tag LOCUS_37120 25904 28396 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222920.1 protein_id gnl|my_center|LOCUS_37120 28389 29474 gene locus_tag LOCUS_37130 28389 29474 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_37130 29830 29582 gene locus_tag LOCUS_37140 29830 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 29860 30300 gene locus_tag LOCUS_37150 29860 30300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 31533 30640 gene locus_tag LOCUS_37160 gene rfbD 31533 30640 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_37160 32525 31533 gene locus_tag LOCUS_37170 gene rfbB 32525 31533 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_37170 32696 34228 gene locus_tag LOCUS_37180 32696 34228 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222916.1 protein_id gnl|my_center|LOCUS_37180 34314 35501 gene locus_tag LOCUS_37190 34314 35501 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876538.1 protein_id gnl|my_center|LOCUS_37190 35694 36389 gene locus_tag LOCUS_37200 35694 36389 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222913.1 protein_id gnl|my_center|LOCUS_37200 36801 36394 gene locus_tag LOCUS_37210 36801 36394 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222912.1 protein_id gnl|my_center|LOCUS_37210 36946 37284 gene locus_tag LOCUS_37220 36946 37284 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_37220 37274 37753 gene locus_tag LOCUS_37230 37274 37753 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081306.1 protein_id gnl|my_center|LOCUS_37230 37855 38937 gene locus_tag LOCUS_37240 37855 38937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 40090 38927 gene locus_tag LOCUS_37250 40090 38927 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222907.1 protein_id gnl|my_center|LOCUS_37250 40649 40143 gene locus_tag LOCUS_37260 gene purE 40649 40143 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_37260 41809 40646 gene locus_tag LOCUS_37270 41809 40646 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222902.1 protein_id gnl|my_center|LOCUS_37270 42989 41994 gene locus_tag LOCUS_37280 42989 41994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192779382.1 protein_id gnl|my_center|LOCUS_37280 43861 42986 gene locus_tag LOCUS_37290 43861 42986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227650.1 protein_id gnl|my_center|LOCUS_37290 44271 43858 gene locus_tag LOCUS_37300 44271 43858 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284752.1 protein_id gnl|my_center|LOCUS_37300 45180 44455 gene locus_tag LOCUS_37310 45180 44455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222899.1 protein_id gnl|my_center|LOCUS_37310 45410 47680 gene locus_tag LOCUS_37320 45410 47680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 45776 45691 gene locus_tag LOCUS_t00380 45776 45691 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 47714 48232 gene locus_tag LOCUS_37330 47714 48232 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286038.1 protein_id gnl|my_center|LOCUS_37330 48269 48820 gene locus_tag LOCUS_37340 48269 48820 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286038.1 protein_id gnl|my_center|LOCUS_37340 49593 48829 gene locus_tag LOCUS_37350 gene hisN 49593 48829 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_37350 49663 50319 gene locus_tag LOCUS_37360 49663 50319 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222890.1 protein_id gnl|my_center|LOCUS_37360 50319 51593 gene locus_tag LOCUS_37370 50319 51593 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222891.1 protein_id gnl|my_center|LOCUS_37370 51906 51580 gene locus_tag LOCUS_37380 51906 51580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105220.1 protein_id gnl|my_center|LOCUS_37380 54572 51903 gene locus_tag LOCUS_37390 54572 51903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 54895 54587 gene locus_tag LOCUS_37400 54895 54587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 55461 54892 gene locus_tag LOCUS_37410 55461 54892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 56141 55458 gene locus_tag LOCUS_37420 56141 55458 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878897.1 protein_id gnl|my_center|LOCUS_37420 56266 56138 gene locus_tag LOCUS_37430 56266 56138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 57200 56271 gene locus_tag LOCUS_37440 57200 56271 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_37440 57717 57187 gene locus_tag LOCUS_37450 57717 57187 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222885.1 protein_id gnl|my_center|LOCUS_37450 58544 57756 gene locus_tag LOCUS_37460 58544 57756 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286032.1 protein_id gnl|my_center|LOCUS_37460 58804 60435 gene locus_tag LOCUS_37470 58804 60435 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222858.1 protein_id gnl|my_center|LOCUS_37470 60432 60644 gene locus_tag LOCUS_37480 60432 60644 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222857.1 protein_id gnl|my_center|LOCUS_37480 61247 60810 gene locus_tag LOCUS_37490 61247 60810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 61373 61981 gene locus_tag LOCUS_37500 61373 61981 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222850.1 protein_id gnl|my_center|LOCUS_37500 62160 63482 gene locus_tag LOCUS_37510 62160 63482 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286026.1 protein_id gnl|my_center|LOCUS_37510 64234 63608 gene locus_tag LOCUS_37520 64234 63608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 64399 66189 gene locus_tag LOCUS_37530 64399 66189 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080774.1 protein_id gnl|my_center|LOCUS_37530 66200 66580 gene locus_tag LOCUS_37540 66200 66580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 66577 67449 gene locus_tag LOCUS_37550 66577 67449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 67461 67901 gene locus_tag LOCUS_37560 67461 67901 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222842.1 protein_id gnl|my_center|LOCUS_37560 67923 68492 gene locus_tag LOCUS_37570 67923 68492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 68610 68987 gene locus_tag LOCUS_37580 68610 68987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 69016 70335 gene locus_tag LOCUS_37590 69016 70335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 70335 71132 gene locus_tag LOCUS_37600 70335 71132 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_37600 71219 72172 gene locus_tag LOCUS_37610 71219 72172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222830.1 protein_id gnl|my_center|LOCUS_37610 72729 72274 gene locus_tag LOCUS_37620 72729 72274 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417219.1 protein_id gnl|my_center|LOCUS_37620 72861 74264 gene locus_tag LOCUS_37630 72861 74264 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 protein_id gnl|my_center|LOCUS_37630 75818 74313 gene locus_tag LOCUS_37640 gene glpK 75818 74313 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222837.1 protein_id gnl|my_center|LOCUS_37640 76573 75833 gene locus_tag LOCUS_37650 76573 75833 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742072.1 protein_id gnl|my_center|LOCUS_37650 76743 78473 gene locus_tag LOCUS_37660 76743 78473 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 protein_id gnl|my_center|LOCUS_37660 79783 78521 gene locus_tag LOCUS_37670 79783 78521 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222829.1 protein_id gnl|my_center|LOCUS_37670 80946 79780 gene locus_tag LOCUS_37680 80946 79780 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727837.1 protein_id gnl|my_center|LOCUS_37680 81459 81157 gene locus_tag LOCUS_37690 81459 81157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 82569 81568 gene locus_tag LOCUS_37700 gene meaB 82569 81568 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_37700 84757 82562 gene locus_tag LOCUS_37710 gene scpA 84757 82562 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_37710 86685 84754 gene locus_tag LOCUS_37720 86685 84754 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_37720 86788 88479 gene locus_tag LOCUS_37730 86788 88479 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222824.1 protein_id gnl|my_center|LOCUS_37730 88534 89364 gene locus_tag LOCUS_37740 88534 89364 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_37740 89361 90977 gene locus_tag LOCUS_37750 89361 90977 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222818.1 protein_id gnl|my_center|LOCUS_37750 91313 90981 gene locus_tag LOCUS_37760 91313 90981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 91496 91948 gene locus_tag LOCUS_37770 91496 91948 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414091.1 protein_id gnl|my_center|LOCUS_37770 92928 91945 gene locus_tag LOCUS_37780 92928 91945 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086853184.1 protein_id gnl|my_center|LOCUS_37780 93926 92940 gene locus_tag LOCUS_37790 93926 92940 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086853184.1 protein_id gnl|my_center|LOCUS_37790 94315 93932 gene locus_tag LOCUS_37800 94315 93932 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222802.1 protein_id gnl|my_center|LOCUS_37800 94749 94366 gene locus_tag LOCUS_37810 94749 94366 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_37810 95419 95213 gene locus_tag LOCUS_37820 95419 95213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 95495 96088 gene locus_tag LOCUS_37830 95495 96088 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_37830 97458 96166 gene locus_tag LOCUS_37840 97458 96166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 97687 98526 gene locus_tag LOCUS_37850 97687 98526 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230013.1 protein_id gnl|my_center|LOCUS_37850 99251 98676 gene locus_tag LOCUS_37860 gene upp 99251 98676 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222797.1 protein_id gnl|my_center|LOCUS_37860 99332 101155 gene locus_tag LOCUS_37870 99332 101155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37870 101146 101589 gene locus_tag LOCUS_37880 101146 101589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37880 101591 102571 gene locus_tag LOCUS_37890 101591 102571 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_37890 102776 102943 gene locus_tag LOCUS_37900 102776 102943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 102940 103389 gene locus_tag LOCUS_37910 102940 103389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 103414 104061 gene locus_tag LOCUS_37920 103414 104061 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878216.1 protein_id gnl|my_center|LOCUS_37920 104213 105178 gene locus_tag LOCUS_37930 gene deoC 104213 105178 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_37930 105180 106607 gene locus_tag LOCUS_37940 105180 106607 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_37940 106600 107466 gene locus_tag LOCUS_37950 106600 107466 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_37950 108037 107489 gene locus_tag LOCUS_37960 108037 107489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229939.1 protein_id gnl|my_center|LOCUS_37960 109359 108034 gene locus_tag LOCUS_37970 109359 108034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845201.1 protein_id gnl|my_center|LOCUS_37970 110144 109356 gene locus_tag LOCUS_37980 110144 109356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229941.1 protein_id gnl|my_center|LOCUS_37980 110920 110159 gene locus_tag LOCUS_37990 110920 110159 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229942.1 protein_id gnl|my_center|LOCUS_37990 111438 110917 gene locus_tag LOCUS_38000 111438 110917 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229943.1 protein_id gnl|my_center|LOCUS_38000 112884 111493 gene locus_tag LOCUS_38010 112884 111493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 113555 112977 gene locus_tag LOCUS_38020 113555 112977 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 protein_id gnl|my_center|LOCUS_38020 114170 113574 gene locus_tag LOCUS_38030 114170 113574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 114802 114266 gene locus_tag LOCUS_38040 114802 114266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 114847 115284 gene locus_tag LOCUS_38050 114847 115284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 115286 116443 gene locus_tag LOCUS_38060 115286 116443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 116448 116825 gene locus_tag LOCUS_38070 116448 116825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 116822 117337 gene locus_tag LOCUS_38080 116822 117337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 117402 118616 gene locus_tag LOCUS_38090 117402 118616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222777.1 protein_id gnl|my_center|LOCUS_38090 119775 118705 gene locus_tag LOCUS_38100 119775 118705 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222775.1 protein_id gnl|my_center|LOCUS_38100 120199 121392 gene locus_tag LOCUS_38110 120199 121392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222774.1 protein_id gnl|my_center|LOCUS_38110 122894 121620 gene locus_tag LOCUS_38120 122894 121620 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_38120 123280 122891 gene locus_tag LOCUS_38130 123280 122891 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839697.1 protein_id gnl|my_center|LOCUS_38130 124538 123273 gene locus_tag LOCUS_38140 124538 123273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222771.1 protein_id gnl|my_center|LOCUS_38140 125605 124535 gene locus_tag LOCUS_38150 125605 124535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_38150 127146 125605 gene locus_tag LOCUS_38160 127146 125605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222769.1 protein_id gnl|my_center|LOCUS_38160 128541 127411 gene locus_tag LOCUS_38170 128541 127411 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_38170 128913 129434 gene locus_tag LOCUS_38180 128913 129434 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125312767.1 protein_id gnl|my_center|LOCUS_38180 129452 131110 gene locus_tag LOCUS_38190 129452 131110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 131135 146242 gene locus_tag LOCUS_38200 131135 146242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 146297 147556 gene locus_tag LOCUS_38210 146297 147556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 147831 148256 gene locus_tag LOCUS_38220 gene sdhC 147831 148256 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222765.1 protein_id gnl|my_center|LOCUS_38220 148259 148672 gene locus_tag LOCUS_38230 148259 148672 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222764.1 protein_id gnl|my_center|LOCUS_38230 148697 150448 gene locus_tag LOCUS_38240 gene sdhA 148697 150448 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222763.1 protein_id gnl|my_center|LOCUS_38240 150448 151230 gene locus_tag LOCUS_38250 150448 151230 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222762.1 protein_id gnl|my_center|LOCUS_38250 152652 151429 gene locus_tag LOCUS_38260 152652 151429 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222758.1 protein_id gnl|my_center|LOCUS_38260 152770 153015 gene locus_tag LOCUS_38270 152770 153015 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222759.1 protein_id gnl|my_center|LOCUS_38270 153041 153385 gene locus_tag LOCUS_38280 153041 153385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 154399 153389 gene locus_tag LOCUS_38290 gene yhjD 154399 153389 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222755.1 protein_id gnl|my_center|LOCUS_38290 155408 154425 gene locus_tag LOCUS_38300 gene trpS 155408 154425 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_38300 155805 155518 gene locus_tag LOCUS_38310 155805 155518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 158487 155968 gene locus_tag LOCUS_38320 158487 155968 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009479.1 protein_id gnl|my_center|LOCUS_38320 160110 158569 gene locus_tag LOCUS_38330 160110 158569 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_38330 159992 160282 gene locus_tag LOCUS_38340 159992 160282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 160562 160290 gene locus_tag LOCUS_38350 160562 160290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 161403 160597 gene locus_tag LOCUS_38360 161403 160597 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_38360 161631 161413 gene locus_tag LOCUS_38370 161631 161413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 161958 161644 gene locus_tag LOCUS_38380 161958 161644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 163352 162132 gene locus_tag LOCUS_38390 163352 162132 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_38390 163661 164443 gene locus_tag LOCUS_38400 163661 164443 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_38400 164586 165065 gene locus_tag LOCUS_38410 164586 165065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 165330 165073 gene locus_tag LOCUS_38420 165330 165073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_38420 165545 165472 gene locus_tag LOCUS_t00390 165545 165472 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 165604 166719 gene locus_tag LOCUS_38430 165604 166719 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225217.1 protein_id gnl|my_center|LOCUS_38430 168055 166712 gene locus_tag LOCUS_38440 168055 166712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 168222 168365 gene locus_tag LOCUS_38450 168222 168365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 168396 168989 gene locus_tag LOCUS_38460 168396 168989 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222739.1 protein_id gnl|my_center|LOCUS_38460 168999 170585 gene locus_tag LOCUS_38470 168999 170585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 171724 170519 gene locus_tag LOCUS_38480 171724 170519 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222736.1 protein_id gnl|my_center|LOCUS_38480 171846 172163 gene locus_tag LOCUS_38490 171846 172163 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222735.1 protein_id gnl|my_center|LOCUS_38490 172160 172546 gene locus_tag LOCUS_38500 172160 172546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 172599 173375 gene locus_tag LOCUS_38510 172599 173375 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804600.1 protein_id gnl|my_center|LOCUS_38510 173368 174165 gene locus_tag LOCUS_38520 173368 174165 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_38520 174162 175112 gene locus_tag LOCUS_38530 174162 175112 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804598.1 protein_id gnl|my_center|LOCUS_38530 175151 175546 gene locus_tag LOCUS_38540 175151 175546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 175614 175838 gene locus_tag LOCUS_38550 175614 175838 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_38550 176056 175760 gene locus_tag LOCUS_38560 176056 175760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 177110 176295 gene locus_tag LOCUS_38570 177110 176295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 178149 177160 gene locus_tag LOCUS_38580 178149 177160 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_38580 178299 178892 gene locus_tag LOCUS_38590 178299 178892 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222730.1 protein_id gnl|my_center|LOCUS_38590 181533 178942 gene locus_tag LOCUS_38600 181533 178942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 183109 181607 gene locus_tag LOCUS_38610 183109 181607 CDS product TNT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231048.1 protein_id gnl|my_center|LOCUS_38610 183582 183106 gene locus_tag LOCUS_38620 183582 183106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 189790 183545 gene locus_tag LOCUS_38630 189790 183545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 190113 189802 gene locus_tag LOCUS_38640 190113 189802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231041.1 protein_id gnl|my_center|LOCUS_38640 190562 190110 gene locus_tag LOCUS_38650 190562 190110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 190723 191922 gene locus_tag LOCUS_38660 190723 191922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230552.1 protein_id gnl|my_center|LOCUS_38660 191915 192847 gene locus_tag LOCUS_38670 191915 192847 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739818.1 protein_id gnl|my_center|LOCUS_38670 192852 193709 gene locus_tag LOCUS_38680 192852 193709 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950877.1 protein_id gnl|my_center|LOCUS_38680 193720 194022 gene locus_tag LOCUS_38690 193720 194022 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222733.1 protein_id gnl|my_center|LOCUS_38690 194536 193997 gene locus_tag LOCUS_38700 194536 193997 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_38700 194663 195226 gene locus_tag LOCUS_38710 194663 195226 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_38710 198862 195560 gene locus_tag LOCUS_38720 198862 195560 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222728.1 protein_id gnl|my_center|LOCUS_38720 199092 198862 gene locus_tag LOCUS_38730 199092 198862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 200720 199092 gene locus_tag LOCUS_38740 200720 199092 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285994.1 protein_id gnl|my_center|LOCUS_38740 201653 200724 gene locus_tag LOCUS_38750 201653 200724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 201839 202597 gene locus_tag LOCUS_38760 201839 202597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222721.1 protein_id gnl|my_center|LOCUS_38760 204230 202647 gene locus_tag LOCUS_38770 gene purH 204230 202647 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_38770 204889 204227 gene locus_tag LOCUS_38780 gene purN 204889 204227 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222719.1 protein_id gnl|my_center|LOCUS_38780 206417 204918 gene locus_tag LOCUS_38790 206417 204918 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222718.1 protein_id gnl|my_center|LOCUS_38790 207179 206526 gene locus_tag LOCUS_38800 207179 206526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 208255 207365 gene locus_tag LOCUS_38810 gene sucD 208255 207365 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222716.1 protein_id gnl|my_center|LOCUS_38810 209427 208258 gene locus_tag LOCUS_38820 gene sucC 209427 208258 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_38820 211218 209668 gene locus_tag LOCUS_38830 211218 209668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 211409 212383 gene locus_tag LOCUS_38840 211409 212383 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_38840 212725 213393 gene locus_tag LOCUS_38850 212725 213393 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222712.1 protein_id gnl|my_center|LOCUS_38850 216078 213757 gene locus_tag LOCUS_38860 gene pcrA 216078 213757 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222711.1 protein_id gnl|my_center|LOCUS_38860 216295 216555 gene locus_tag LOCUS_38870 216295 216555 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222709.1 protein_id gnl|my_center|LOCUS_38870 217612 216524 gene locus_tag LOCUS_38880 217612 216524 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113816.1 protein_id gnl|my_center|LOCUS_38880 217677 217991 gene locus_tag LOCUS_38890 217677 217991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222708.1 protein_id gnl|my_center|LOCUS_38890 218199 219086 gene locus_tag LOCUS_38900 218199 219086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 219249 220034 gene locus_tag LOCUS_38910 219249 220034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 220193 221146 gene locus_tag LOCUS_38920 220193 221146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 221502 222854 gene locus_tag LOCUS_38930 221502 222854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 223029 224576 gene locus_tag LOCUS_38940 223029 224576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38940 225487 224594 gene locus_tag LOCUS_38950 225487 224594 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_38950 225597 226541 gene locus_tag LOCUS_38960 225597 226541 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222702.1 protein_id gnl|my_center|LOCUS_38960 226737 227147 gene locus_tag LOCUS_38970 226737 227147 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227152.1 protein_id gnl|my_center|LOCUS_38970 227183 228523 gene locus_tag LOCUS_38980 227183 228523 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230071.1 protein_id gnl|my_center|LOCUS_38980 229215 228565 gene locus_tag LOCUS_38990 229215 228565 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_38990 230444 229212 gene locus_tag LOCUS_39000 230444 229212 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222700.1 protein_id gnl|my_center|LOCUS_39000 230525 231796 gene locus_tag LOCUS_39010 230525 231796 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222697.1 protein_id gnl|my_center|LOCUS_39010 231789 231992 gene locus_tag LOCUS_39020 231789 231992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 233665 232106 gene locus_tag LOCUS_39030 gene guaA 233665 232106 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222695.1 protein_id gnl|my_center|LOCUS_39030 233717 234433 gene locus_tag LOCUS_39040 233717 234433 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451301.1 protein_id gnl|my_center|LOCUS_39040 234881 236215 gene locus_tag LOCUS_39050 234881 236215 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222691.1 protein_id gnl|my_center|LOCUS_39050 236780 236205 gene locus_tag LOCUS_39060 236780 236205 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222346.1 protein_id gnl|my_center|LOCUS_39060 236847 237587 gene locus_tag LOCUS_39070 236847 237587 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060018.1 protein_id gnl|my_center|LOCUS_39070 237584 238921 gene locus_tag LOCUS_39080 237584 238921 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027365.1 protein_id gnl|my_center|LOCUS_39080 240158 238896 gene locus_tag LOCUS_39090 240158 238896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 241147 240188 gene locus_tag LOCUS_39100 241147 240188 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227077.1 protein_id gnl|my_center|LOCUS_39100 242996 241167 gene locus_tag LOCUS_39110 242996 241167 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_39110 244138 243005 gene locus_tag LOCUS_39120 244138 243005 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222686.1 protein_id gnl|my_center|LOCUS_39120 245711 244200 gene locus_tag LOCUS_39130 gene guaB 245711 244200 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_39130 245838 246227 gene locus_tag LOCUS_39140 245838 246227 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 protein_id gnl|my_center|LOCUS_39140 247221 246280 gene locus_tag LOCUS_39150 247221 246280 CDS product anti-sigma-D factor RsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222682.1 protein_id gnl|my_center|LOCUS_39150 247794 247222 gene locus_tag LOCUS_39160 247794 247222 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468912.1 protein_id gnl|my_center|LOCUS_39160 248608 248129 gene locus_tag LOCUS_39170 248608 248129 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073605.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39170 249712 248807 gene locus_tag LOCUS_39180 249712 248807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222680.1 protein_id gnl|my_center|LOCUS_39180 251334 250327 gene locus_tag LOCUS_39190 251334 250327 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222679.1 protein_id gnl|my_center|LOCUS_39190 251524 251820 gene locus_tag LOCUS_39200 251524 251820 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_39200 253519 251891 gene locus_tag LOCUS_39210 gene groL 253519 251891 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222677.1 protein_id gnl|my_center|LOCUS_39210 253894 253601 gene locus_tag LOCUS_39220 gene groES 253894 253601 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_39220 254120 255637 gene locus_tag LOCUS_39230 254120 255637 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_39230 256498 255638 gene locus_tag LOCUS_39240 256498 255638 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028377.1 protein_id gnl|my_center|LOCUS_39240 256616 259618 gene locus_tag LOCUS_39250 256616 259618 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230443.1 protein_id gnl|my_center|LOCUS_39250 260697 259645 gene locus_tag LOCUS_39260 gene tsaD 260697 259645 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222664.1 protein_id gnl|my_center|LOCUS_39260 261148 260690 gene locus_tag LOCUS_39270 gene rimI 261148 260690 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222663.1 protein_id gnl|my_center|LOCUS_39270 261819 261145 gene locus_tag LOCUS_39280 gene tsaB 261819 261145 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222662.1 protein_id gnl|my_center|LOCUS_39280 261891 262262 gene locus_tag LOCUS_39290 261891 262262 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226817.1 protein_id gnl|my_center|LOCUS_39290 262662 263987 gene locus_tag LOCUS_39300 262662 263987 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222661.1 protein_id gnl|my_center|LOCUS_39300 263984 265198 gene locus_tag LOCUS_39310 263984 265198 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028357.1 protein_id gnl|my_center|LOCUS_39310 265661 265203 gene locus_tag LOCUS_39320 gene tsaE 265661 265203 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466589.1 protein_id gnl|my_center|LOCUS_39320 266761 265658 gene locus_tag LOCUS_39330 266761 265658 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285971.1 protein_id gnl|my_center|LOCUS_39330 267846 266758 gene locus_tag LOCUS_39340 gene alr 267846 266758 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222656.1 protein_id gnl|my_center|LOCUS_39340 269400 268057 gene locus_tag LOCUS_39350 269400 268057 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222652.1 protein_id gnl|my_center|LOCUS_39350 271443 269467 gene locus_tag LOCUS_39360 gene glmS 271443 269467 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 protein_id gnl|my_center|LOCUS_39360 271464 272279 gene locus_tag LOCUS_39370 271464 272279 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222650.1 protein_id gnl|my_center|LOCUS_39370 273333 272878 gene locus_tag LOCUS_39380 273333 272878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 276278 273330 gene locus_tag LOCUS_39390 276278 273330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 276580 276278 gene locus_tag LOCUS_39400 276580 276278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 277066 276752 gene locus_tag LOCUS_39410 277066 276752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 278427 277093 gene locus_tag LOCUS_39420 gene glmM 278427 277093 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_39420 279161 278544 gene locus_tag LOCUS_39430 279161 278544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 279601 279158 gene locus_tag LOCUS_39440 gene rplM 279601 279158 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_39440 280142 279855 gene locus_tag LOCUS_39450 280142 279855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 280525 280214 gene locus_tag LOCUS_39460 280525 280214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 281094 280672 gene locus_tag LOCUS_39470 281094 280672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 282907 281111 gene locus_tag LOCUS_39480 282907 281111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 285832 283082 gene locus_tag LOCUS_39490 285832 283082 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_39490 288537 285829 gene locus_tag LOCUS_39500 288537 285829 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_39500 290495 288600 gene locus_tag LOCUS_39510 290495 288600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 293279 290568 gene locus_tag LOCUS_39520 293279 290568 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_39520 296341 293618 gene locus_tag LOCUS_39530 296341 293618 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_39530 299109 296338 gene locus_tag LOCUS_39540 299109 296338 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_39540 303411 299407 gene locus_tag LOCUS_39550 303411 299407 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_39550 303732 305126 gene locus_tag LOCUS_39560 gene eccD 303732 305126 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_39560 305134 306606 gene locus_tag LOCUS_39570 gene mycP 305134 306606 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111995.1 protein_id gnl|my_center|LOCUS_39570 307761 306697 gene locus_tag LOCUS_39580 307761 306697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222632.1 protein_id gnl|my_center|LOCUS_39580 308117 307761 gene locus_tag LOCUS_39590 308117 307761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304771.1 protein_id gnl|my_center|LOCUS_39590 309834 308191 gene locus_tag LOCUS_39600 gene eccB 309834 308191 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081911197.1 protein_id gnl|my_center|LOCUS_39600 310036 311301 gene locus_tag LOCUS_39610 gene eccE 310036 311301 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304772.1 protein_id gnl|my_center|LOCUS_39610 311298 312020 gene locus_tag LOCUS_39620 311298 312020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222627.1 protein_id gnl|my_center|LOCUS_39620 312271 313839 gene locus_tag LOCUS_39630 312271 313839 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027742.1 protein_id gnl|my_center|LOCUS_39630 313989 314612 gene locus_tag LOCUS_39640 313989 314612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 315683 314616 gene locus_tag LOCUS_39650 315683 314616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 315676 316470 gene locus_tag LOCUS_39660 315676 316470 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_39660 316479 317402 gene locus_tag LOCUS_39670 316479 317402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 318159 317368 gene locus_tag LOCUS_39680 gene truA 318159 317368 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112002.1 protein_id gnl|my_center|LOCUS_39680 318827 318219 gene locus_tag LOCUS_39690 gene rplQ 318827 318219 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222625.1 protein_id gnl|my_center|LOCUS_39690 319938 318886 gene locus_tag LOCUS_39700 319938 318886 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558887.1 protein_id gnl|my_center|LOCUS_39700 320686 320081 gene locus_tag LOCUS_39710 gene rpsD 320686 320081 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222624.1 protein_id gnl|my_center|LOCUS_39710 321117 320710 gene locus_tag LOCUS_39720 gene rpsK 321117 320710 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_39720 321535 321155 gene locus_tag LOCUS_39730 gene rpsM 321535 321155 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285908.1 protein_id gnl|my_center|LOCUS_39730 322144 321923 gene locus_tag LOCUS_39740 gene infA 322144 321923 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_39740 322693 322304 gene locus_tag LOCUS_39750 322693 322304 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 protein_id gnl|my_center|LOCUS_39750 323302 322739 gene locus_tag LOCUS_39760 323302 322739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 324170 323352 gene locus_tag LOCUS_39770 gene map 324170 323352 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_39770 324739 324188 gene locus_tag LOCUS_39780 324739 324188 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222620.1 protein_id gnl|my_center|LOCUS_39780 326049 324739 gene locus_tag LOCUS_39790 gene secY 326049 324739 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 protein_id gnl|my_center|LOCUS_39790 326900 326304 gene locus_tag LOCUS_39800 326900 326304 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222618.1 protein_id gnl|my_center|LOCUS_39800 327550 327107 gene locus_tag LOCUS_39810 gene rplO 327550 327107 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222616.1 protein_id gnl|my_center|LOCUS_39810 327732 327547 gene locus_tag LOCUS_39820 gene rpmD 327732 327547 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_39820 328340 327735 gene locus_tag LOCUS_39830 gene rpsE 328340 327735 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222614.1 protein_id gnl|my_center|LOCUS_39830 328773 328375 gene locus_tag LOCUS_39840 gene rplR 328773 328375 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_39840 329314 328775 gene locus_tag LOCUS_39850 gene rplF 329314 328775 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_39850 329730 329332 gene locus_tag LOCUS_39860 gene rpsH 329730 329332 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558871.1 protein_id gnl|my_center|LOCUS_39860 330042 329857 gene locus_tag LOCUS_39870 330042 329857 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_39870 330608 330045 gene locus_tag LOCUS_39880 gene rplE 330608 330045 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222611.1 protein_id gnl|my_center|LOCUS_39880 330922 330608 gene locus_tag LOCUS_39890 gene rplX 330922 330608 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_39890 331293 330925 gene locus_tag LOCUS_39900 gene rplN 331293 330925 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_39900 331690 331409 gene locus_tag LOCUS_39910 gene rpsQ 331690 331409 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_39910 331935 331687 gene locus_tag LOCUS_39920 gene rpmC 331935 331687 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222608.1 protein_id gnl|my_center|LOCUS_39920 332354 331935 gene locus_tag LOCUS_39930 gene rplP 332354 331935 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 protein_id gnl|my_center|LOCUS_39930 333188 332358 gene locus_tag LOCUS_39940 gene rpsC 333188 332358 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222607.1 protein_id gnl|my_center|LOCUS_39940 333604 333188 gene locus_tag LOCUS_39950 gene rplV 333604 333188 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222606.1 protein_id gnl|my_center|LOCUS_39950 333921 333640 gene locus_tag LOCUS_39960 gene rpsS 333921 333640 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_39960 334776 333940 gene locus_tag LOCUS_39970 gene rplB 334776 333940 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102084.1 protein_id gnl|my_center|LOCUS_39970 335098 334799 gene locus_tag LOCUS_39980 gene rplW 335098 334799 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102087.1 protein_id gnl|my_center|LOCUS_39980 335787 335095 gene locus_tag LOCUS_39990 gene rplD 335787 335095 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_39990 336440 335790 gene locus_tag LOCUS_40000 gene rplC 336440 335790 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222604.1 protein_id gnl|my_center|LOCUS_40000 336852 336493 gene locus_tag LOCUS_40010 gene rpsJ 336852 336493 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102098.1 protein_id gnl|my_center|LOCUS_40010 338319 337126 gene locus_tag LOCUS_40020 gene tuf 338319 337126 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_40020 340561 338459 gene locus_tag LOCUS_40030 gene fusA 340561 338459 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222602.1 protein_id gnl|my_center|LOCUS_40030 341126 340656 gene locus_tag LOCUS_40040 gene rpsG 341126 340656 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102106.1 protein_id gnl|my_center|LOCUS_40040 341500 341126 gene locus_tag LOCUS_40050 gene rpsL 341500 341126 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_40050 341986 342882 gene locus_tag LOCUS_40060 341986 342882 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027843.1 protein_id gnl|my_center|LOCUS_40060 342921 343217 gene locus_tag LOCUS_40070 342921 343217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 343314 343754 gene locus_tag LOCUS_40080 343314 343754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 343913 344188 gene locus_tag LOCUS_40090 343913 344188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 348307 344411 gene locus_tag LOCUS_40100 348307 344411 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222587.1 protein_id gnl|my_center|LOCUS_40100 351883 348401 gene locus_tag LOCUS_40110 351883 348401 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222586.1 protein_id gnl|my_center|LOCUS_40110 353378 352365 gene locus_tag LOCUS_40120 353378 352365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 353924 353397 gene locus_tag LOCUS_40130 353924 353397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229365.1 protein_id gnl|my_center|LOCUS_40130 355172 353937 gene locus_tag LOCUS_40140 355172 353937 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222539.1 protein_id gnl|my_center|LOCUS_40140 356326 355169 gene locus_tag LOCUS_40150 356326 355169 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222538.1 protein_id gnl|my_center|LOCUS_40150 357492 356323 gene locus_tag LOCUS_40160 357492 356323 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222537.1 protein_id gnl|my_center|LOCUS_40160 358522 357494 gene locus_tag LOCUS_40170 358522 357494 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222536.1 protein_id gnl|my_center|LOCUS_40170 359547 358519 gene locus_tag LOCUS_40180 359547 358519 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222535.1 protein_id gnl|my_center|LOCUS_40180 360872 359544 gene locus_tag LOCUS_40190 360872 359544 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224301.1 protein_id gnl|my_center|LOCUS_40190 361708 360869 gene locus_tag LOCUS_40200 361708 360869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223674.1 protein_id gnl|my_center|LOCUS_40200 362495 361710 gene locus_tag LOCUS_40210 362495 361710 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223675.1 protein_id gnl|my_center|LOCUS_40210 363565 362492 gene locus_tag LOCUS_40220 363565 362492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222531.1 protein_id gnl|my_center|LOCUS_40220 364215 363826 gene locus_tag LOCUS_40230 gene rplL 364215 363826 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222530.1 protein_id gnl|my_center|LOCUS_40230 364836 364279 gene locus_tag LOCUS_40240 gene rplJ 364836 364279 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055400.1 protein_id gnl|my_center|LOCUS_40240 365098 365862 gene locus_tag LOCUS_40250 365098 365862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 366640 365924 gene locus_tag LOCUS_40260 gene rplA 366640 365924 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222526.1 protein_id gnl|my_center|LOCUS_40260 367152 366718 gene locus_tag LOCUS_40270 gene rplK 367152 366718 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222525.1 protein_id gnl|my_center|LOCUS_40270 368157 367252 gene locus_tag LOCUS_40280 gene nusG 368157 367252 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222524.1 protein_id gnl|my_center|LOCUS_40280 368626 368222 gene locus_tag LOCUS_40290 gene secE 368626 368222 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222523.1 protein_id gnl|my_center|LOCUS_40290 368730 368657 gene locus_tag LOCUS_t00400 368730 368657 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 368919 370160 gene locus_tag LOCUS_40300 368919 370160 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_40300 370297 370731 gene locus_tag LOCUS_40310 370297 370731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 370842 371231 gene locus_tag LOCUS_40320 370842 371231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 371650 371228 gene locus_tag LOCUS_40330 371650 371228 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_40330 372096 371647 gene locus_tag LOCUS_40340 372096 371647 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_40340 372349 372185 gene locus_tag LOCUS_40350 gene rpmG 372349 372185 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_40350 372640 372567 gene locus_tag LOCUS_t00410 372640 372567 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 372757 372684 gene locus_tag LOCUS_t00420 372757 372684 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 375430 372827 gene locus_tag LOCUS_40360 375430 372827 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222516.1 protein_id gnl|my_center|LOCUS_40360 376382 375606 gene locus_tag LOCUS_40370 376382 375606 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230233.1 protein_id gnl|my_center|LOCUS_40370 376413 377204 gene locus_tag LOCUS_40380 376413 377204 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222515.1 protein_id gnl|my_center|LOCUS_40380 377748 377263 gene locus_tag LOCUS_40390 377748 377263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 378020 378262 gene locus_tag LOCUS_40400 378020 378262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223616.1 protein_id gnl|my_center|LOCUS_40400 378672 378590 gene locus_tag LOCUS_t00430 378672 378590 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 378795 379286 gene locus_tag LOCUS_40410 378795 379286 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222510.1 protein_id gnl|my_center|LOCUS_40410 379283 380155 gene locus_tag LOCUS_40420 gene rfbA 379283 380155 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222507.1 protein_id gnl|my_center|LOCUS_40420 381015 380152 gene locus_tag LOCUS_40430 gene htpX 381015 380152 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222504.1 protein_id gnl|my_center|LOCUS_40430 381511 381035 gene locus_tag LOCUS_40440 381511 381035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 382097 381504 gene locus_tag LOCUS_40450 382097 381504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40450 382498 382094 gene locus_tag LOCUS_40460 382498 382094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 382756 383793 gene locus_tag LOCUS_40470 382756 383793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 383979 383812 gene locus_tag LOCUS_40480 383979 383812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 384840 384076 gene locus_tag LOCUS_40490 384840 384076 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_40490 384903 385475 gene locus_tag LOCUS_40500 384903 385475 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831756.1 protein_id gnl|my_center|LOCUS_40500 386472 385594 gene locus_tag LOCUS_40510 386472 385594 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_40510 386548 386988 gene locus_tag LOCUS_40520 386548 386988 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261465.1 protein_id gnl|my_center|LOCUS_40520 386999 387760 gene locus_tag LOCUS_40530 386999 387760 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_40530 387980 389914 gene locus_tag LOCUS_40540 387980 389914 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_40540 389911 390966 gene locus_tag LOCUS_40550 389911 390966 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222471.1 protein_id gnl|my_center|LOCUS_40550 393268 391265 gene locus_tag LOCUS_40560 393268 391265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 393385 394308 gene locus_tag LOCUS_40570 gene rarD 393385 394308 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075908.1 protein_id gnl|my_center|LOCUS_40570 395460 394459 gene locus_tag LOCUS_40580 395460 394459 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_40580 397089 395482 gene locus_tag LOCUS_40590 gene nuoN 397089 395482 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222464.1 protein_id gnl|my_center|LOCUS_40590 398653 397091 gene locus_tag LOCUS_40600 398653 397091 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222463.1 protein_id gnl|my_center|LOCUS_40600 400617 398650 gene locus_tag LOCUS_40610 gene nuoL 400617 398650 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222462.1 protein_id gnl|my_center|LOCUS_40610 400927 400628 gene locus_tag LOCUS_40620 gene nuoK 400927 400628 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_40620 401766 400924 gene locus_tag LOCUS_40630 401766 400924 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222461.1 protein_id gnl|my_center|LOCUS_40630 402329 401763 gene locus_tag LOCUS_40640 gene nuoI 402329 401763 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_40640 403647 402316 gene locus_tag LOCUS_40650 gene nuoH 403647 402316 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222459.1 protein_id gnl|my_center|LOCUS_40650 406094 403644 gene locus_tag LOCUS_40660 406094 403644 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222458.1 protein_id gnl|my_center|LOCUS_40660 407179 406091 gene locus_tag LOCUS_40670 gene nuoF 407179 406091 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222457.1 protein_id gnl|my_center|LOCUS_40670 408171 407386 gene locus_tag LOCUS_40680 gene nuoE 408171 407386 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222456.1 protein_id gnl|my_center|LOCUS_40680 409550 408168 gene locus_tag LOCUS_40690 409550 408168 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_40690 410368 409568 gene locus_tag LOCUS_40700 410368 409568 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222454.1 protein_id gnl|my_center|LOCUS_40700 410923 410375 gene locus_tag LOCUS_40710 410923 410375 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_40710 411303 410938 gene locus_tag LOCUS_40720 411303 410938 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222453.1 protein_id gnl|my_center|LOCUS_40720 412926 411649 gene locus_tag LOCUS_40730 412926 411649 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285867.1 protein_id gnl|my_center|LOCUS_40730 413740 413051 gene locus_tag LOCUS_40740 413740 413051 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222451.1 protein_id gnl|my_center|LOCUS_40740 415117 414008 gene locus_tag LOCUS_40750 415117 414008 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_40750 416246 415131 gene locus_tag LOCUS_40760 416246 415131 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_40760 416379 417203 gene locus_tag LOCUS_40770 416379 417203 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222446.1 protein_id gnl|my_center|LOCUS_40770 417956 417321 gene locus_tag LOCUS_40780 417956 417321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 418988 417966 gene locus_tag LOCUS_40790 gene paaK 418988 417966 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838237.1 protein_id gnl|my_center|LOCUS_40790 419494 419000 gene locus_tag LOCUS_40800 gene paaJ 419494 419000 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_40800 420378 419488 gene locus_tag LOCUS_40810 gene paaC 420378 419488 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223465.1 protein_id gnl|my_center|LOCUS_40810 420659 420375 gene locus_tag LOCUS_40820 gene paaB 420659 420375 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_40820 421588 420656 gene locus_tag LOCUS_40830 gene paaA 421588 420656 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223463.1 protein_id gnl|my_center|LOCUS_40830 422022 421630 gene locus_tag LOCUS_40840 422022 421630 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222445.1 protein_id gnl|my_center|LOCUS_40840 422215 423384 gene locus_tag LOCUS_40850 422215 423384 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_40850 423584 423390 gene locus_tag LOCUS_40860 423584 423390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 425475 423979 gene locus_tag LOCUS_40870 425475 423979 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222444.1 protein_id gnl|my_center|LOCUS_40870 427156 425531 gene locus_tag LOCUS_40880 gene menD 427156 425531 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_40880 427241 428164 gene locus_tag LOCUS_40890 427241 428164 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222442.1 protein_id gnl|my_center|LOCUS_40890 428164 429228 gene locus_tag LOCUS_40900 gene menE 428164 429228 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_40900 429360 430556 gene locus_tag LOCUS_40910 429360 430556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223425.1 protein_id gnl|my_center|LOCUS_40910 430611 431483 gene locus_tag LOCUS_40920 430611 431483 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_40920 431558 432217 gene locus_tag LOCUS_40930 431558 432217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 432596 432198 gene locus_tag LOCUS_40940 432596 432198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 433720 432671 gene locus_tag LOCUS_40950 433720 432671 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_40950 433789 434781 gene locus_tag LOCUS_40960 433789 434781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 435805 434804 gene locus_tag LOCUS_40970 435805 434804 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_40970 435938 436261 gene locus_tag LOCUS_40980 435938 436261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 436258 436569 gene locus_tag LOCUS_40990 436258 436569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 436814 436575 gene locus_tag LOCUS_41000 436814 436575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 437310 436843 gene locus_tag LOCUS_41010 437310 436843 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466559.1 protein_id gnl|my_center|LOCUS_41010 437438 437695 gene locus_tag LOCUS_41020 437438 437695 CDS product BldC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081896.1 protein_id gnl|my_center|LOCUS_41020 437748 437927 gene locus_tag LOCUS_41030 437748 437927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222436.1 protein_id gnl|my_center|LOCUS_41030 439406 437991 gene locus_tag LOCUS_41040 439406 437991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 440507 439563 gene locus_tag LOCUS_41050 gene ccsB 440507 439563 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222434.1 protein_id gnl|my_center|LOCUS_41050 442102 440507 gene locus_tag LOCUS_41060 442102 440507 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222433.1 protein_id gnl|my_center|LOCUS_41060 442902 442102 gene locus_tag LOCUS_41070 442902 442102 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222432.1 protein_id gnl|my_center|LOCUS_41070 443061 444023 gene locus_tag LOCUS_41080 443061 444023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 444593 444027 gene locus_tag LOCUS_41090 444593 444027 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222431.1 protein_id gnl|my_center|LOCUS_41090 445234 444605 gene locus_tag LOCUS_41100 445234 444605 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_41100 446541 445231 gene locus_tag LOCUS_41110 gene hemL 446541 445231 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_41110 446933 446538 gene locus_tag LOCUS_41120 446933 446538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 447378 446923 gene locus_tag LOCUS_41130 447378 446923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222422.1 protein_id gnl|my_center|LOCUS_41130 447955 447386 gene locus_tag LOCUS_41140 447955 447386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 448566 447952 gene locus_tag LOCUS_41150 448566 447952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225070.1 protein_id gnl|my_center|LOCUS_41150 448985 448584 gene locus_tag LOCUS_41160 448985 448584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 449599 448982 gene locus_tag LOCUS_41170 449599 448982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 450270 449683 gene locus_tag LOCUS_41180 450270 449683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 451244 450267 gene locus_tag LOCUS_41190 gene hemB 451244 450267 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_41190 453198 451651 gene locus_tag LOCUS_41200 453198 451651 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222417.1 protein_id gnl|my_center|LOCUS_41200 454154 453198 gene locus_tag LOCUS_41210 gene hemC 454154 453198 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222416.1 protein_id gnl|my_center|LOCUS_41210 455473 454151 gene locus_tag LOCUS_41220 455473 454151 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222415.1 protein_id gnl|my_center|LOCUS_41220 456278 455508 gene locus_tag LOCUS_41230 456278 455508 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222414.1 protein_id gnl|my_center|LOCUS_41230 457939 456446 gene locus_tag LOCUS_41240 457939 456446 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 protein_id gnl|my_center|LOCUS_41240 458214 457999 gene locus_tag LOCUS_41250 458214 457999 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222412.1 protein_id gnl|my_center|LOCUS_41250 459737 458241 gene locus_tag LOCUS_41260 459737 458241 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222411.1 protein_id gnl|my_center|LOCUS_41260 460002 460562 gene locus_tag LOCUS_41270 460002 460562 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_41270 460663 461769 gene locus_tag LOCUS_41280 460663 461769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 461809 462696 gene locus_tag LOCUS_41290 461809 462696 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878084.1 protein_id gnl|my_center|LOCUS_41290 463707 462706 gene locus_tag LOCUS_41300 463707 462706 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222404.1 protein_id gnl|my_center|LOCUS_41300 464777 463740 gene locus_tag LOCUS_41310 464777 463740 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_41310 465415 465212 gene locus_tag LOCUS_41320 465415 465212 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222402.1 protein_id gnl|my_center|LOCUS_41320 466348 465536 gene locus_tag LOCUS_41330 gene proC 466348 465536 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222401.1 protein_id gnl|my_center|LOCUS_41330 467204 466398 gene locus_tag LOCUS_41340 467204 466398 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222400.1 protein_id gnl|my_center|LOCUS_41340 468133 467213 gene locus_tag LOCUS_41350 468133 467213 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_41350 469053 468268 gene locus_tag LOCUS_41360 469053 468268 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742120.1 protein_id gnl|my_center|LOCUS_41360 470273 469050 gene locus_tag LOCUS_41370 470273 469050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 471181 470273 gene locus_tag LOCUS_41380 471181 470273 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222397.1 protein_id gnl|my_center|LOCUS_41380 471991 471311 gene locus_tag LOCUS_41390 471991 471311 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222396.1 protein_id gnl|my_center|LOCUS_41390 473187 471988 gene locus_tag LOCUS_41400 473187 471988 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285858.1 protein_id gnl|my_center|LOCUS_41400 473487 473296 gene locus_tag LOCUS_41410 473487 473296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 474267 473521 gene locus_tag LOCUS_41420 474267 473521 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_41420 474639 474382 gene locus_tag LOCUS_41430 474639 474382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 476366 474801 gene locus_tag LOCUS_41440 476366 474801 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 protein_id gnl|my_center|LOCUS_41440 477677 476787 gene locus_tag LOCUS_41450 477677 476787 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742052.1 protein_id gnl|my_center|LOCUS_41450 478228 477746 gene locus_tag LOCUS_41460 478228 477746 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 protein_id gnl|my_center|LOCUS_41460 479478 478225 gene locus_tag LOCUS_41470 gene mshA 479478 478225 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_41470 480272 479475 gene locus_tag LOCUS_41480 480272 479475 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 protein_id gnl|my_center|LOCUS_41480 481714 480557 gene locus_tag LOCUS_41490 481714 480557 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222387.1 protein_id gnl|my_center|LOCUS_41490 481826 482539 gene locus_tag LOCUS_41500 481826 482539 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062048.1 protein_id gnl|my_center|LOCUS_41500 483488 482490 gene locus_tag LOCUS_41510 483488 482490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 484662 483607 gene locus_tag LOCUS_41520 484662 483607 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_41520 484682 485212 gene locus_tag LOCUS_41530 484682 485212 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876911.1 protein_id gnl|my_center|LOCUS_41530 485191 485994 gene locus_tag LOCUS_41540 485191 485994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222384.1 protein_id gnl|my_center|LOCUS_41540 486005 486739 gene locus_tag LOCUS_41550 486005 486739 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_41550 486752 487630 gene locus_tag LOCUS_41560 gene purU 486752 487630 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222381.1 protein_id gnl|my_center|LOCUS_41560 487766 488833 gene locus_tag LOCUS_41570 487766 488833 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_41570 489369 488830 gene locus_tag LOCUS_41580 489369 488830 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_41580 489450 490208 gene locus_tag LOCUS_41590 489450 490208 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918580.1 protein_id gnl|my_center|LOCUS_41590 490803 490249 gene locus_tag LOCUS_41600 490803 490249 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_41600 491475 490813 gene locus_tag LOCUS_41610 491475 490813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 491786 491469 gene locus_tag LOCUS_41620 491786 491469 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222364.1 protein_id gnl|my_center|LOCUS_41620 492556 491870 gene locus_tag LOCUS_41630 492556 491870 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222363.1 protein_id gnl|my_center|LOCUS_41630 493014 492562 gene locus_tag LOCUS_41640 493014 492562 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222362.1 protein_id gnl|my_center|LOCUS_41640 493127 494251 gene locus_tag LOCUS_41650 493127 494251 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_41650 494866 494360 gene locus_tag LOCUS_41660 494866 494360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 494969 496906 gene locus_tag LOCUS_41670 494969 496906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 497968 496886 gene locus_tag LOCUS_41680 497968 496886 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222355.1 protein_id gnl|my_center|LOCUS_41680 497859 498110 gene locus_tag LOCUS_41690 497859 498110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 498088 499344 gene locus_tag LOCUS_41700 498088 499344 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_41700 499951 499487 gene locus_tag LOCUS_41710 499951 499487 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222357.1 protein_id gnl|my_center|LOCUS_41710 500175 500699 gene locus_tag LOCUS_41720 500175 500699 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_41720 500696 501421 gene locus_tag LOCUS_41730 500696 501421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_41730 501418 503715 gene locus_tag LOCUS_41740 501418 503715 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225032.1 protein_id gnl|my_center|LOCUS_41740 503884 506055 gene locus_tag LOCUS_41750 503884 506055 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_41750 506144 506683 gene locus_tag LOCUS_41760 506144 506683 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854968.1 protein_id gnl|my_center|LOCUS_41760 506680 507102 gene locus_tag LOCUS_41770 506680 507102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 507099 507995 gene locus_tag LOCUS_41780 507099 507995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 508318 509277 gene locus_tag LOCUS_41790 508318 509277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 511427 510087 gene locus_tag LOCUS_41800 511427 510087 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 protein_id gnl|my_center|LOCUS_41800 511609 512238 gene locus_tag LOCUS_41810 511609 512238 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222352.1 protein_id gnl|my_center|LOCUS_41810 512743 512207 gene locus_tag LOCUS_41820 512743 512207 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222351.1 protein_id gnl|my_center|LOCUS_41820 512952 512740 gene locus_tag LOCUS_41830 512952 512740 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_41830 513018 513761 gene locus_tag LOCUS_41840 513018 513761 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466552.1 protein_id gnl|my_center|LOCUS_41840 513882 513806 gene locus_tag LOCUS_t00440 513882 513806 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 513991 513917 gene locus_tag LOCUS_t00450 513991 513917 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 514092 514019 gene locus_tag LOCUS_t00460 514092 514019 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 514620 514375 gene locus_tag LOCUS_41850 514620 514375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222297.1 protein_id gnl|my_center|LOCUS_41850 514785 515213 gene locus_tag LOCUS_41860 514785 515213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 515469 515783 gene locus_tag LOCUS_41870 515469 515783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 516112 515909 gene locus_tag LOCUS_41880 516112 515909 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558414.1 protein_id gnl|my_center|LOCUS_41880 517152 516325 gene locus_tag LOCUS_41890 517152 516325 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223187.1 protein_id gnl|my_center|LOCUS_41890 518159 517320 gene locus_tag LOCUS_41900 518159 517320 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_41900 518287 518805 gene locus_tag LOCUS_41910 518287 518805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 523797 518962 gene locus_tag LOCUS_41920 523797 518962 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_41920 525791 523794 gene locus_tag LOCUS_41930 525791 523794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_41930 526372 525791 gene locus_tag LOCUS_41940 526372 525791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 527673 526453 gene locus_tag LOCUS_41950 527673 526453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 528250 527723 gene locus_tag LOCUS_41960 528250 527723 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977488.1 protein_id gnl|my_center|LOCUS_41960 528347 529339 gene locus_tag LOCUS_41970 528347 529339 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_41970 530261 529347 gene locus_tag LOCUS_41980 530261 529347 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_41980 530360 530435 gene locus_tag LOCUS_t00470 530360 530435 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 530816 530487 gene locus_tag LOCUS_41990 530816 530487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 530789 531094 gene locus_tag LOCUS_42000 530789 531094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 531557 531222 gene locus_tag LOCUS_42010 531557 531222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 531880 531554 gene locus_tag LOCUS_42020 531880 531554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 532056 533504 gene locus_tag LOCUS_42030 532056 533504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 534161 533514 gene locus_tag LOCUS_42040 534161 533514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 535886 534744 gene locus_tag LOCUS_42050 535886 534744 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182199.1 protein_id gnl|my_center|LOCUS_42050 538990 536390 gene locus_tag LOCUS_42060 538990 536390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 539410 539880 gene locus_tag LOCUS_42070 539410 539880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 539928 540422 gene locus_tag LOCUS_42080 539928 540422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 540476 541138 gene locus_tag LOCUS_42090 540476 541138 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973215.1 protein_id gnl|my_center|LOCUS_42090 541151 542299 gene locus_tag LOCUS_42100 gene dusB 541151 542299 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_42100 542301 542756 gene locus_tag LOCUS_42110 542301 542756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 542937 543800 gene locus_tag LOCUS_42120 542937 543800 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230708.1 protein_id gnl|my_center|LOCUS_42120 544011 547367 gene locus_tag LOCUS_42130 544011 547367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 547448 548113 gene locus_tag LOCUS_42140 gene phoU 547448 548113 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 protein_id gnl|my_center|LOCUS_42140 548914 548117 gene locus_tag LOCUS_42150 548914 548117 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222184.1 protein_id gnl|my_center|LOCUS_42150 550434 548911 gene locus_tag LOCUS_42160 550434 548911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 551002 550454 gene locus_tag LOCUS_42170 551002 550454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 551446 551015 gene locus_tag LOCUS_42180 551446 551015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 552355 551579 gene locus_tag LOCUS_42190 gene pstB 552355 551579 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230712.1 protein_id gnl|my_center|LOCUS_42190 553280 552366 gene locus_tag LOCUS_42200 gene pstA 553280 552366 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230713.1 protein_id gnl|my_center|LOCUS_42200 554332 553277 gene locus_tag LOCUS_42210 gene pstC 554332 553277 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730785.1 protein_id gnl|my_center|LOCUS_42210 555491 554367 gene locus_tag LOCUS_42220 gene pstS 555491 554367 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730786.1 protein_id gnl|my_center|LOCUS_42220 556566 555688 gene locus_tag LOCUS_42230 gene mshD 556566 555688 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230716.1 protein_id gnl|my_center|LOCUS_42230 557580 556714 gene locus_tag LOCUS_42240 557580 556714 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092492.1 protein_id gnl|my_center|LOCUS_42240 557699 558400 gene locus_tag LOCUS_42250 557699 558400 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_42250 558397 559203 gene locus_tag LOCUS_42260 558397 559203 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230718.1 protein_id gnl|my_center|LOCUS_42260 559204 559638 gene locus_tag LOCUS_42270 559204 559638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 559886 560341 gene locus_tag LOCUS_42280 559886 560341 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_42280 560380 561225 gene locus_tag LOCUS_42290 560380 561225 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_42290 561228 561530 gene locus_tag LOCUS_42300 561228 561530 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467851.1 protein_id gnl|my_center|LOCUS_42300 561732 562367 gene locus_tag LOCUS_42310 561732 562367 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_42310 562442 563047 gene locus_tag LOCUS_42320 562442 563047 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230724.1 protein_id gnl|my_center|LOCUS_42320 563044 563994 gene locus_tag LOCUS_42330 563044 563994 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230725.1 protein_id gnl|my_center|LOCUS_42330 564133 566370 gene locus_tag LOCUS_42340 564133 566370 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226876.1 protein_id gnl|my_center|LOCUS_42340 566535 566978 gene locus_tag LOCUS_42350 566535 566978 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_42350 566975 568066 gene locus_tag LOCUS_42360 566975 568066 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230728.1 protein_id gnl|my_center|LOCUS_42360 568181 569029 gene locus_tag LOCUS_42370 568181 569029 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_42370 569090 569671 gene locus_tag LOCUS_42380 569090 569671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230729.1 protein_id gnl|my_center|LOCUS_42380 569718 570914 gene locus_tag LOCUS_42390 569718 570914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222776.1 protein_id gnl|my_center|LOCUS_42390 571748 570867 gene locus_tag LOCUS_42400 571748 570867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467854.1 protein_id gnl|my_center|LOCUS_42400 571911 572096 gene locus_tag LOCUS_42410 571911 572096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 573233 572169 gene locus_tag LOCUS_42420 573233 572169 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113836.1 protein_id gnl|my_center|LOCUS_42420 >Feature sequence07 293 2527 gene locus_tag LOCUS_42430 293 2527 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230289.1 protein_id gnl|my_center|LOCUS_42430 3188 2535 gene locus_tag LOCUS_42440 3188 2535 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091390221.1 protein_id gnl|my_center|LOCUS_42440 3517 3185 gene locus_tag LOCUS_42450 3517 3185 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402188.1 protein_id gnl|my_center|LOCUS_42450 3629 4177 gene locus_tag LOCUS_42460 3629 4177 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230292.1 protein_id gnl|my_center|LOCUS_42460 5737 4766 gene locus_tag LOCUS_42470 gene pssA 5737 4766 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230288.1 protein_id gnl|my_center|LOCUS_42470 6464 5742 gene locus_tag LOCUS_42480 6464 5742 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230287.1 protein_id gnl|my_center|LOCUS_42480 7845 6640 gene locus_tag LOCUS_42490 7845 6640 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230283.1 protein_id gnl|my_center|LOCUS_42490 7909 8553 gene locus_tag LOCUS_42500 7909 8553 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230282.1 protein_id gnl|my_center|LOCUS_42500 8634 8840 gene locus_tag LOCUS_42510 8634 8840 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085446.1 protein_id gnl|my_center|LOCUS_42510 9008 10246 gene locus_tag LOCUS_42520 9008 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 10463 12085 gene locus_tag LOCUS_42530 gene groL 10463 12085 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230279.1 protein_id gnl|my_center|LOCUS_42530 13211 13990 gene locus_tag LOCUS_42540 13211 13990 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531095.1 protein_id gnl|my_center|LOCUS_42540 14595 14110 gene locus_tag LOCUS_42550 14595 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222254.1 protein_id gnl|my_center|LOCUS_42550 15197 14592 gene locus_tag LOCUS_42560 15197 14592 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222253.1 protein_id gnl|my_center|LOCUS_42560 15555 15379 gene locus_tag LOCUS_42570 15555 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 15674 16339 gene locus_tag LOCUS_42580 15674 16339 CDS product copper homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230268.1 protein_id gnl|my_center|LOCUS_42580 16444 17721 gene locus_tag LOCUS_42590 16444 17721 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227859.1 protein_id gnl|my_center|LOCUS_42590 17741 18634 gene locus_tag LOCUS_42600 17741 18634 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742190.1 protein_id gnl|my_center|LOCUS_42600 18631 19467 gene locus_tag LOCUS_42610 18631 19467 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227861.1 protein_id gnl|my_center|LOCUS_42610 19464 20807 gene locus_tag LOCUS_42620 19464 20807 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227862.1 protein_id gnl|my_center|LOCUS_42620 21029 20808 gene locus_tag LOCUS_42630 21029 20808 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230277.1 protein_id gnl|my_center|LOCUS_42630 21415 21230 gene locus_tag LOCUS_42640 21415 21230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 21320 22198 gene locus_tag LOCUS_42650 21320 22198 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_42650 22195 23280 gene locus_tag LOCUS_42660 22195 23280 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_42660 23273 24379 gene locus_tag LOCUS_42670 23273 24379 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_42670 24452 24994 gene locus_tag LOCUS_42680 24452 24994 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_42680 24991 27423 gene locus_tag LOCUS_42690 24991 27423 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_42690 27420 28274 gene locus_tag LOCUS_42700 27420 28274 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_42700 28271 28897 gene locus_tag LOCUS_42710 28271 28897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 28939 29994 gene locus_tag LOCUS_42720 28939 29994 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223416.1 protein_id gnl|my_center|LOCUS_42720 31261 30020 gene locus_tag LOCUS_42730 31261 30020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093934436.1 protein_id gnl|my_center|LOCUS_42730 31381 32268 gene locus_tag LOCUS_42740 31381 32268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495563.1 protein_id gnl|my_center|LOCUS_42740 32265 33170 gene locus_tag LOCUS_42750 32265 33170 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037062758.1 protein_id gnl|my_center|LOCUS_42750 34071 33112 gene locus_tag LOCUS_42760 34071 33112 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230276.1 protein_id gnl|my_center|LOCUS_42760 34572 34081 gene locus_tag LOCUS_42770 34572 34081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 36271 34577 gene locus_tag LOCUS_42780 36271 34577 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_42780 36449 37066 gene locus_tag LOCUS_42790 36449 37066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 37136 38023 gene locus_tag LOCUS_42800 37136 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 38109 38576 gene locus_tag LOCUS_42810 38109 38576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 38641 39618 gene locus_tag LOCUS_42820 38641 39618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 40659 39742 gene locus_tag LOCUS_42830 40659 39742 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230270.1 protein_id gnl|my_center|LOCUS_42830 41167 44499 gene locus_tag LOCUS_42840 41167 44499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 44496 44915 gene locus_tag LOCUS_42850 44496 44915 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085368.1 protein_id gnl|my_center|LOCUS_42850 44946 45704 gene locus_tag LOCUS_42860 44946 45704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 45685 46290 gene locus_tag LOCUS_42870 45685 46290 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_42870 48735 46489 gene locus_tag LOCUS_42880 48735 46489 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_42880 49445 48846 gene locus_tag LOCUS_42890 49445 48846 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031635.1 protein_id gnl|my_center|LOCUS_42890 49549 49734 gene locus_tag LOCUS_42900 49549 49734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911329.1 protein_id gnl|my_center|LOCUS_42900 49830 51218 gene locus_tag LOCUS_42910 49830 51218 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230249.1 protein_id gnl|my_center|LOCUS_42910 51274 51747 gene locus_tag LOCUS_42920 gene moaC 51274 51747 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230248.1 protein_id gnl|my_center|LOCUS_42920 51744 52217 gene locus_tag LOCUS_42930 51744 52217 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878425.1 protein_id gnl|my_center|LOCUS_42930 52214 52639 gene locus_tag LOCUS_42940 52214 52639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42940 53514 52747 gene locus_tag LOCUS_42950 53514 52747 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230245.1 protein_id gnl|my_center|LOCUS_42950 54036 53782 gene locus_tag LOCUS_42960 54036 53782 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230244.1 protein_id gnl|my_center|LOCUS_42960 55066 54038 gene locus_tag LOCUS_42970 gene moaA 55066 54038 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_42970 55212 55676 gene locus_tag LOCUS_42980 55212 55676 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230242.1 protein_id gnl|my_center|LOCUS_42980 55686 56501 gene locus_tag LOCUS_42990 55686 56501 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_42990 56551 57288 gene locus_tag LOCUS_43000 56551 57288 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031856.1 protein_id gnl|my_center|LOCUS_43000 57574 58329 gene locus_tag LOCUS_43010 57574 58329 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230235.1 protein_id gnl|my_center|LOCUS_43010 58370 58753 gene locus_tag LOCUS_43020 58370 58753 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230330.1 protein_id gnl|my_center|LOCUS_43020 59132 58758 gene locus_tag LOCUS_43030 59132 58758 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_43030 59174 60148 gene locus_tag LOCUS_43040 59174 60148 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_43040 61004 60435 gene locus_tag LOCUS_43050 61004 60435 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230219.1 protein_id gnl|my_center|LOCUS_43050 61017 61661 gene locus_tag LOCUS_43060 61017 61661 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230218.1 protein_id gnl|my_center|LOCUS_43060 61818 61627 gene locus_tag LOCUS_43070 61818 61627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 61997 62383 gene locus_tag LOCUS_43080 61997 62383 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230216.1 protein_id gnl|my_center|LOCUS_43080 63284 62805 gene locus_tag LOCUS_43090 63284 62805 CDS product DUF2771 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230215.1 protein_id gnl|my_center|LOCUS_43090 64861 63296 gene locus_tag LOCUS_43100 64861 63296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 65798 64896 gene locus_tag LOCUS_43110 65798 64896 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786700.1 protein_id gnl|my_center|LOCUS_43110 66746 65814 gene locus_tag LOCUS_43120 66746 65814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 66633 67403 gene locus_tag LOCUS_43130 66633 67403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 67400 70228 gene locus_tag LOCUS_43140 67400 70228 CDS product molecular chaperone Hsp90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230211.1 protein_id gnl|my_center|LOCUS_43140 70809 70606 gene locus_tag LOCUS_43150 70809 70606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 70958 72451 gene locus_tag LOCUS_43160 70958 72451 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_43160 72480 72944 gene locus_tag LOCUS_43170 72480 72944 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_43170 73033 74280 gene locus_tag LOCUS_43180 73033 74280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_43180 74443 75216 gene locus_tag LOCUS_43190 74443 75216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_43190 75623 75246 gene locus_tag LOCUS_43200 75623 75246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 75504 76988 gene locus_tag LOCUS_43210 75504 76988 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972254.1 protein_id gnl|my_center|LOCUS_43210 76993 77403 gene locus_tag LOCUS_43220 76993 77403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 78107 78526 gene locus_tag LOCUS_43230 78107 78526 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228199.1 protein_id gnl|my_center|LOCUS_43230 80110 78611 gene locus_tag LOCUS_43240 80110 78611 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261568.1 protein_id gnl|my_center|LOCUS_43240 80259 81092 gene locus_tag LOCUS_43250 80259 81092 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230200.1 protein_id gnl|my_center|LOCUS_43250 81157 81804 gene locus_tag LOCUS_43260 81157 81804 CDS product DUF2537 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230199.1 protein_id gnl|my_center|LOCUS_43260 83676 81811 gene locus_tag LOCUS_43270 83676 81811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030254.1 protein_id gnl|my_center|LOCUS_43270 85436 83673 gene locus_tag LOCUS_43280 85436 83673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_43280 85528 85767 gene locus_tag LOCUS_43290 85528 85767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 86201 85764 gene locus_tag LOCUS_43300 86201 85764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 86568 86194 gene locus_tag LOCUS_43310 86568 86194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 87617 86697 gene locus_tag LOCUS_43320 gene sepH 87617 86697 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230196.1 protein_id gnl|my_center|LOCUS_43320 88993 87860 gene locus_tag LOCUS_43330 gene serC 88993 87860 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_43330 90232 89120 gene locus_tag LOCUS_43340 90232 89120 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230178.1 protein_id gnl|my_center|LOCUS_43340 90420 90722 gene locus_tag LOCUS_43350 90420 90722 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230177.1 protein_id gnl|my_center|LOCUS_43350 90732 91043 gene locus_tag LOCUS_43360 90732 91043 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_43360 91040 92740 gene locus_tag LOCUS_43370 91040 92740 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230175.1 protein_id gnl|my_center|LOCUS_43370 92740 93390 gene locus_tag LOCUS_43380 92740 93390 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230174.1 protein_id gnl|my_center|LOCUS_43380 93380 94069 gene locus_tag LOCUS_43390 gene ureG 93380 94069 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 protein_id gnl|my_center|LOCUS_43390 94545 94039 gene locus_tag LOCUS_43400 94545 94039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 94695 95483 gene locus_tag LOCUS_43410 94695 95483 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230172.1 protein_id gnl|my_center|LOCUS_43410 95532 96188 gene locus_tag LOCUS_43420 gene pdxH 95532 96188 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230168.1 protein_id gnl|my_center|LOCUS_43420 96548 96258 gene locus_tag LOCUS_43430 96548 96258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 96765 98024 gene locus_tag LOCUS_43440 96765 98024 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_43440 98125 99078 gene locus_tag LOCUS_43450 98125 99078 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742245.1 protein_id gnl|my_center|LOCUS_43450 100376 99075 gene locus_tag LOCUS_43460 100376 99075 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 protein_id gnl|my_center|LOCUS_43460 100702 100493 gene locus_tag LOCUS_43470 100702 100493 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029565.1 protein_id gnl|my_center|LOCUS_43470 101554 100715 gene locus_tag LOCUS_43480 101554 100715 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_43480 101650 101883 gene locus_tag LOCUS_43490 101650 101883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 101956 103338 gene locus_tag LOCUS_43500 101956 103338 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 protein_id gnl|my_center|LOCUS_43500 105508 103388 gene locus_tag LOCUS_43510 105508 103388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 105845 105549 gene locus_tag LOCUS_43520 105845 105549 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_43520 106756 105923 gene locus_tag LOCUS_43530 106756 105923 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230164.1 protein_id gnl|my_center|LOCUS_43530 107307 106753 gene locus_tag LOCUS_43540 107307 106753 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284106.1 protein_id gnl|my_center|LOCUS_43540 107376 108248 gene locus_tag LOCUS_43550 107376 108248 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_43550 108268 109497 gene locus_tag LOCUS_43560 108268 109497 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230159.1 protein_id gnl|my_center|LOCUS_43560 110614 109475 gene locus_tag LOCUS_43570 110614 109475 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230156.1 protein_id gnl|my_center|LOCUS_43570 110704 111300 gene locus_tag LOCUS_43580 110704 111300 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230155.1 protein_id gnl|my_center|LOCUS_43580 111297 112235 gene locus_tag LOCUS_43590 111297 112235 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230154.1 protein_id gnl|my_center|LOCUS_43590 112504 113817 gene locus_tag LOCUS_43600 112504 113817 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_43600 113918 115189 gene locus_tag LOCUS_43610 113918 115189 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_43610 116373 115186 gene locus_tag LOCUS_43620 116373 115186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_43620 117281 116370 gene locus_tag LOCUS_43630 117281 116370 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_43630 117576 117328 gene locus_tag LOCUS_43640 117576 117328 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104405.1 protein_id gnl|my_center|LOCUS_43640 117781 118224 gene locus_tag LOCUS_43650 117781 118224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 118236 118550 gene locus_tag LOCUS_43660 118236 118550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 118547 120208 gene locus_tag LOCUS_43670 118547 120208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 121861 120419 gene locus_tag LOCUS_43680 121861 120419 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230146.1 protein_id gnl|my_center|LOCUS_43680 122424 121858 gene locus_tag LOCUS_43690 122424 121858 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230145.1 protein_id gnl|my_center|LOCUS_43690 122423 124078 gene locus_tag LOCUS_43700 122423 124078 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230144.1 protein_id gnl|my_center|LOCUS_43700 124068 125264 gene locus_tag LOCUS_43710 124068 125264 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384447.1 protein_id gnl|my_center|LOCUS_43710 126047 125337 gene locus_tag LOCUS_43720 126047 125337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 126083 126490 gene locus_tag LOCUS_43730 126083 126490 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229329.1 protein_id gnl|my_center|LOCUS_43730 126921 126493 gene locus_tag LOCUS_43740 126921 126493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 129689 126918 gene locus_tag LOCUS_43750 129689 126918 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230656.1 protein_id gnl|my_center|LOCUS_43750 129942 129691 gene locus_tag LOCUS_43760 129942 129691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 130204 129944 gene locus_tag LOCUS_43770 130204 129944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 131149 130343 gene locus_tag LOCUS_43780 131149 130343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 131368 131748 gene locus_tag LOCUS_43790 131368 131748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 132620 131853 gene locus_tag LOCUS_43800 132620 131853 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107019904.1 protein_id gnl|my_center|LOCUS_43800 133226 132621 gene locus_tag LOCUS_43810 133226 132621 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184934043.1 protein_id gnl|my_center|LOCUS_43810 134395 133325 gene locus_tag LOCUS_43820 134395 133325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 134913 134539 gene locus_tag LOCUS_43830 134913 134539 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224929.1 protein_id gnl|my_center|LOCUS_43830 135011 135823 gene locus_tag LOCUS_43840 135011 135823 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 protein_id gnl|my_center|LOCUS_43840 136806 135820 gene locus_tag LOCUS_43850 136806 135820 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031660.1 protein_id gnl|my_center|LOCUS_43850 137141 137566 gene locus_tag LOCUS_43860 137141 137566 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_43860 138390 137563 gene locus_tag LOCUS_43870 138390 137563 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_43870 138464 139282 gene locus_tag LOCUS_43880 138464 139282 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027226.1 protein_id gnl|my_center|LOCUS_43880 140678 139305 gene locus_tag LOCUS_43890 140678 139305 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223390.1 protein_id gnl|my_center|LOCUS_43890 142526 140715 gene locus_tag LOCUS_43900 142526 140715 CDS product isoniazid inducible protein IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193353532.1 protein_id gnl|my_center|LOCUS_43900 143602 142646 gene locus_tag LOCUS_43910 143602 142646 CDS product IniB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223388.1 protein_id gnl|my_center|LOCUS_43910 143848 145131 gene locus_tag LOCUS_43920 143848 145131 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226992.1 protein_id gnl|my_center|LOCUS_43920 145128 147521 gene locus_tag LOCUS_43930 145128 147521 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223386.1 protein_id gnl|my_center|LOCUS_43930 147936 147532 gene locus_tag LOCUS_43940 147936 147532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 148046 148627 gene locus_tag LOCUS_43950 148046 148627 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226530.1 protein_id gnl|my_center|LOCUS_43950 148631 150139 gene locus_tag LOCUS_43960 148631 150139 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 protein_id gnl|my_center|LOCUS_43960 150691 150191 gene locus_tag LOCUS_43970 150691 150191 CDS product DUF2165 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974551.1 protein_id gnl|my_center|LOCUS_43970 154825 150767 gene locus_tag LOCUS_43980 154825 150767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 155142 155306 gene locus_tag LOCUS_43990 155142 155306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 155476 156900 gene locus_tag LOCUS_44000 155476 156900 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_44000 156917 157408 gene locus_tag LOCUS_44010 156917 157408 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_44010 157642 158226 gene locus_tag LOCUS_44020 157642 158226 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_44020 158229 158945 gene locus_tag LOCUS_44030 158229 158945 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226469.1 protein_id gnl|my_center|LOCUS_44030 158942 159817 gene locus_tag LOCUS_44040 158942 159817 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_44040 160715 159882 gene locus_tag LOCUS_44050 160715 159882 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467855.1 protein_id gnl|my_center|LOCUS_44050 160929 161804 gene locus_tag LOCUS_44060 160929 161804 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230746.1 protein_id gnl|my_center|LOCUS_44060 161935 162174 gene locus_tag LOCUS_44070 161935 162174 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_44070 162158 162469 gene locus_tag LOCUS_44080 162158 162469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 163300 162692 gene locus_tag LOCUS_44090 163300 162692 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728450.1 protein_id gnl|my_center|LOCUS_44090 163378 163920 gene locus_tag LOCUS_44100 163378 163920 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_44100 164795 164022 gene locus_tag LOCUS_44110 164795 164022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_44110 165718 164792 gene locus_tag LOCUS_44120 165718 164792 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_44120 166900 165731 gene locus_tag LOCUS_44130 166900 165731 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224575.1 protein_id gnl|my_center|LOCUS_44130 167780 166941 gene locus_tag LOCUS_44140 167780 166941 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_44140 168332 167844 gene locus_tag LOCUS_44150 168332 167844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_44150 168765 169943 gene locus_tag LOCUS_44160 168765 169943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 170917 170066 gene locus_tag LOCUS_44170 170917 170066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 171359 171108 gene locus_tag LOCUS_44180 171359 171108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 171475 171834 gene locus_tag LOCUS_44190 171475 171834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 172068 171995 gene locus_tag LOCUS_t00480 172068 171995 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 172269 173210 gene locus_tag LOCUS_44200 172269 173210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 173223 173975 gene locus_tag LOCUS_44210 173223 173975 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081985.1 protein_id gnl|my_center|LOCUS_44210 177310 174119 gene locus_tag LOCUS_44220 177310 174119 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742126.1 protein_id gnl|my_center|LOCUS_44220 177482 178120 gene locus_tag LOCUS_44230 177482 178120 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224172.1 protein_id gnl|my_center|LOCUS_44230 178324 178971 gene locus_tag LOCUS_44240 178324 178971 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230063.1 protein_id gnl|my_center|LOCUS_44240 180728 179229 gene locus_tag LOCUS_44250 180728 179229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 181434 180802 gene locus_tag LOCUS_44260 gene bluB 181434 180802 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228822.1 protein_id gnl|my_center|LOCUS_44260 181520 181840 gene locus_tag LOCUS_44270 181520 181840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 181897 182946 gene locus_tag LOCUS_44280 181897 182946 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971615.1 protein_id gnl|my_center|LOCUS_44280 183596 182943 gene locus_tag LOCUS_44290 183596 182943 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228601.1 protein_id gnl|my_center|LOCUS_44290 183651 183971 gene locus_tag LOCUS_44300 183651 183971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 183968 184801 gene locus_tag LOCUS_44310 183968 184801 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083218.1 protein_id gnl|my_center|LOCUS_44310 184812 185942 gene locus_tag LOCUS_44320 184812 185942 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749467.1 protein_id gnl|my_center|LOCUS_44320 186049 186738 gene locus_tag LOCUS_44330 186049 186738 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_44330 186735 188126 gene locus_tag LOCUS_44340 186735 188126 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_44340 189190 188318 gene locus_tag LOCUS_44350 189190 188318 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_44350 190152 189187 gene locus_tag LOCUS_44360 190152 189187 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_44360 191452 190157 gene locus_tag LOCUS_44370 191452 190157 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968184.1 protein_id gnl|my_center|LOCUS_44370 191610 193613 gene locus_tag LOCUS_44380 191610 193613 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_44380 193615 194412 gene locus_tag LOCUS_44390 193615 194412 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_44390 194409 195488 gene locus_tag LOCUS_44400 gene galT 194409 195488 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_44400 195557 197446 gene locus_tag LOCUS_44410 195557 197446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 198218 198496 gene locus_tag LOCUS_44420 198218 198496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 198506 199201 gene locus_tag LOCUS_44430 198506 199201 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_44430 199201 200220 gene locus_tag LOCUS_44440 199201 200220 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230049.1 protein_id gnl|my_center|LOCUS_44440 200311 200718 gene locus_tag LOCUS_44450 200311 200718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 200853 201353 gene locus_tag LOCUS_44460 200853 201353 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230045.1 protein_id gnl|my_center|LOCUS_44460 201350 201550 gene locus_tag LOCUS_44470 201350 201550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 202140 201745 gene locus_tag LOCUS_44480 gene mscL 202140 201745 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230043.1 protein_id gnl|my_center|LOCUS_44480 203385 202912 gene locus_tag LOCUS_44490 203385 202912 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230042.1 protein_id gnl|my_center|LOCUS_44490 203787 203509 gene locus_tag LOCUS_44500 203787 203509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 204455 203889 gene locus_tag LOCUS_44510 204455 203889 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230040.1 protein_id gnl|my_center|LOCUS_44510 204494 205375 gene locus_tag LOCUS_44520 204494 205375 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230039.1 protein_id gnl|my_center|LOCUS_44520 205398 206612 gene locus_tag LOCUS_44530 205398 206612 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230038.1 protein_id gnl|my_center|LOCUS_44530 206646 207302 gene locus_tag LOCUS_44540 206646 207302 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230037.1 protein_id gnl|my_center|LOCUS_44540 207464 208168 gene locus_tag LOCUS_44550 207464 208168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230036.1 protein_id gnl|my_center|LOCUS_44550 208232 208305 gene locus_tag LOCUS_t00490 208232 208305 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 208631 208879 gene locus_tag LOCUS_44560 208631 208879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 209333 212305 gene locus_tag LOCUS_44570 209333 212305 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189169828.1 protein_id gnl|my_center|LOCUS_44570 212504 213820 gene locus_tag LOCUS_44580 212504 213820 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_44580 214596 213883 gene locus_tag LOCUS_44590 214596 213883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030129.1 protein_id gnl|my_center|LOCUS_44590 214649 215218 gene locus_tag LOCUS_44600 214649 215218 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728101.1 protein_id gnl|my_center|LOCUS_44600 215197 215355 gene locus_tag LOCUS_44610 215197 215355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 215788 216273 gene locus_tag LOCUS_44620 215788 216273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 216535 218454 gene locus_tag LOCUS_44630 216535 218454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 219508 218405 gene locus_tag LOCUS_44640 219508 218405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 219912 219520 gene locus_tag LOCUS_44650 219912 219520 CDS product DUF2000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046118341.1 protein_id gnl|my_center|LOCUS_44650 220016 220474 gene locus_tag LOCUS_44660 220016 220474 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_44660 220746 220429 gene locus_tag LOCUS_44670 220746 220429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 222351 220780 gene locus_tag LOCUS_44680 222351 220780 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229989.1 protein_id gnl|my_center|LOCUS_44680 222406 223221 gene locus_tag LOCUS_44690 gene rsmI 222406 223221 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_44690 223320 225110 gene locus_tag LOCUS_44700 gene metG 223320 225110 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467759.1 protein_id gnl|my_center|LOCUS_44700 225178 225960 gene locus_tag LOCUS_44710 225178 225960 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229979.1 protein_id gnl|my_center|LOCUS_44710 226241 227671 gene locus_tag LOCUS_44720 226241 227671 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229978.1 protein_id gnl|my_center|LOCUS_44720 227721 228617 gene locus_tag LOCUS_44730 gene rsmA 227721 228617 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_44730 229001 230011 gene locus_tag LOCUS_44740 229001 230011 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229976.1 protein_id gnl|my_center|LOCUS_44740 230035 230691 gene locus_tag LOCUS_44750 230035 230691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027847.1 protein_id gnl|my_center|LOCUS_44750 230720 231526 gene locus_tag LOCUS_44760 230720 231526 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_44760 231956 232921 gene locus_tag LOCUS_44770 231956 232921 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 protein_id gnl|my_center|LOCUS_44770 233143 234912 gene locus_tag LOCUS_44780 233143 234912 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229973.1 protein_id gnl|my_center|LOCUS_44780 235675 235106 gene locus_tag LOCUS_44790 235675 235106 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_44790 236987 235710 gene locus_tag LOCUS_44800 236987 235710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 237095 238744 gene locus_tag LOCUS_44810 237095 238744 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229972.1 protein_id gnl|my_center|LOCUS_44810 238744 239535 gene locus_tag LOCUS_44820 238744 239535 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_44820 240251 239682 gene locus_tag LOCUS_44830 gene pth 240251 239682 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_44830 240753 240241 gene locus_tag LOCUS_44840 240753 240241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 241417 240812 gene locus_tag LOCUS_44850 241417 240812 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 protein_id gnl|my_center|LOCUS_44850 242720 241707 gene locus_tag LOCUS_44860 242720 241707 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_44860 244170 242692 gene locus_tag LOCUS_44870 gene glmU 244170 242692 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467757.1 protein_id gnl|my_center|LOCUS_44870 246010 244238 gene locus_tag LOCUS_44880 246010 244238 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229962.1 protein_id gnl|my_center|LOCUS_44880 246051 245980 gene locus_tag LOCUS_t00500 246051 245980 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 247550 246405 gene locus_tag LOCUS_44890 247550 246405 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 protein_id gnl|my_center|LOCUS_44890 247807 248664 gene locus_tag LOCUS_44900 247807 248664 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229961.1 protein_id gnl|my_center|LOCUS_44900 248733 249374 gene locus_tag LOCUS_44910 248733 249374 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467756.1 protein_id gnl|my_center|LOCUS_44910 250716 249586 gene locus_tag LOCUS_44920 250716 249586 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_44920 250803 251702 gene locus_tag LOCUS_44930 250803 251702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 252285 251683 gene locus_tag LOCUS_44940 252285 251683 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_44940 252436 256014 gene locus_tag LOCUS_44950 gene mfd 252436 256014 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229948.1 protein_id gnl|my_center|LOCUS_44950 256028 256972 gene locus_tag LOCUS_44960 256028 256972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630323.1 protein_id gnl|my_center|LOCUS_44960 256969 257883 gene locus_tag LOCUS_44970 256969 257883 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229944.1 protein_id gnl|my_center|LOCUS_44970 258212 261397 gene locus_tag LOCUS_44980 258212 261397 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_44980 262031 261630 gene locus_tag LOCUS_44990 262031 261630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 262246 263082 gene locus_tag LOCUS_45000 262246 263082 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229932.1 protein_id gnl|my_center|LOCUS_45000 265805 263079 gene locus_tag LOCUS_45010 265805 263079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 266672 266313 gene locus_tag LOCUS_45020 266672 266313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 267046 266669 gene locus_tag LOCUS_45030 267046 266669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 267819 267115 gene locus_tag LOCUS_45040 267819 267115 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223917.1 protein_id gnl|my_center|LOCUS_45040 267938 269224 gene locus_tag LOCUS_45050 gene eno 267938 269224 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229929.1 protein_id gnl|my_center|LOCUS_45050 269224 269775 gene locus_tag LOCUS_45060 269224 269775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 269772 270263 gene locus_tag LOCUS_45070 269772 270263 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229927.1 protein_id gnl|my_center|LOCUS_45070 270376 271737 gene locus_tag LOCUS_45080 270376 271737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 271849 272799 gene locus_tag LOCUS_45090 271849 272799 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_45090 272956 274578 gene locus_tag LOCUS_45100 272956 274578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949626.1 protein_id gnl|my_center|LOCUS_45100 274644 275567 gene locus_tag LOCUS_45110 274644 275567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_45110 275560 276459 gene locus_tag LOCUS_45120 275560 276459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_45120 276467 277459 gene locus_tag LOCUS_45130 276467 277459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229921.1 protein_id gnl|my_center|LOCUS_45130 277437 278447 gene locus_tag LOCUS_45140 277437 278447 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_45140 279996 278515 gene locus_tag LOCUS_45150 279996 278515 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229918.1 protein_id gnl|my_center|LOCUS_45150 280027 280737 gene locus_tag LOCUS_45160 280027 280737 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_45160 280983 281918 gene locus_tag LOCUS_45170 280983 281918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 281906 282208 gene locus_tag LOCUS_45180 281906 282208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 282349 283056 gene locus_tag LOCUS_45190 282349 283056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 283053 283520 gene locus_tag LOCUS_45200 283053 283520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 283517 284488 gene locus_tag LOCUS_45210 283517 284488 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804471.1 protein_id gnl|my_center|LOCUS_45210 284485 285879 gene locus_tag LOCUS_45220 284485 285879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 285959 286465 gene locus_tag LOCUS_45230 285959 286465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 286696 287961 gene locus_tag LOCUS_45240 286696 287961 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_45240 288157 288279 gene locus_tag LOCUS_45250 288157 288279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 288283 289401 gene locus_tag LOCUS_45260 288283 289401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 289382 290452 gene locus_tag LOCUS_45270 289382 290452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 290540 290614 gene locus_tag LOCUS_t00510 290540 290614 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 292400 290772 gene locus_tag LOCUS_45280 292400 290772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 293101 292454 gene locus_tag LOCUS_45290 293101 292454 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_45290 294330 293053 gene locus_tag LOCUS_45300 294330 293053 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_45300 295225 294389 gene locus_tag LOCUS_45310 gene pqqB 295225 294389 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229609.1 protein_id gnl|my_center|LOCUS_45310 296328 295261 gene locus_tag LOCUS_45320 gene pqqE 296328 295261 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229608.1 protein_id gnl|my_center|LOCUS_45320 296590 296321 gene locus_tag LOCUS_45330 296590 296321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 297297 296587 gene locus_tag LOCUS_45340 gene pqqC 297297 296587 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467700.1 protein_id gnl|my_center|LOCUS_45340 298700 297543 gene locus_tag LOCUS_45350 298700 297543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225785.1 protein_id gnl|my_center|LOCUS_45350 299472 298771 gene locus_tag LOCUS_45360 299472 298771 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229846.1 protein_id gnl|my_center|LOCUS_45360 300884 299469 gene locus_tag LOCUS_45370 300884 299469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229845.1 protein_id gnl|my_center|LOCUS_45370 301134 301934 gene locus_tag LOCUS_45380 301134 301934 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229844.1 protein_id gnl|my_center|LOCUS_45380 302346 302134 gene locus_tag LOCUS_45390 302346 302134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 303622 302402 gene locus_tag LOCUS_45400 303622 302402 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_45400 303800 305170 gene locus_tag LOCUS_45410 303800 305170 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_45410 305275 305081 gene locus_tag LOCUS_45420 305275 305081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 305321 306412 gene locus_tag LOCUS_45430 305321 306412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 306495 307646 gene locus_tag LOCUS_45440 306495 307646 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_45440 308144 307872 gene locus_tag LOCUS_45450 308144 307872 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_45450 308406 308176 gene locus_tag LOCUS_45460 308406 308176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 309763 308582 gene locus_tag LOCUS_45470 gene hppD 309763 308582 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229829.1 protein_id gnl|my_center|LOCUS_45470 309839 310333 gene locus_tag LOCUS_45480 309839 310333 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229828.1 protein_id gnl|my_center|LOCUS_45480 310901 310413 gene locus_tag LOCUS_45490 gene greA 310901 310413 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_45490 311503 311093 gene locus_tag LOCUS_45500 311503 311093 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229825.1 protein_id gnl|my_center|LOCUS_45500 311615 312496 gene locus_tag LOCUS_45510 gene mca 311615 312496 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_45510 312493 312780 gene locus_tag LOCUS_45520 312493 312780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 316320 312781 gene locus_tag LOCUS_45530 316320 312781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 313028 312940 gene locus_tag LOCUS_t00520 313028 312940 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 317095 316331 gene locus_tag LOCUS_45540 317095 316331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 317149 319116 gene locus_tag LOCUS_45550 317149 319116 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284173.1 protein_id gnl|my_center|LOCUS_45550 319192 319749 gene locus_tag LOCUS_45560 319192 319749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_45560 320028 320627 gene locus_tag LOCUS_45570 320028 320627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 320621 321460 gene locus_tag LOCUS_45580 320621 321460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 322206 321781 gene locus_tag LOCUS_45590 322206 321781 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950169.1 protein_id gnl|my_center|LOCUS_45590 322279 323058 gene locus_tag LOCUS_45600 322279 323058 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030352.1 protein_id gnl|my_center|LOCUS_45600 323194 323613 gene locus_tag LOCUS_45610 323194 323613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 323624 323911 gene locus_tag LOCUS_45620 323624 323911 CDS product AMED_5909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072476545.1 protein_id gnl|my_center|LOCUS_45620 323908 324183 gene locus_tag LOCUS_45630 323908 324183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 324595 325995 gene locus_tag LOCUS_45640 324595 325995 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110627.1 protein_id gnl|my_center|LOCUS_45640 325992 327620 gene locus_tag LOCUS_45650 325992 327620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 protein_id gnl|my_center|LOCUS_45650 327617 327814 gene locus_tag LOCUS_45660 327617 327814 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227709.1 protein_id gnl|my_center|LOCUS_45660 327851 329074 gene locus_tag LOCUS_45670 327851 329074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 329707 329114 gene locus_tag LOCUS_45680 329707 329114 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_45680 329867 330649 gene locus_tag LOCUS_45690 329867 330649 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_45690 331085 330726 gene locus_tag LOCUS_45700 331085 330726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 331740 331429 gene locus_tag LOCUS_45710 331740 331429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 331973 333211 gene locus_tag LOCUS_45720 331973 333211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_45720 333689 334963 gene locus_tag LOCUS_45730 333689 334963 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229808.1 protein_id gnl|my_center|LOCUS_45730 335661 334951 gene locus_tag LOCUS_45740 335661 334951 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229800.1 protein_id gnl|my_center|LOCUS_45740 337175 335736 gene locus_tag LOCUS_45750 337175 335736 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229805.1 protein_id gnl|my_center|LOCUS_45750 337696 337313 gene locus_tag LOCUS_45760 337696 337313 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729797.1 protein_id gnl|my_center|LOCUS_45760 337782 338819 gene locus_tag LOCUS_45770 337782 338819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 340832 339297 gene locus_tag LOCUS_45780 340832 339297 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229798.1 protein_id gnl|my_center|LOCUS_45780 342228 340861 gene locus_tag LOCUS_45790 342228 340861 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104558.1 protein_id gnl|my_center|LOCUS_45790 342312 343172 gene locus_tag LOCUS_45800 342312 343172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 344512 343169 gene locus_tag LOCUS_45810 344512 343169 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229796.1 protein_id gnl|my_center|LOCUS_45810 344643 345614 gene locus_tag LOCUS_45820 344643 345614 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_45820 346042 345611 gene locus_tag LOCUS_45830 346042 345611 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227715.1 protein_id gnl|my_center|LOCUS_45830 346458 346099 gene locus_tag LOCUS_45840 346458 346099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 346403 346771 gene locus_tag LOCUS_45850 346403 346771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 347600 346833 gene locus_tag LOCUS_45860 347600 346833 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 protein_id gnl|my_center|LOCUS_45860 348783 347728 gene locus_tag LOCUS_45870 gene glpX 348783 347728 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_45870 349059 348850 gene locus_tag LOCUS_45880 349059 348850 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229792.1 protein_id gnl|my_center|LOCUS_45880 349463 349056 gene locus_tag LOCUS_45890 349463 349056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229791.1 protein_id gnl|my_center|LOCUS_45890 350703 349444 gene locus_tag LOCUS_45900 gene xseA 350703 349444 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229790.1 protein_id gnl|my_center|LOCUS_45900 351176 350700 gene locus_tag LOCUS_45910 351176 350700 CDS product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229789.1 protein_id gnl|my_center|LOCUS_45910 351241 352185 gene locus_tag LOCUS_45920 351241 352185 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_45920 352374 352252 gene locus_tag LOCUS_45930 352374 352252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 352802 354676 gene locus_tag LOCUS_45940 352802 354676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_45940 355096 357957 gene locus_tag LOCUS_45950 355096 357957 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223918.1 protein_id gnl|my_center|LOCUS_45950 360871 357992 gene locus_tag LOCUS_45960 360871 357992 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_45960 362019 360868 gene locus_tag LOCUS_45970 362019 360868 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_45970 362141 363046 gene locus_tag LOCUS_45980 362141 363046 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229786.1 protein_id gnl|my_center|LOCUS_45980 363084 363851 gene locus_tag LOCUS_45990 363084 363851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45990 364386 363889 gene locus_tag LOCUS_46000 364386 363889 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 protein_id gnl|my_center|LOCUS_46000 365651 364383 gene locus_tag LOCUS_46010 365651 364383 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229782.1 protein_id gnl|my_center|LOCUS_46010 365732 366811 gene locus_tag LOCUS_46020 gene ychF 365732 366811 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229781.1 protein_id gnl|my_center|LOCUS_46020 366833 367045 gene locus_tag LOCUS_46030 366833 367045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013316.1 protein_id gnl|my_center|LOCUS_46030 367042 367428 gene locus_tag LOCUS_46040 367042 367428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 367987 367412 gene locus_tag LOCUS_46050 367987 367412 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_46050 368265 368131 gene locus_tag LOCUS_46060 368265 368131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 368340 369560 gene locus_tag LOCUS_46070 368340 369560 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217160422.1 protein_id gnl|my_center|LOCUS_46070 369809 369510 gene locus_tag LOCUS_46080 369809 369510 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_46080 369944 370981 gene locus_tag LOCUS_46090 369944 370981 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_46090 370957 372558 gene locus_tag LOCUS_46100 370957 372558 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125313541.1 protein_id gnl|my_center|LOCUS_46100 372558 373529 gene locus_tag LOCUS_46110 372558 373529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_46110 374025 373519 gene locus_tag LOCUS_46120 374025 373519 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_46120 374862 374029 gene locus_tag LOCUS_46130 374862 374029 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229773.1 protein_id gnl|my_center|LOCUS_46130 375842 374859 gene locus_tag LOCUS_46140 375842 374859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229772.1 protein_id gnl|my_center|LOCUS_46140 375584 375493 gene locus_tag LOCUS_t00530 375584 375493 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 377053 375872 gene locus_tag LOCUS_46150 377053 375872 CDS product sigma-E factor regulatory protein RseB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229771.1 protein_id gnl|my_center|LOCUS_46150 377180 377893 gene locus_tag LOCUS_46160 377180 377893 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283998.1 protein_id gnl|my_center|LOCUS_46160 377890 379173 gene locus_tag LOCUS_46170 377890 379173 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229769.1 protein_id gnl|my_center|LOCUS_46170 379197 380012 gene locus_tag LOCUS_46180 379197 380012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 381170 380205 gene locus_tag LOCUS_46190 gene trpS 381170 380205 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229767.1 protein_id gnl|my_center|LOCUS_46190 381363 381662 gene locus_tag LOCUS_46200 381363 381662 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229766.1 protein_id gnl|my_center|LOCUS_46200 381882 381712 gene locus_tag LOCUS_46210 381882 381712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 382048 383949 gene locus_tag LOCUS_46220 gene typA 382048 383949 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229765.1 protein_id gnl|my_center|LOCUS_46220 384745 386391 gene locus_tag LOCUS_46230 384745 386391 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229764.1 protein_id gnl|my_center|LOCUS_46230 386737 388506 gene locus_tag LOCUS_46240 386737 388506 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283994.1 protein_id gnl|my_center|LOCUS_46240 388656 389654 gene locus_tag LOCUS_46250 388656 389654 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229760.1 protein_id gnl|my_center|LOCUS_46250 389647 390603 gene locus_tag LOCUS_46260 389647 390603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 protein_id gnl|my_center|LOCUS_46260 390600 391787 gene locus_tag LOCUS_46270 390600 391787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 391784 392851 gene locus_tag LOCUS_46280 391784 392851 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_46280 392923 393762 gene locus_tag LOCUS_46290 gene mshB 392923 393762 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229758.1 protein_id gnl|my_center|LOCUS_46290 393759 394151 gene locus_tag LOCUS_46300 393759 394151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229757.1 protein_id gnl|my_center|LOCUS_46300 394132 394875 gene locus_tag LOCUS_46310 394132 394875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229756.1 protein_id gnl|my_center|LOCUS_46310 395588 394851 gene locus_tag LOCUS_46320 395588 394851 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222934.1 protein_id gnl|my_center|LOCUS_46320 395735 396061 gene locus_tag LOCUS_46330 395735 396061 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_46330 396058 397152 gene locus_tag LOCUS_46340 gene dapC 396058 397152 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 protein_id gnl|my_center|LOCUS_46340 398248 397343 gene locus_tag LOCUS_46350 gene dapD 398248 397343 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 protein_id gnl|my_center|LOCUS_46350 398268 399419 gene locus_tag LOCUS_46360 gene dapE 398268 399419 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222942.1 protein_id gnl|my_center|LOCUS_46360 399430 400194 gene locus_tag LOCUS_46370 399430 400194 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_46370 400221 400727 gene locus_tag LOCUS_46380 400221 400727 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088046.1 protein_id gnl|my_center|LOCUS_46380 401818 400775 gene locus_tag LOCUS_46390 401818 400775 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223033.1 protein_id gnl|my_center|LOCUS_46390 402182 401811 gene locus_tag LOCUS_46400 402182 401811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 403744 402218 gene locus_tag LOCUS_46410 403744 402218 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035939.1 protein_id gnl|my_center|LOCUS_46410 403834 404703 gene locus_tag LOCUS_46420 gene folP 403834 404703 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228969.1 protein_id gnl|my_center|LOCUS_46420 406990 405446 gene locus_tag LOCUS_46430 gene cydC 406990 405446 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222959.1 protein_id gnl|my_center|LOCUS_46430 408738 406987 gene locus_tag LOCUS_46440 408738 406987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 409612 408758 gene locus_tag LOCUS_46450 409612 408758 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222961.1 protein_id gnl|my_center|LOCUS_46450 410788 409616 gene locus_tag LOCUS_46460 410788 409616 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222962.1 protein_id gnl|my_center|LOCUS_46460 410877 411215 gene locus_tag LOCUS_46470 410877 411215 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_46470 411197 411874 gene locus_tag LOCUS_46480 411197 411874 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222964.1 protein_id gnl|my_center|LOCUS_46480 411900 412268 gene locus_tag LOCUS_46490 411900 412268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 412255 412668 gene locus_tag LOCUS_46500 412255 412668 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222966.1 protein_id gnl|my_center|LOCUS_46500 412665 413213 gene locus_tag LOCUS_46510 412665 413213 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222967.1 protein_id gnl|my_center|LOCUS_46510 414034 413255 gene locus_tag LOCUS_46520 414034 413255 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_46520 414828 414049 gene locus_tag LOCUS_46530 gene paaX 414828 414049 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085674.1 protein_id gnl|my_center|LOCUS_46530 415091 415258 gene locus_tag LOCUS_46540 415091 415258 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222969.1 protein_id gnl|my_center|LOCUS_46540 415451 416902 gene locus_tag LOCUS_46550 415451 416902 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222970.1 protein_id gnl|my_center|LOCUS_46550 418134 416932 gene locus_tag LOCUS_46560 418134 416932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 419573 418221 gene locus_tag LOCUS_46570 419573 418221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 420845 419673 gene locus_tag LOCUS_46580 gene glgA 420845 419673 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133762.1 protein_id gnl|my_center|LOCUS_46580 421007 422155 gene locus_tag LOCUS_46590 gene glgC 421007 422155 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730299.1 protein_id gnl|my_center|LOCUS_46590 423018 422392 gene locus_tag LOCUS_46600 423018 422392 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_46600 423215 423826 gene locus_tag LOCUS_46610 gene sigE 423215 423826 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_46610 423823 424446 gene locus_tag LOCUS_46620 423823 424446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222976.1 protein_id gnl|my_center|LOCUS_46620 424529 426055 gene locus_tag LOCUS_46630 424529 426055 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286309.1 protein_id gnl|my_center|LOCUS_46630 426105 426485 gene locus_tag LOCUS_46640 gene tatB 426105 426485 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222978.1 protein_id gnl|my_center|LOCUS_46640 427796 426663 gene locus_tag LOCUS_46650 427796 426663 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_46650 427906 428391 gene locus_tag LOCUS_46660 427906 428391 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227819.1 protein_id gnl|my_center|LOCUS_46660 428930 428439 gene locus_tag LOCUS_46670 428930 428439 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222980.1 protein_id gnl|my_center|LOCUS_46670 430176 428923 gene locus_tag LOCUS_46680 430176 428923 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222981.1 protein_id gnl|my_center|LOCUS_46680 431088 430231 gene locus_tag LOCUS_46690 431088 430231 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222982.1 protein_id gnl|my_center|LOCUS_46690 431405 431085 gene locus_tag LOCUS_46700 431405 431085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 431535 432494 gene locus_tag LOCUS_46710 431535 432494 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_46710 432630 432821 gene locus_tag LOCUS_46720 432630 432821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 433124 432831 gene locus_tag LOCUS_46730 433124 432831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 433269 434465 gene locus_tag LOCUS_46740 433269 434465 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222986.1 protein_id gnl|my_center|LOCUS_46740 434649 435185 gene locus_tag LOCUS_46750 434649 435185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286307.1 protein_id gnl|my_center|LOCUS_46750 435370 436626 gene locus_tag LOCUS_46760 435370 436626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 protein_id gnl|my_center|LOCUS_46760 436623 437570 gene locus_tag LOCUS_46770 436623 437570 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222989.1 protein_id gnl|my_center|LOCUS_46770 437570 438415 gene locus_tag LOCUS_46780 437570 438415 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222990.1 protein_id gnl|my_center|LOCUS_46780 438420 439601 gene locus_tag LOCUS_46790 gene ugpC 438420 439601 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222991.1 protein_id gnl|my_center|LOCUS_46790 439886 440773 gene locus_tag LOCUS_46800 439886 440773 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229432.1 protein_id gnl|my_center|LOCUS_46800 440907 441887 gene locus_tag LOCUS_46810 440907 441887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 442723 441884 gene locus_tag LOCUS_46820 442723 441884 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223001.1 protein_id gnl|my_center|LOCUS_46820 443389 442736 gene locus_tag LOCUS_46830 443389 442736 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223002.1 protein_id gnl|my_center|LOCUS_46830 443505 444590 gene locus_tag LOCUS_46840 443505 444590 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403477.1 protein_id gnl|my_center|LOCUS_46840 445806 444730 gene locus_tag LOCUS_46850 gene corA 445806 444730 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_46850 446102 446605 gene locus_tag LOCUS_46860 446102 446605 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_46860 446607 447692 gene locus_tag LOCUS_46870 446607 447692 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223005.1 protein_id gnl|my_center|LOCUS_46870 448129 447707 gene locus_tag LOCUS_46880 448129 447707 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_46880 448263 448421 gene locus_tag LOCUS_46890 448263 448421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162472554.1 protein_id gnl|my_center|LOCUS_46890 448460 449020 gene locus_tag LOCUS_46900 448460 449020 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095467.1 protein_id gnl|my_center|LOCUS_46900 449035 449892 gene locus_tag LOCUS_46910 449035 449892 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223008.1 protein_id gnl|my_center|LOCUS_46910 449926 450765 gene locus_tag LOCUS_46920 449926 450765 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_46920 450776 451078 gene locus_tag LOCUS_46930 450776 451078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 451600 451118 gene locus_tag LOCUS_46940 451600 451118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 452688 451816 gene locus_tag LOCUS_46950 452688 451816 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_46950 454071 452731 gene locus_tag LOCUS_46960 454071 452731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324690.1 protein_id gnl|my_center|LOCUS_46960 456696 454939 gene locus_tag LOCUS_46970 456696 454939 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223014.1 protein_id gnl|my_center|LOCUS_46970 456949 457647 gene locus_tag LOCUS_46980 456949 457647 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223015.1 protein_id gnl|my_center|LOCUS_46980 457653 457919 gene locus_tag LOCUS_46990 457653 457919 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223016.1 protein_id gnl|my_center|LOCUS_46990 458363 458061 gene locus_tag LOCUS_47000 458363 458061 CDS product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223017.1 protein_id gnl|my_center|LOCUS_47000 459097 458363 gene locus_tag LOCUS_47010 459097 458363 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223018.1 protein_id gnl|my_center|LOCUS_47010 459162 460061 gene locus_tag LOCUS_47020 459162 460061 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466629.1 protein_id gnl|my_center|LOCUS_47020 460070 460981 gene locus_tag LOCUS_47030 460070 460981 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223020.1 protein_id gnl|my_center|LOCUS_47030 461775 461218 gene locus_tag LOCUS_47040 461775 461218 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_47040 462003 462989 gene locus_tag LOCUS_47050 462003 462989 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_47050 463102 464079 gene locus_tag LOCUS_47060 463102 464079 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223023.1 protein_id gnl|my_center|LOCUS_47060 464237 465409 gene locus_tag LOCUS_47070 gene moeZ 464237 465409 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223024.1 protein_id gnl|my_center|LOCUS_47070 465655 466458 gene locus_tag LOCUS_47080 465655 466458 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223025.1 protein_id gnl|my_center|LOCUS_47080 466554 468584 gene locus_tag LOCUS_47090 466554 468584 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_47090 468581 470023 gene locus_tag LOCUS_47100 468581 470023 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_47100 470124 471476 gene locus_tag LOCUS_47110 470124 471476 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223028.1 protein_id gnl|my_center|LOCUS_47110 471629 474100 gene locus_tag LOCUS_47120 gene nirB 471629 474100 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_47120 474097 474417 gene locus_tag LOCUS_47130 gene nirD 474097 474417 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401341.1 protein_id gnl|my_center|LOCUS_47130 474450 475529 gene locus_tag LOCUS_47140 474450 475529 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223031.1 protein_id gnl|my_center|LOCUS_47140 475526 476191 gene locus_tag LOCUS_47150 475526 476191 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080998.1 protein_id gnl|my_center|LOCUS_47150 476403 476807 gene locus_tag LOCUS_47160 476403 476807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 477096 476770 gene locus_tag LOCUS_47170 477096 476770 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286299.1 protein_id gnl|my_center|LOCUS_47170 477225 480368 gene locus_tag LOCUS_47180 477225 480368 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_47180 480439 483999 gene locus_tag LOCUS_47190 480439 483999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 484535 483996 gene locus_tag LOCUS_47200 484535 483996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 484995 484615 gene locus_tag LOCUS_47210 484995 484615 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971791.1 protein_id gnl|my_center|LOCUS_47210 485110 486477 gene locus_tag LOCUS_47220 485110 486477 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973791.1 protein_id gnl|my_center|LOCUS_47220 486474 487538 gene locus_tag LOCUS_47230 486474 487538 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223041.1 protein_id gnl|my_center|LOCUS_47230 489056 487569 gene locus_tag LOCUS_47240 489056 487569 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225439.1 protein_id gnl|my_center|LOCUS_47240 489736 489053 gene locus_tag LOCUS_47250 489736 489053 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225438.1 protein_id gnl|my_center|LOCUS_47250 490476 490877 gene locus_tag LOCUS_47260 490476 490877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 491746 490847 gene locus_tag LOCUS_47270 491746 490847 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224274.1 protein_id gnl|my_center|LOCUS_47270 492748 491762 gene locus_tag LOCUS_47280 492748 491762 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223052.1 protein_id gnl|my_center|LOCUS_47280 493118 494758 gene locus_tag LOCUS_47290 493118 494758 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_47290 494783 495082 gene locus_tag LOCUS_47300 494783 495082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 495092 496378 gene locus_tag LOCUS_47310 495092 496378 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_47310 496375 497763 gene locus_tag LOCUS_47320 496375 497763 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_47320 497760 498722 gene locus_tag LOCUS_47330 gene nudC 497760 498722 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223057.1 protein_id gnl|my_center|LOCUS_47330 498892 500082 gene locus_tag LOCUS_47340 498892 500082 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 protein_id gnl|my_center|LOCUS_47340 501202 500129 gene locus_tag LOCUS_47350 501202 500129 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971557.1 protein_id gnl|my_center|LOCUS_47350 501317 501697 gene locus_tag LOCUS_47360 501317 501697 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328136.1 protein_id gnl|my_center|LOCUS_47360 505989 501694 gene locus_tag LOCUS_47370 505989 501694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 507155 505986 gene locus_tag LOCUS_47380 507155 505986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 508636 507155 gene locus_tag LOCUS_47390 508636 507155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 508715 509662 gene locus_tag LOCUS_47400 508715 509662 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_47400 510407 509598 gene locus_tag LOCUS_47410 510407 509598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223073.1 protein_id gnl|my_center|LOCUS_47410 510999 510424 gene locus_tag LOCUS_47420 510999 510424 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976199.1 protein_id gnl|my_center|LOCUS_47420 511942 511004 gene locus_tag LOCUS_47430 511942 511004 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_47430 512579 512118 gene locus_tag LOCUS_47440 512579 512118 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223074.1 protein_id gnl|my_center|LOCUS_47440 512797 512570 gene locus_tag LOCUS_47450 512797 512570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 512691 513101 gene locus_tag LOCUS_47460 512691 513101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 513088 513351 gene locus_tag LOCUS_47470 513088 513351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 513609 513391 gene locus_tag LOCUS_47480 513609 513391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 513506 514387 gene locus_tag LOCUS_47490 513506 514387 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094629.1 protein_id gnl|my_center|LOCUS_47490 514428 515471 gene locus_tag LOCUS_47500 gene cobC 514428 515471 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129968.1 protein_id gnl|my_center|LOCUS_47500 515468 516295 gene locus_tag LOCUS_47510 515468 516295 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_47510 516292 517029 gene locus_tag LOCUS_47520 516292 517029 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_47520 517026 518144 gene locus_tag LOCUS_47530 517026 518144 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_47530 518698 518141 gene locus_tag LOCUS_47540 gene ssuE 518698 518141 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771200.1 protein_id gnl|my_center|LOCUS_47540 519398 519733 gene locus_tag LOCUS_47550 519398 519733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 520349 520005 gene locus_tag LOCUS_47560 520349 520005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 520733 521008 gene locus_tag LOCUS_47570 520733 521008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562703.1 protein_id gnl|my_center|LOCUS_47570 521012 521485 gene locus_tag LOCUS_47580 521012 521485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 521466 524327 gene locus_tag LOCUS_47590 521466 524327 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223090.1 protein_id gnl|my_center|LOCUS_47590 524521 526305 gene locus_tag LOCUS_47600 524521 526305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223091.1 protein_id gnl|my_center|LOCUS_47600 526305 526913 gene locus_tag LOCUS_47610 526305 526913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223092.1 protein_id gnl|my_center|LOCUS_47610 526915 527916 gene locus_tag LOCUS_47620 526915 527916 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223093.1 protein_id gnl|my_center|LOCUS_47620 527929 528456 gene locus_tag LOCUS_47630 527929 528456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 528464 528682 gene locus_tag LOCUS_47640 528464 528682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223095.1 protein_id gnl|my_center|LOCUS_47640 528704 530110 gene locus_tag LOCUS_47650 528704 530110 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_47650 530163 530831 gene locus_tag LOCUS_47660 gene npdG 530163 530831 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_47660 530831 531580 gene locus_tag LOCUS_47670 530831 531580 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_47670 532511 531570 gene locus_tag LOCUS_47680 gene pip 532511 531570 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204007.1 protein_id gnl|my_center|LOCUS_47680 533457 532603 gene locus_tag LOCUS_47690 gene panB 533457 532603 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_47690 535367 533679 gene locus_tag LOCUS_47700 535367 533679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 535426 536238 gene locus_tag LOCUS_47710 535426 536238 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_47710 537024 536275 gene locus_tag LOCUS_47720 537024 536275 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967172.1 protein_id gnl|my_center|LOCUS_47720 537145 537990 gene locus_tag LOCUS_47730 537145 537990 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_47730 538932 538102 gene locus_tag LOCUS_47740 538932 538102 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_47740 539063 539251 gene locus_tag LOCUS_47750 539063 539251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 539302 539583 gene locus_tag LOCUS_47760 539302 539583 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225328.1 protein_id gnl|my_center|LOCUS_47760 541134 539584 gene locus_tag LOCUS_47770 541134 539584 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223121.1 protein_id gnl|my_center|LOCUS_47770 541219 542934 gene locus_tag LOCUS_47780 541219 542934 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_47780 543712 543182 gene locus_tag LOCUS_47790 543712 543182 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115357.1 protein_id gnl|my_center|LOCUS_47790 545364 543838 gene locus_tag LOCUS_47800 545364 543838 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907794.1 protein_id gnl|my_center|LOCUS_47800 546041 545388 gene locus_tag LOCUS_47810 546041 545388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 546192 547535 gene locus_tag LOCUS_47820 gene glnA 546192 547535 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_47820 547547 552010 gene locus_tag LOCUS_47830 547547 552010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 >Feature sequence08 801 1658 gene locus_tag LOCUS_47840 801 1658 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_47840 2216 1665 gene locus_tag LOCUS_47850 2216 1665 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031069.1 protein_id gnl|my_center|LOCUS_47850 3685 2213 gene locus_tag LOCUS_47860 3685 2213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385703.1 protein_id gnl|my_center|LOCUS_47860 4452 3682 gene locus_tag LOCUS_47870 4452 3682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311615.1 protein_id gnl|my_center|LOCUS_47870 5393 4449 gene locus_tag LOCUS_47880 5393 4449 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_47880 6925 5390 gene locus_tag LOCUS_47890 6925 5390 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030775978.1 protein_id gnl|my_center|LOCUS_47890 7734 6937 gene locus_tag LOCUS_47900 7734 6937 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143020.1 protein_id gnl|my_center|LOCUS_47900 8912 7731 gene locus_tag LOCUS_47910 8912 7731 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132388.1 protein_id gnl|my_center|LOCUS_47910 9910 8909 gene locus_tag LOCUS_47920 9910 8909 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_47920 10956 9907 gene locus_tag LOCUS_47930 gene cysK2 10956 9907 CDS product S-sulfocysteine synthase CysK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935595.1 protein_id gnl|my_center|LOCUS_47930 11816 10977 gene locus_tag LOCUS_47940 11816 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 13128 11872 gene locus_tag LOCUS_47950 13128 11872 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226592.1 protein_id gnl|my_center|LOCUS_47950 13031 13219 gene locus_tag LOCUS_47960 13031 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 13802 13272 gene locus_tag LOCUS_47970 13802 13272 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892919.1 protein_id gnl|my_center|LOCUS_47970 13851 14777 gene locus_tag LOCUS_47980 13851 14777 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_47980 15791 14811 gene locus_tag LOCUS_47990 15791 14811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 16313 15942 gene locus_tag LOCUS_48000 16313 15942 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190696.1 protein_id gnl|my_center|LOCUS_48000 17693 16542 gene locus_tag LOCUS_48010 17693 16542 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747155.1 protein_id gnl|my_center|LOCUS_48010 17862 18977 gene locus_tag LOCUS_48020 17862 18977 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143051171.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48020 18974 19723 gene locus_tag LOCUS_48030 18974 19723 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029146.1 protein_id gnl|my_center|LOCUS_48030 19945 19724 gene locus_tag LOCUS_48040 19945 19724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 20009 20356 gene locus_tag LOCUS_48050 20009 20356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 21129 20353 gene locus_tag LOCUS_48060 21129 20353 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_48060 22628 21126 gene locus_tag LOCUS_48070 22628 21126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103962448.1 protein_id gnl|my_center|LOCUS_48070 23548 22625 gene locus_tag LOCUS_48080 23548 22625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228283.1 protein_id gnl|my_center|LOCUS_48080 23698 24849 gene locus_tag LOCUS_48090 23698 24849 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030388.1 protein_id gnl|my_center|LOCUS_48090 24846 25514 gene locus_tag LOCUS_48100 24846 25514 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_48100 26589 25561 gene locus_tag LOCUS_48110 26589 25561 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_48110 26969 28279 gene locus_tag LOCUS_48120 26969 28279 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 protein_id gnl|my_center|LOCUS_48120 28349 29314 gene locus_tag LOCUS_48130 28349 29314 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467636.1 protein_id gnl|my_center|LOCUS_48130 29311 30177 gene locus_tag LOCUS_48140 29311 30177 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_48140 30185 31690 gene locus_tag LOCUS_48150 30185 31690 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 protein_id gnl|my_center|LOCUS_48150 34236 31852 gene locus_tag LOCUS_48160 34236 31852 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_48160 34770 34354 gene locus_tag LOCUS_48170 34770 34354 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078910.1 protein_id gnl|my_center|LOCUS_48170 35236 34772 gene locus_tag LOCUS_48180 35236 34772 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 protein_id gnl|my_center|LOCUS_48180 36354 35317 gene locus_tag LOCUS_48190 gene sigG 36354 35317 CDS product sigma-70 family RNA polymerase sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401110.1 protein_id gnl|my_center|LOCUS_48190 36433 37248 gene locus_tag LOCUS_48200 36433 37248 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226536.1 protein_id gnl|my_center|LOCUS_48200 38563 37361 gene locus_tag LOCUS_48210 38563 37361 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028228.1 protein_id gnl|my_center|LOCUS_48210 38702 39736 gene locus_tag LOCUS_48220 38702 39736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 40092 39697 gene locus_tag LOCUS_48230 40092 39697 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229837.1 protein_id gnl|my_center|LOCUS_48230 41582 40122 gene locus_tag LOCUS_48240 41582 40122 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485352.1 protein_id gnl|my_center|LOCUS_48240 42144 41656 gene locus_tag LOCUS_48250 42144 41656 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337336.1 protein_id gnl|my_center|LOCUS_48250 43539 42196 gene locus_tag LOCUS_48260 43539 42196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 44395 43781 gene locus_tag LOCUS_48270 44395 43781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 45248 44598 gene locus_tag LOCUS_48280 45248 44598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 46390 45233 gene locus_tag LOCUS_48290 46390 45233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 47447 46383 gene locus_tag LOCUS_48300 47447 46383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 47492 47803 gene locus_tag LOCUS_48310 47492 47803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 47833 49233 gene locus_tag LOCUS_48320 47833 49233 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469007.1 protein_id gnl|my_center|LOCUS_48320 49236 50237 gene locus_tag LOCUS_48330 49236 50237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 50234 50890 gene locus_tag LOCUS_48340 50234 50890 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_48340 51642 50860 gene locus_tag LOCUS_48350 51642 50860 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029682.1 protein_id gnl|my_center|LOCUS_48350 51748 52644 gene locus_tag LOCUS_48360 51748 52644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_48360 52641 53492 gene locus_tag LOCUS_48370 52641 53492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_48370 54390 53524 gene locus_tag LOCUS_48380 54390 53524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 54332 54646 gene locus_tag LOCUS_48390 54332 54646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 55356 54718 gene locus_tag LOCUS_48400 55356 54718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896615.1 protein_id gnl|my_center|LOCUS_48400 55374 55547 gene locus_tag LOCUS_48410 55374 55547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 55624 57114 gene locus_tag LOCUS_48420 55624 57114 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223125.1 protein_id gnl|my_center|LOCUS_48420 57149 58003 gene locus_tag LOCUS_48430 57149 58003 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228350.1 protein_id gnl|my_center|LOCUS_48430 58474 59001 gene locus_tag LOCUS_48440 58474 59001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 59111 59467 gene locus_tag LOCUS_48450 59111 59467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 60190 59618 gene locus_tag LOCUS_48460 60190 59618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 61356 60196 gene locus_tag LOCUS_48470 61356 60196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 61636 61400 gene locus_tag LOCUS_48480 61636 61400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 61946 61767 gene locus_tag LOCUS_48490 61946 61767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 62120 62485 gene locus_tag LOCUS_48500 62120 62485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 62607 63041 gene locus_tag LOCUS_48510 62607 63041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 63193 64224 gene locus_tag LOCUS_48520 63193 64224 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_48520 64352 65362 gene locus_tag LOCUS_48530 64352 65362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 65359 66096 gene locus_tag LOCUS_48540 65359 66096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_48540 66093 67400 gene locus_tag LOCUS_48550 66093 67400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 67908 68720 gene locus_tag LOCUS_48560 67908 68720 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218604714.1 protein_id gnl|my_center|LOCUS_48560 68900 70384 gene locus_tag LOCUS_48570 68900 70384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 72248 71451 gene locus_tag LOCUS_48580 72248 71451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 73066 72482 gene locus_tag LOCUS_48590 73066 72482 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226262.1 protein_id gnl|my_center|LOCUS_48590 73256 74422 gene locus_tag LOCUS_48600 73256 74422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 74758 76992 gene locus_tag LOCUS_48610 74758 76992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 77376 78644 gene locus_tag LOCUS_48620 77376 78644 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730801.1 protein_id gnl|my_center|LOCUS_48620 78720 80258 gene locus_tag LOCUS_48630 78720 80258 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223435.1 protein_id gnl|my_center|LOCUS_48630 80246 80887 gene locus_tag LOCUS_48640 80246 80887 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 protein_id gnl|my_center|LOCUS_48640 80995 82035 gene locus_tag LOCUS_48650 80995 82035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887741.1 protein_id gnl|my_center|LOCUS_48650 82032 82838 gene locus_tag LOCUS_48660 82032 82838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 82835 83164 gene locus_tag LOCUS_48670 82835 83164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 83161 84252 gene locus_tag LOCUS_48680 83161 84252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731325.1 protein_id gnl|my_center|LOCUS_48680 84521 85279 gene locus_tag LOCUS_48690 84521 85279 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223420.1 protein_id gnl|my_center|LOCUS_48690 85276 86523 gene locus_tag LOCUS_48700 85276 86523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 87226 86531 gene locus_tag LOCUS_48710 gene urtE 87226 86531 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894358.1 protein_id gnl|my_center|LOCUS_48710 88002 87226 gene locus_tag LOCUS_48720 gene urtD 88002 87226 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 protein_id gnl|my_center|LOCUS_48720 89039 87999 gene locus_tag LOCUS_48730 gene urtC 89039 87999 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 protein_id gnl|my_center|LOCUS_48730 89911 89036 gene locus_tag LOCUS_48740 gene urtB 89911 89036 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_48740 91128 89911 gene locus_tag LOCUS_48750 gene urtA 91128 89911 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 protein_id gnl|my_center|LOCUS_48750 91388 92518 gene locus_tag LOCUS_48760 91388 92518 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112799.1 protein_id gnl|my_center|LOCUS_48760 94630 92534 gene locus_tag LOCUS_48770 94630 92534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 94647 95633 gene locus_tag LOCUS_48780 94647 95633 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027480.1 protein_id gnl|my_center|LOCUS_48780 95683 96546 gene locus_tag LOCUS_48790 95683 96546 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230371.1 protein_id gnl|my_center|LOCUS_48790 98823 96619 gene locus_tag LOCUS_48800 98823 96619 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227076.1 protein_id gnl|my_center|LOCUS_48800 100061 98973 gene locus_tag LOCUS_48810 100061 98973 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972380.1 protein_id gnl|my_center|LOCUS_48810 102889 100529 gene locus_tag LOCUS_48820 102889 100529 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229028.1 protein_id gnl|my_center|LOCUS_48820 104324 103098 gene locus_tag LOCUS_48830 104324 103098 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 protein_id gnl|my_center|LOCUS_48830 104511 106169 gene locus_tag LOCUS_48840 104511 106169 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467774.1 protein_id gnl|my_center|LOCUS_48840 106166 107266 gene locus_tag LOCUS_48850 106166 107266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_48850 107263 108243 gene locus_tag LOCUS_48860 107263 108243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_48860 108247 109239 gene locus_tag LOCUS_48870 108247 109239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 protein_id gnl|my_center|LOCUS_48870 109236 110276 gene locus_tag LOCUS_48880 109236 110276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_48880 110318 111718 gene locus_tag LOCUS_48890 110318 111718 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230096.1 protein_id gnl|my_center|LOCUS_48890 113976 111859 gene locus_tag LOCUS_48900 113976 111859 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226394.1 protein_id gnl|my_center|LOCUS_48900 114156 114674 gene locus_tag LOCUS_48910 114156 114674 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226392.1 protein_id gnl|my_center|LOCUS_48910 114759 115511 gene locus_tag LOCUS_48920 114759 115511 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878120.1 protein_id gnl|my_center|LOCUS_48920 115583 116185 gene locus_tag LOCUS_48930 115583 116185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 117321 116272 gene locus_tag LOCUS_48940 117321 116272 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742235.1 protein_id gnl|my_center|LOCUS_48940 117453 117956 gene locus_tag LOCUS_48950 117453 117956 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 protein_id gnl|my_center|LOCUS_48950 118411 117962 gene locus_tag LOCUS_48960 118411 117962 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227124.1 protein_id gnl|my_center|LOCUS_48960 119945 118422 gene locus_tag LOCUS_48970 119945 118422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 120126 120725 gene locus_tag LOCUS_48980 gene ruvC 120126 120725 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_48980 120722 121315 gene locus_tag LOCUS_48990 gene ruvA 120722 121315 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227122.1 protein_id gnl|my_center|LOCUS_48990 121312 122376 gene locus_tag LOCUS_49000 gene ruvB 121312 122376 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467235.1 protein_id gnl|my_center|LOCUS_49000 122475 122837 gene locus_tag LOCUS_49010 122475 122837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 122978 124822 gene locus_tag LOCUS_49020 gene secD 122978 124822 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467234.1 protein_id gnl|my_center|LOCUS_49020 124824 126011 gene locus_tag LOCUS_49030 gene secF 124824 126011 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227118.1 protein_id gnl|my_center|LOCUS_49030 126008 126526 gene locus_tag LOCUS_49040 126008 126526 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227117.1 protein_id gnl|my_center|LOCUS_49040 126739 129039 gene locus_tag LOCUS_49050 126739 129039 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227116.1 protein_id gnl|my_center|LOCUS_49050 130136 129285 gene locus_tag LOCUS_49060 130136 129285 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227106.1 protein_id gnl|my_center|LOCUS_49060 130282 130989 gene locus_tag LOCUS_49070 130282 130989 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_49070 130994 132256 gene locus_tag LOCUS_49080 gene hisS 130994 132256 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894356.1 protein_id gnl|my_center|LOCUS_49080 132253 132882 gene locus_tag LOCUS_49090 132253 132882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227104.1 protein_id gnl|my_center|LOCUS_49090 133762 132899 gene locus_tag LOCUS_49100 133762 132899 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_49100 134177 133770 gene locus_tag LOCUS_49110 134177 133770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 134176 134559 gene locus_tag LOCUS_49120 134176 134559 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224159.1 protein_id gnl|my_center|LOCUS_49120 135916 134486 gene locus_tag LOCUS_49130 135916 134486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 136081 136707 gene locus_tag LOCUS_49140 136081 136707 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_49140 137783 136686 gene locus_tag LOCUS_49150 137783 136686 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_49150 138415 137780 gene locus_tag LOCUS_49160 gene pnuC 138415 137780 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_49160 138462 140366 gene locus_tag LOCUS_49170 138462 140366 CDS product intein-containing Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324692.1 protein_id gnl|my_center|LOCUS_49170 142172 140787 gene locus_tag LOCUS_49180 142172 140787 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222690.1 protein_id gnl|my_center|LOCUS_49180 142266 142643 gene locus_tag LOCUS_49190 142266 142643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 142740 143339 gene locus_tag LOCUS_49200 142740 143339 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867225.1 protein_id gnl|my_center|LOCUS_49200 143336 144085 gene locus_tag LOCUS_49210 143336 144085 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270155.1 protein_id gnl|my_center|LOCUS_49210 144082 145323 gene locus_tag LOCUS_49220 144082 145323 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224751.1 protein_id gnl|my_center|LOCUS_49220 145320 145640 gene locus_tag LOCUS_49230 145320 145640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 145637 146791 gene locus_tag LOCUS_49240 145637 146791 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224752.1 protein_id gnl|my_center|LOCUS_49240 146788 148383 gene locus_tag LOCUS_49250 146788 148383 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_49250 148391 150256 gene locus_tag LOCUS_49260 148391 150256 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_49260 150253 151446 gene locus_tag LOCUS_49270 150253 151446 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224755.1 protein_id gnl|my_center|LOCUS_49270 152410 151448 gene locus_tag LOCUS_49280 152410 151448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_49280 153069 152878 gene locus_tag LOCUS_49290 153069 152878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 153164 154282 gene locus_tag LOCUS_49300 153164 154282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 154318 155442 gene locus_tag LOCUS_49310 154318 155442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 155935 155450 gene locus_tag LOCUS_49320 155935 155450 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571271.1 protein_id gnl|my_center|LOCUS_49320 156168 157352 gene locus_tag LOCUS_49330 156168 157352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 158357 157458 gene locus_tag LOCUS_49340 158357 157458 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222176.1 protein_id gnl|my_center|LOCUS_49340 158857 158354 gene locus_tag LOCUS_49350 158857 158354 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222175.1 protein_id gnl|my_center|LOCUS_49350 160602 158902 gene locus_tag LOCUS_49360 160602 158902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223080.1 protein_id gnl|my_center|LOCUS_49360 161354 160599 gene locus_tag LOCUS_49370 161354 160599 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222179.1 protein_id gnl|my_center|LOCUS_49370 162604 161351 gene locus_tag LOCUS_49380 162604 161351 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222180.1 protein_id gnl|my_center|LOCUS_49380 162744 163175 gene locus_tag LOCUS_49390 162744 163175 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284971.1 protein_id gnl|my_center|LOCUS_49390 163244 165016 gene locus_tag LOCUS_49400 gene aspS 163244 165016 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_49400 165021 165962 gene locus_tag LOCUS_49410 165021 165962 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466857.1 protein_id gnl|my_center|LOCUS_49410 166075 167274 gene locus_tag LOCUS_49420 166075 167274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224572.1 protein_id gnl|my_center|LOCUS_49420 167326 168150 gene locus_tag LOCUS_49430 167326 168150 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224573.1 protein_id gnl|my_center|LOCUS_49430 169984 168155 gene locus_tag LOCUS_49440 169984 168155 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228529.1 protein_id gnl|my_center|LOCUS_49440 171189 169981 gene locus_tag LOCUS_49450 171189 169981 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228528.1 protein_id gnl|my_center|LOCUS_49450 173018 171228 gene locus_tag LOCUS_49460 173018 171228 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228518.1 protein_id gnl|my_center|LOCUS_49460 172701 172610 gene locus_tag LOCUS_t00540 172701 172610 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 174473 173097 gene locus_tag LOCUS_49470 174473 173097 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876236.1 protein_id gnl|my_center|LOCUS_49470 175263 174523 gene locus_tag LOCUS_49480 175263 174523 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_49480 175435 176007 gene locus_tag LOCUS_49490 175435 176007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 176019 176681 gene locus_tag LOCUS_49500 176019 176681 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228316.1 protein_id gnl|my_center|LOCUS_49500 176709 178508 gene locus_tag LOCUS_49510 176709 178508 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_49510 178505 179014 gene locus_tag LOCUS_49520 gene mug 178505 179014 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_49520 179506 178991 gene locus_tag LOCUS_49530 179506 178991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 179797 180018 gene locus_tag LOCUS_49540 179797 180018 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222201.1 protein_id gnl|my_center|LOCUS_49540 180567 180040 gene locus_tag LOCUS_49550 180567 180040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 181142 182635 gene locus_tag LOCUS_49560 181142 182635 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467238.1 protein_id gnl|my_center|LOCUS_49560 182896 187737 gene locus_tag LOCUS_49570 182896 187737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 189551 188190 gene locus_tag LOCUS_49580 189551 188190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 190483 189524 gene locus_tag LOCUS_49590 190483 189524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 190583 191536 gene locus_tag LOCUS_49600 190583 191536 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_49600 191708 192805 gene locus_tag LOCUS_49610 191708 192805 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769496.1 protein_id gnl|my_center|LOCUS_49610 194000 192783 gene locus_tag LOCUS_49620 194000 192783 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223217130.1 protein_id gnl|my_center|LOCUS_49620 195472 193997 gene locus_tag LOCUS_49630 195472 193997 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_49630 196518 195469 gene locus_tag LOCUS_49640 196518 195469 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061727.1 protein_id gnl|my_center|LOCUS_49640 196600 197457 gene locus_tag LOCUS_49650 196600 197457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 197454 198689 gene locus_tag LOCUS_49660 197454 198689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 198756 200075 gene locus_tag LOCUS_49670 198756 200075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 201855 200617 gene locus_tag LOCUS_49680 201855 200617 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223772.1 protein_id gnl|my_center|LOCUS_49680 201879 202751 gene locus_tag LOCUS_49690 201879 202751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 202754 204802 gene locus_tag LOCUS_49700 202754 204802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 204996 206522 gene locus_tag LOCUS_49710 204996 206522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 206533 207009 gene locus_tag LOCUS_49720 206533 207009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 207832 207047 gene locus_tag LOCUS_49730 207832 207047 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284646.1 protein_id gnl|my_center|LOCUS_49730 207909 208376 gene locus_tag LOCUS_49740 207909 208376 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976461.1 protein_id gnl|my_center|LOCUS_49740 208631 209023 gene locus_tag LOCUS_49750 208631 209023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 211894 209117 gene locus_tag LOCUS_49760 211894 209117 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_49760 212175 213398 gene locus_tag LOCUS_49770 212175 213398 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228794.1 protein_id gnl|my_center|LOCUS_49770 213445 213885 gene locus_tag LOCUS_49780 213445 213885 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226133.1 protein_id gnl|my_center|LOCUS_49780 215609 214032 gene locus_tag LOCUS_49790 215609 214032 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092532455.1 protein_id gnl|my_center|LOCUS_49790 216631 215606 gene locus_tag LOCUS_49800 216631 215606 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226131.1 protein_id gnl|my_center|LOCUS_49800 218923 216647 gene locus_tag LOCUS_49810 218923 216647 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_49810 219845 219069 gene locus_tag LOCUS_49820 219845 219069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 220980 219883 gene locus_tag LOCUS_49830 220980 219883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 221267 222511 gene locus_tag LOCUS_49840 221267 222511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086251.1 protein_id gnl|my_center|LOCUS_49840 222508 223497 gene locus_tag LOCUS_49850 222508 223497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729335.1 protein_id gnl|my_center|LOCUS_49850 223494 225899 gene locus_tag LOCUS_49860 223494 225899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 225893 227074 gene locus_tag LOCUS_49870 225893 227074 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877825.1 protein_id gnl|my_center|LOCUS_49870 227120 227584 gene locus_tag LOCUS_49880 227120 227584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 227646 227963 gene locus_tag LOCUS_49890 227646 227963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 227960 228379 gene locus_tag LOCUS_49900 gene zntR 227960 228379 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174611.1 protein_id gnl|my_center|LOCUS_49900 228414 229214 gene locus_tag LOCUS_49910 228414 229214 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098166.1 protein_id gnl|my_center|LOCUS_49910 229744 229211 gene locus_tag LOCUS_49920 229744 229211 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002063889.1 protein_id gnl|my_center|LOCUS_49920 229812 230708 gene locus_tag LOCUS_49930 229812 230708 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_49930 230871 230680 gene locus_tag LOCUS_49940 230871 230680 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974539.1 protein_id gnl|my_center|LOCUS_49940 231731 230868 gene locus_tag LOCUS_49950 231731 230868 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_49950 231807 232043 gene locus_tag LOCUS_49960 231807 232043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 233394 232024 gene locus_tag LOCUS_49970 233394 232024 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_49970 233579 234538 gene locus_tag LOCUS_49980 233579 234538 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898763.1 protein_id gnl|my_center|LOCUS_49980 234572 235852 gene locus_tag LOCUS_49990 234572 235852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 236470 237264 gene locus_tag LOCUS_50000 236470 237264 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085761.1 protein_id gnl|my_center|LOCUS_50000 237252 238022 gene locus_tag LOCUS_50010 237252 238022 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803880.1 protein_id gnl|my_center|LOCUS_50010 238039 238995 gene locus_tag LOCUS_50020 238039 238995 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086423.1 protein_id gnl|my_center|LOCUS_50020 241035 239179 gene locus_tag LOCUS_50030 241035 239179 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230810.1 protein_id gnl|my_center|LOCUS_50030 241856 241032 gene locus_tag LOCUS_50040 241856 241032 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803881.1 protein_id gnl|my_center|LOCUS_50040 242270 243406 gene locus_tag LOCUS_50050 242270 243406 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113360.1 protein_id gnl|my_center|LOCUS_50050 243411 243890 gene locus_tag LOCUS_50060 243411 243890 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973023.1 protein_id gnl|my_center|LOCUS_50060 243916 244815 gene locus_tag LOCUS_50070 243916 244815 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_50070 245002 245934 gene locus_tag LOCUS_50080 245002 245934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 246266 247072 gene locus_tag LOCUS_50090 246266 247072 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284474.1 protein_id gnl|my_center|LOCUS_50090 247069 247236 gene locus_tag LOCUS_50100 247069 247236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 247589 247299 gene locus_tag LOCUS_50110 247589 247299 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227045.1 protein_id gnl|my_center|LOCUS_50110 248248 247586 gene locus_tag LOCUS_50120 248248 247586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 248733 248245 gene locus_tag LOCUS_50130 248733 248245 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225267572.1 protein_id gnl|my_center|LOCUS_50130 248793 249743 gene locus_tag LOCUS_50140 248793 249743 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226134.1 protein_id gnl|my_center|LOCUS_50140 250128 249766 gene locus_tag LOCUS_50150 gene trxA 250128 249766 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_50150 250287 251189 gene locus_tag LOCUS_50160 250287 251189 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223399.1 protein_id gnl|my_center|LOCUS_50160 251179 252093 gene locus_tag LOCUS_50170 251179 252093 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223400.1 protein_id gnl|my_center|LOCUS_50170 252090 252848 gene locus_tag LOCUS_50180 252090 252848 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223401.1 protein_id gnl|my_center|LOCUS_50180 252849 254618 gene locus_tag LOCUS_50190 252849 254618 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223402.1 protein_id gnl|my_center|LOCUS_50190 256058 255015 gene locus_tag LOCUS_50200 256058 255015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072478723.1 protein_id gnl|my_center|LOCUS_50200 256234 256620 gene locus_tag LOCUS_50210 256234 256620 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_50210 256617 257759 gene locus_tag LOCUS_50220 gene cbiE 256617 257759 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_50220 257756 258499 gene locus_tag LOCUS_50230 gene cobM 257756 258499 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 protein_id gnl|my_center|LOCUS_50230 259740 258682 gene locus_tag LOCUS_50240 259740 258682 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 protein_id gnl|my_center|LOCUS_50240 259764 260468 gene locus_tag LOCUS_50250 259764 260468 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_50250 261900 260443 gene locus_tag LOCUS_50260 261900 260443 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 protein_id gnl|my_center|LOCUS_50260 262523 261897 gene locus_tag LOCUS_50270 262523 261897 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_50270 263530 262520 gene locus_tag LOCUS_50280 gene cobG 263530 262520 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900454.1 protein_id gnl|my_center|LOCUS_50280 263706 267272 gene locus_tag LOCUS_50290 gene cobN 263706 267272 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228832.1 protein_id gnl|my_center|LOCUS_50290 267841 269127 gene locus_tag LOCUS_50300 267841 269127 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 protein_id gnl|my_center|LOCUS_50300 269127 270131 gene locus_tag LOCUS_50310 269127 270131 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_50310 270131 271030 gene locus_tag LOCUS_50320 270131 271030 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_50320 271033 272454 gene locus_tag LOCUS_50330 271033 272454 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286145.1 protein_id gnl|my_center|LOCUS_50330 272451 273482 gene locus_tag LOCUS_50340 272451 273482 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971590.1 protein_id gnl|my_center|LOCUS_50340 273795 276557 gene locus_tag LOCUS_50350 273795 276557 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227003.1 protein_id gnl|my_center|LOCUS_50350 276867 276565 gene locus_tag LOCUS_50360 276867 276565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 279651 276997 gene locus_tag LOCUS_50370 279651 276997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 282883 279737 gene locus_tag LOCUS_50380 282883 279737 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_50380 283011 283541 gene locus_tag LOCUS_50390 283011 283541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222754.1 protein_id gnl|my_center|LOCUS_50390 284789 283614 gene locus_tag LOCUS_50400 284789 283614 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_50400 284848 285984 gene locus_tag LOCUS_50410 gene xylA 284848 285984 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228546.1 protein_id gnl|my_center|LOCUS_50410 285984 287363 gene locus_tag LOCUS_50420 gene xylB 285984 287363 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_50420 288297 287416 gene locus_tag LOCUS_50430 288297 287416 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328866.1 protein_id gnl|my_center|LOCUS_50430 288397 289008 gene locus_tag LOCUS_50440 288397 289008 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862793.1 protein_id gnl|my_center|LOCUS_50440 290174 289302 gene locus_tag LOCUS_50450 290174 289302 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_50450 290088 291095 gene locus_tag LOCUS_50460 290088 291095 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226131.1 protein_id gnl|my_center|LOCUS_50460 291395 291120 gene locus_tag LOCUS_50470 291395 291120 CDS product DUF6480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227627.1 protein_id gnl|my_center|LOCUS_50470 291442 292014 gene locus_tag LOCUS_50480 291442 292014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50480 292011 292259 gene locus_tag LOCUS_50490 292011 292259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50490 292256 292984 gene locus_tag LOCUS_50500 292256 292984 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031621.1 protein_id gnl|my_center|LOCUS_50500 292989 293510 gene locus_tag LOCUS_50510 292989 293510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 294306 293788 gene locus_tag LOCUS_50520 294306 293788 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227042.1 protein_id gnl|my_center|LOCUS_50520 294456 294971 gene locus_tag LOCUS_50530 294456 294971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50530 294968 295960 gene locus_tag LOCUS_50540 294968 295960 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030719.1 protein_id gnl|my_center|LOCUS_50540 295957 296835 gene locus_tag LOCUS_50550 295957 296835 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_50550 296832 298037 gene locus_tag LOCUS_50560 296832 298037 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_50560 298034 298609 gene locus_tag LOCUS_50570 298034 298609 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030722.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50570 298606 299892 gene locus_tag LOCUS_50580 gene rfaE2 298606 299892 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270276.1 protein_id gnl|my_center|LOCUS_50580 299892 300572 gene locus_tag LOCUS_50590 299892 300572 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 protein_id gnl|my_center|LOCUS_50590 300563 301741 gene locus_tag LOCUS_50600 300563 301741 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 protein_id gnl|my_center|LOCUS_50600 301762 302268 gene locus_tag LOCUS_50610 301762 302268 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677243.1 protein_id gnl|my_center|LOCUS_50610 302333 304585 gene locus_tag LOCUS_50620 gene helR 302333 304585 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081619.1 protein_id gnl|my_center|LOCUS_50620 305505 304831 gene locus_tag LOCUS_50630 305505 304831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228334.1 protein_id gnl|my_center|LOCUS_50630 305929 305588 gene locus_tag LOCUS_50640 305929 305588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 307146 305974 gene locus_tag LOCUS_50650 307146 305974 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_50650 307236 308057 gene locus_tag LOCUS_50660 307236 308057 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226107.1 protein_id gnl|my_center|LOCUS_50660 308528 308073 gene locus_tag LOCUS_50670 308528 308073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 308656 309132 gene locus_tag LOCUS_50680 308656 309132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 309234 309893 gene locus_tag LOCUS_50690 309234 309893 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_50690 309890 311230 gene locus_tag LOCUS_50700 309890 311230 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 protein_id gnl|my_center|LOCUS_50700 311645 311247 gene locus_tag LOCUS_50710 311645 311247 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228348.1 protein_id gnl|my_center|LOCUS_50710 311716 313083 gene locus_tag LOCUS_50720 311716 313083 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226111.1 protein_id gnl|my_center|LOCUS_50720 313706 313104 gene locus_tag LOCUS_50730 313706 313104 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_50730 314794 313703 gene locus_tag LOCUS_50740 314794 313703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 314948 315862 gene locus_tag LOCUS_50750 314948 315862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_50750 315859 316563 gene locus_tag LOCUS_50760 315859 316563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974898.1 protein_id gnl|my_center|LOCUS_50760 317899 316616 gene locus_tag LOCUS_50770 317899 316616 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_50770 318762 317857 gene locus_tag LOCUS_50780 318762 317857 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_50780 319790 318759 gene locus_tag LOCUS_50790 319790 318759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 321403 319787 gene locus_tag LOCUS_50800 321403 319787 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_50800 322397 321471 gene locus_tag LOCUS_50810 322397 321471 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742236.1 protein_id gnl|my_center|LOCUS_50810 322458 323306 gene locus_tag LOCUS_50820 322458 323306 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226123.1 protein_id gnl|my_center|LOCUS_50820 324132 323686 gene locus_tag LOCUS_50830 324132 323686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 324256 325071 gene locus_tag LOCUS_50840 324256 325071 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_50840 325651 325142 gene locus_tag LOCUS_50850 325651 325142 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028522.1 protein_id gnl|my_center|LOCUS_50850 325681 326511 gene locus_tag LOCUS_50860 325681 326511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 328136 326916 gene locus_tag LOCUS_50870 328136 326916 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454989.1 protein_id gnl|my_center|LOCUS_50870 328367 328224 gene locus_tag LOCUS_50880 328367 328224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 331113 328768 gene locus_tag LOCUS_50890 331113 328768 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224843.1 protein_id gnl|my_center|LOCUS_50890 331826 331110 gene locus_tag LOCUS_50900 331826 331110 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224844.1 protein_id gnl|my_center|LOCUS_50900 331896 333203 gene locus_tag LOCUS_50910 331896 333203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50910 333527 333207 gene locus_tag LOCUS_50920 333527 333207 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229238.1 protein_id gnl|my_center|LOCUS_50920 333484 334017 gene locus_tag LOCUS_50930 333484 334017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 334023 334154 gene locus_tag LOCUS_50940 334023 334154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 334769 334158 gene locus_tag LOCUS_50950 334769 334158 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 protein_id gnl|my_center|LOCUS_50950 335119 334766 gene locus_tag LOCUS_50960 335119 334766 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224722.1 protein_id gnl|my_center|LOCUS_50960 335227 335874 gene locus_tag LOCUS_50970 335227 335874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 336076 336876 gene locus_tag LOCUS_50980 336076 336876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 336996 337739 gene locus_tag LOCUS_50990 336996 337739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228287.1 protein_id gnl|my_center|LOCUS_50990 338103 337756 gene locus_tag LOCUS_51000 338103 337756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 339249 338248 gene locus_tag LOCUS_51010 339249 338248 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_51010 339717 339367 gene locus_tag LOCUS_51020 339717 339367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 340589 339717 gene locus_tag LOCUS_51030 340589 339717 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_51030 340725 341264 gene locus_tag LOCUS_51040 340725 341264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 342175 341261 gene locus_tag LOCUS_51050 342175 341261 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840011.1 protein_id gnl|my_center|LOCUS_51050 342285 343577 gene locus_tag LOCUS_51060 342285 343577 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227012.1 protein_id gnl|my_center|LOCUS_51060 343577 344140 gene locus_tag LOCUS_51070 343577 344140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 345194 344151 gene locus_tag LOCUS_51080 345194 344151 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_51080 346500 345472 gene locus_tag LOCUS_51090 346500 345472 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845572.1 protein_id gnl|my_center|LOCUS_51090 347344 346526 gene locus_tag LOCUS_51100 347344 346526 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803810.1 protein_id gnl|my_center|LOCUS_51100 348195 347341 gene locus_tag LOCUS_51110 348195 347341 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972115.1 protein_id gnl|my_center|LOCUS_51110 349490 348195 gene locus_tag LOCUS_51120 349490 348195 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_51120 349741 350673 gene locus_tag LOCUS_51130 349741 350673 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_51130 350667 352973 gene locus_tag LOCUS_51140 350667 352973 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026995.1 protein_id gnl|my_center|LOCUS_51140 354205 353237 gene locus_tag LOCUS_51150 gene axeA 354205 353237 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_51150 354309 355331 gene locus_tag LOCUS_51160 354309 355331 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027465.1 protein_id gnl|my_center|LOCUS_51160 355722 357341 gene locus_tag LOCUS_51170 355722 357341 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027200.1 protein_id gnl|my_center|LOCUS_51170 357351 358463 gene locus_tag LOCUS_51180 357351 358463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 358620 359027 gene locus_tag LOCUS_51190 358620 359027 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224534.1 protein_id gnl|my_center|LOCUS_51190 359031 360227 gene locus_tag LOCUS_51200 359031 360227 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_51200 360261 360665 gene locus_tag LOCUS_51210 360261 360665 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 protein_id gnl|my_center|LOCUS_51210 360898 364155 gene locus_tag LOCUS_51220 360898 364155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224182.1 protein_id gnl|my_center|LOCUS_51220 364705 364070 gene locus_tag LOCUS_51230 364705 364070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 365116 366594 gene locus_tag LOCUS_51240 365116 366594 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931335.1 protein_id gnl|my_center|LOCUS_51240 368019 366676 gene locus_tag LOCUS_51250 gene murD 368019 366676 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 protein_id gnl|my_center|LOCUS_51250 369349 368006 gene locus_tag LOCUS_51260 gene murL 369349 368006 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_51260 370388 369456 gene locus_tag LOCUS_51270 370388 369456 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_51270 370894 371994 gene locus_tag LOCUS_51280 gene menC 370894 371994 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_51280 372021 372476 gene locus_tag LOCUS_51290 372021 372476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 372796 372632 gene locus_tag LOCUS_51300 372796 372632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 373154 374098 gene locus_tag LOCUS_51310 373154 374098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 374389 376527 gene locus_tag LOCUS_51320 374389 376527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 376524 377399 gene locus_tag LOCUS_51330 376524 377399 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976933.1 protein_id gnl|my_center|LOCUS_51330 377396 378289 gene locus_tag LOCUS_51340 377396 378289 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_51340 378298 379584 gene locus_tag LOCUS_51350 378298 379584 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_51350 379581 380732 gene locus_tag LOCUS_51360 379581 380732 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_51360 380815 381753 gene locus_tag LOCUS_51370 gene pelA 380815 381753 CDS product pectate trisaccharide-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865117.1 protein_id gnl|my_center|LOCUS_51370 384114 382654 gene locus_tag LOCUS_51380 384114 382654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 388051 384236 gene locus_tag LOCUS_51390 388051 384236 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226454.1 protein_id gnl|my_center|LOCUS_51390 388445 388272 gene locus_tag LOCUS_51400 388445 388272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 388620 391034 gene locus_tag LOCUS_51410 gene fxsT 388620 391034 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030349.1 protein_id gnl|my_center|LOCUS_51410 392136 391093 gene locus_tag LOCUS_51420 392136 391093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727843.1 protein_id gnl|my_center|LOCUS_51420 393113 392133 gene locus_tag LOCUS_51430 393113 392133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877168.1 protein_id gnl|my_center|LOCUS_51430 394642 393110 gene locus_tag LOCUS_51440 394642 393110 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_51440 395717 394734 gene locus_tag LOCUS_51450 395717 394734 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_51450 395972 398176 gene locus_tag LOCUS_51460 395972 398176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 398345 399361 gene locus_tag LOCUS_51470 398345 399361 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_51470 399587 401266 gene locus_tag LOCUS_51480 gene araB 399587 401266 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_51480 401271 401924 gene locus_tag LOCUS_51490 401271 401924 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_51490 401921 403453 gene locus_tag LOCUS_51500 gene araA 401921 403453 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_51500 403496 404611 gene locus_tag LOCUS_51510 gene chvE 403496 404611 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_51510 404623 406149 gene locus_tag LOCUS_51520 gene gguA 404623 406149 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 protein_id gnl|my_center|LOCUS_51520 406146 407369 gene locus_tag LOCUS_51530 gene gguB 406146 407369 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226250.1 protein_id gnl|my_center|LOCUS_51530 407602 408726 gene locus_tag LOCUS_51540 407602 408726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 408802 409935 gene locus_tag LOCUS_51550 408802 409935 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639907.1 protein_id gnl|my_center|LOCUS_51550 410561 411832 gene locus_tag LOCUS_51560 410561 411832 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_51560 411829 412761 gene locus_tag LOCUS_51570 411829 412761 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 protein_id gnl|my_center|LOCUS_51570 412758 413603 gene locus_tag LOCUS_51580 412758 413603 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 protein_id gnl|my_center|LOCUS_51580 416374 413687 gene locus_tag LOCUS_51590 416374 413687 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080582917.1 protein_id gnl|my_center|LOCUS_51590 417634 416678 gene locus_tag LOCUS_51600 417634 416678 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_51600 418842 417631 gene locus_tag LOCUS_51610 418842 417631 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227739.1 protein_id gnl|my_center|LOCUS_51610 420300 418906 gene locus_tag LOCUS_51620 420300 418906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 421335 420466 gene locus_tag LOCUS_51630 421335 420466 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228031.1 protein_id gnl|my_center|LOCUS_51630 421396 421989 gene locus_tag LOCUS_51640 421396 421989 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031579.1 protein_id gnl|my_center|LOCUS_51640 423076 422003 gene locus_tag LOCUS_51650 423076 422003 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_51650 423192 423581 gene locus_tag LOCUS_51660 423192 423581 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728758.1 protein_id gnl|my_center|LOCUS_51660 425184 423991 gene locus_tag LOCUS_51670 425184 423991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 426692 425181 gene locus_tag LOCUS_51680 426692 425181 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223428.1 protein_id gnl|my_center|LOCUS_51680 428100 427009 gene locus_tag LOCUS_51690 gene galK 428100 427009 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_51690 429098 428097 gene locus_tag LOCUS_51700 429098 428097 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223213.1 protein_id gnl|my_center|LOCUS_51700 429319 432042 gene locus_tag LOCUS_51710 429319 432042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 431525 431621 gene locus_tag LOCUS_t00550 431525 431621 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 432068 432403 gene locus_tag LOCUS_51720 432068 432403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 432921 432343 gene locus_tag LOCUS_51730 432921 432343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 432951 433253 gene locus_tag LOCUS_51740 432951 433253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 433652 434605 gene locus_tag LOCUS_51750 433652 434605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 434602 435219 gene locus_tag LOCUS_51760 434602 435219 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_51760 436446 435223 gene locus_tag LOCUS_51770 436446 435223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 436708 438534 gene locus_tag LOCUS_51780 436708 438534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 >Feature sequence09 576 2198 gene locus_tag LOCUS_51790 gene kdpA 576 2198 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223785.1 protein_id gnl|my_center|LOCUS_51790 2195 4255 gene locus_tag LOCUS_51800 gene kdpB 2195 4255 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223786.1 protein_id gnl|my_center|LOCUS_51800 4257 4799 gene locus_tag LOCUS_51810 4257 4799 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223787.1 protein_id gnl|my_center|LOCUS_51810 4849 7437 gene locus_tag LOCUS_51820 4849 7437 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223788.1 protein_id gnl|my_center|LOCUS_51820 7434 8114 gene locus_tag LOCUS_51830 7434 8114 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223789.1 protein_id gnl|my_center|LOCUS_51830 8914 8225 gene locus_tag LOCUS_51840 8914 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 10250 8907 gene locus_tag LOCUS_51850 10250 8907 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_51850 11027 11671 gene locus_tag LOCUS_51860 11027 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 12979 11837 gene locus_tag LOCUS_51870 12979 11837 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468241.1 protein_id gnl|my_center|LOCUS_51870 13614 12991 gene locus_tag LOCUS_51880 13614 12991 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640558.1 protein_id gnl|my_center|LOCUS_51880 15988 13976 gene locus_tag LOCUS_51890 15988 13976 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_51890 16647 16000 gene locus_tag LOCUS_51900 16647 16000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 17058 17879 gene locus_tag LOCUS_51910 17058 17879 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227561.1 protein_id gnl|my_center|LOCUS_51910 18439 18008 gene locus_tag LOCUS_51920 18439 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 19794 18499 gene locus_tag LOCUS_51930 19794 18499 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742244.1 protein_id gnl|my_center|LOCUS_51930 19889 20452 gene locus_tag LOCUS_51940 19889 20452 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224590.1 protein_id gnl|my_center|LOCUS_51940 20976 21278 gene locus_tag LOCUS_51950 20976 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 21223 21534 gene locus_tag LOCUS_51960 21223 21534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 22615 21806 gene locus_tag LOCUS_51970 22615 21806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 22996 22742 gene locus_tag LOCUS_51980 22996 22742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 23697 23071 gene locus_tag LOCUS_51990 23697 23071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 24356 23955 gene locus_tag LOCUS_52000 24356 23955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 24521 24823 gene locus_tag LOCUS_52010 24521 24823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 24988 25845 gene locus_tag LOCUS_52020 24988 25845 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_52020 25868 26071 gene locus_tag LOCUS_52030 25868 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 27155 26199 gene locus_tag LOCUS_52040 27155 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 27386 27730 gene locus_tag LOCUS_52050 27386 27730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 27734 27988 gene locus_tag LOCUS_52060 27734 27988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 29113 28043 gene locus_tag LOCUS_52070 29113 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 29567 29728 gene locus_tag LOCUS_52080 29567 29728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 29981 30637 gene locus_tag LOCUS_52090 29981 30637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 30873 30640 gene locus_tag LOCUS_52100 30873 30640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 30793 30990 gene locus_tag LOCUS_52110 30793 30990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 31029 32753 gene locus_tag LOCUS_52120 31029 32753 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189214254.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52120 32830 34968 gene locus_tag LOCUS_52130 32830 34968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029071.1 protein_id gnl|my_center|LOCUS_52130 36286 35171 gene locus_tag LOCUS_52140 36286 35171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 37010 36357 gene locus_tag LOCUS_52150 37010 36357 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_52150 37190 37354 gene locus_tag LOCUS_52160 37190 37354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 37538 37780 gene locus_tag LOCUS_52170 37538 37780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 38611 37781 gene locus_tag LOCUS_52180 38611 37781 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970106.1 protein_id gnl|my_center|LOCUS_52180 39014 38652 gene locus_tag LOCUS_52190 39014 38652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 39093 39887 gene locus_tag LOCUS_52200 39093 39887 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026878.1 protein_id gnl|my_center|LOCUS_52200 40504 40136 gene locus_tag LOCUS_52210 40504 40136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 40979 40716 gene locus_tag LOCUS_52220 40979 40716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 41300 40980 gene locus_tag LOCUS_52230 41300 40980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 42648 42457 gene locus_tag LOCUS_52240 42648 42457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52240 43005 43754 gene locus_tag LOCUS_52250 43005 43754 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227881.1 protein_id gnl|my_center|LOCUS_52250 43961 44647 gene locus_tag LOCUS_52260 43961 44647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 44775 46934 gene locus_tag LOCUS_52270 44775 46934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 47710 47114 gene locus_tag LOCUS_52280 47710 47114 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_52280 49204 47771 gene locus_tag LOCUS_52290 gene ltrA 49204 47771 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967989.1 protein_id gnl|my_center|LOCUS_52290 50028 49771 gene locus_tag LOCUS_52300 50028 49771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 52223 50868 gene locus_tag LOCUS_52310 52223 50868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 52637 53143 gene locus_tag LOCUS_52320 52637 53143 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_52320 56425 53192 gene locus_tag LOCUS_52330 56425 53192 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225961.1 protein_id gnl|my_center|LOCUS_52330 57653 56604 gene locus_tag LOCUS_52340 57653 56604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 58484 58236 gene locus_tag LOCUS_52350 58484 58236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 58434 58913 gene locus_tag LOCUS_52360 58434 58913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52360 58923 59180 gene locus_tag LOCUS_52370 58923 59180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 60535 59348 gene locus_tag LOCUS_52380 60535 59348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 63462 60550 gene locus_tag LOCUS_52390 63462 60550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 64452 63472 gene locus_tag LOCUS_52400 64452 63472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 65222 65725 gene locus_tag LOCUS_52410 65222 65725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 65805 66086 gene locus_tag LOCUS_52420 65805 66086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 66121 66396 gene locus_tag LOCUS_52430 66121 66396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 67475 66726 gene locus_tag LOCUS_52440 67475 66726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 67548 68657 gene locus_tag LOCUS_52450 67548 68657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 69536 69745 gene locus_tag LOCUS_52460 69536 69745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 72011 70065 gene locus_tag LOCUS_52470 72011 70065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 72619 72014 gene locus_tag LOCUS_52480 72619 72014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 72892 72680 gene locus_tag LOCUS_52490 72892 72680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 74233 73163 gene locus_tag LOCUS_52500 74233 73163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 75430 74906 gene locus_tag LOCUS_52510 75430 74906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803693.1 protein_id gnl|my_center|LOCUS_52510 75743 76381 gene locus_tag LOCUS_52520 75743 76381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 76381 76674 gene locus_tag LOCUS_52530 76381 76674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 78774 77677 gene locus_tag LOCUS_52540 78774 77677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 82534 78977 gene locus_tag LOCUS_52550 82534 78977 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225956772.1 protein_id gnl|my_center|LOCUS_52550 82479 82658 gene locus_tag LOCUS_52560 82479 82658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 83177 82863 gene locus_tag LOCUS_52570 83177 82863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 83164 83739 gene locus_tag LOCUS_52580 83164 83739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 83733 84893 gene locus_tag LOCUS_52590 83733 84893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 85165 84947 gene locus_tag LOCUS_52600 85165 84947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 87523 85316 gene locus_tag LOCUS_52610 87523 85316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 88366 87887 gene locus_tag LOCUS_52620 88366 87887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 88936 88403 gene locus_tag LOCUS_52630 88936 88403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 90546 88969 gene locus_tag LOCUS_52640 90546 88969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 91785 90595 gene locus_tag LOCUS_52650 91785 90595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 92699 92187 gene locus_tag LOCUS_52660 92699 92187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 93344 93745 gene locus_tag LOCUS_52670 93344 93745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 93760 94029 gene locus_tag LOCUS_52680 93760 94029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 94190 96418 gene locus_tag LOCUS_52690 94190 96418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 97546 96440 gene locus_tag LOCUS_52700 97546 96440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 97833 97621 gene locus_tag LOCUS_52710 97833 97621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 98078 101290 gene locus_tag LOCUS_52720 98078 101290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 102705 102154 gene locus_tag LOCUS_52730 102705 102154 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_52730 104189 102687 gene locus_tag LOCUS_52740 104189 102687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 104571 104200 gene locus_tag LOCUS_52750 104571 104200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 104747 108313 gene locus_tag LOCUS_52760 104747 108313 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_52760 108691 109095 gene locus_tag LOCUS_52770 108691 109095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 109129 111276 gene locus_tag LOCUS_52780 109129 111276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 111566 111333 gene locus_tag LOCUS_52790 111566 111333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 112395 112607 gene locus_tag LOCUS_52800 112395 112607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 113017 112793 gene locus_tag LOCUS_52810 113017 112793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52810 114492 113164 gene locus_tag LOCUS_52820 114492 113164 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226203.1 protein_id gnl|my_center|LOCUS_52820 115283 114609 gene locus_tag LOCUS_52830 115283 114609 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 protein_id gnl|my_center|LOCUS_52830 115411 117273 gene locus_tag LOCUS_52840 115411 117273 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226206.1 protein_id gnl|my_center|LOCUS_52840 118150 117188 gene locus_tag LOCUS_52850 118150 117188 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226205.1 protein_id gnl|my_center|LOCUS_52850 118481 118242 gene locus_tag LOCUS_52860 118481 118242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52860 118856 118509 gene locus_tag LOCUS_52870 118856 118509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52870 119597 119094 gene locus_tag LOCUS_52880 119597 119094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 119922 120656 gene locus_tag LOCUS_52890 119922 120656 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898131.1 protein_id gnl|my_center|LOCUS_52890 122495 120783 gene locus_tag LOCUS_52900 122495 120783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 123421 124581 gene locus_tag LOCUS_52910 123421 124581 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031628.1 protein_id gnl|my_center|LOCUS_52910 124862 125866 gene locus_tag LOCUS_52920 124862 125866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 126200 127528 gene locus_tag LOCUS_52930 126200 127528 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_52930 128636 127800 gene locus_tag LOCUS_52940 128636 127800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 129144 130484 gene locus_tag LOCUS_52950 129144 130484 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314712.1 protein_id gnl|my_center|LOCUS_52950 130609 144564 gene locus_tag LOCUS_52960 130609 144564 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224965.1 protein_id gnl|my_center|LOCUS_52960 144578 164314 gene locus_tag LOCUS_52970 144578 164314 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224968.1 protein_id gnl|my_center|LOCUS_52970 164311 165564 gene locus_tag LOCUS_52980 164311 165564 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_52980 166739 165603 gene locus_tag LOCUS_52990 166739 165603 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_52990 167072 168334 gene locus_tag LOCUS_53000 167072 168334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 171030 168631 gene locus_tag LOCUS_53010 gene fxsT 171030 168631 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190714.1 protein_id gnl|my_center|LOCUS_53010 171588 171151 gene locus_tag LOCUS_53020 171588 171151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 172020 171760 gene locus_tag LOCUS_53030 172020 171760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 172228 172443 gene locus_tag LOCUS_53040 172228 172443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 172440 172733 gene locus_tag LOCUS_53050 172440 172733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 173157 172849 gene locus_tag LOCUS_53060 173157 172849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 173660 173268 gene locus_tag LOCUS_53070 173660 173268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 173903 173694 gene locus_tag LOCUS_53080 173903 173694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 174639 174280 gene locus_tag LOCUS_53090 174639 174280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 174875 177544 gene locus_tag LOCUS_53100 174875 177544 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_53100 177486 178331 gene locus_tag LOCUS_53110 177486 178331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 178561 178232 gene locus_tag LOCUS_53120 178561 178232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 179969 178587 gene locus_tag LOCUS_53130 gene pcaB 179969 178587 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031114.1 protein_id gnl|my_center|LOCUS_53130 181951 179981 gene locus_tag LOCUS_53140 181951 179981 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132113460.1 protein_id gnl|my_center|LOCUS_53140 183659 182184 gene locus_tag LOCUS_53150 183659 182184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 184610 184314 gene locus_tag LOCUS_53160 184610 184314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 184752 186131 gene locus_tag LOCUS_53170 184752 186131 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_53170 186268 187512 gene locus_tag LOCUS_53180 186268 187512 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_53180 187781 189043 gene locus_tag LOCUS_53190 gene pvdA 187781 189043 CDS product L-ornithine N(5)-monooxygenase PvdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114509.1 protein_id gnl|my_center|LOCUS_53190 189049 189420 gene locus_tag LOCUS_53200 189049 189420 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764558.1 protein_id gnl|my_center|LOCUS_53200 189417 190958 gene locus_tag LOCUS_53210 189417 190958 CDS product class I tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030917.1 protein_id gnl|my_center|LOCUS_53210 190960 192054 gene locus_tag LOCUS_53220 190960 192054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 192096 193394 gene locus_tag LOCUS_53230 192096 193394 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127180013.1 protein_id gnl|my_center|LOCUS_53230 193391 195106 gene locus_tag LOCUS_53240 193391 195106 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227138.1 protein_id gnl|my_center|LOCUS_53240 195149 195643 gene locus_tag LOCUS_53250 195149 195643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 195673 197229 gene locus_tag LOCUS_53260 195673 197229 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949626.1 protein_id gnl|my_center|LOCUS_53260 198482 197478 gene locus_tag LOCUS_53270 198482 197478 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089171.1 protein_id gnl|my_center|LOCUS_53270 198554 199795 gene locus_tag LOCUS_53280 198554 199795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_53280 201059 199914 gene locus_tag LOCUS_53290 201059 199914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 201506 202315 gene locus_tag LOCUS_53300 201506 202315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 202306 203148 gene locus_tag LOCUS_53310 202306 203148 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223086.1 protein_id gnl|my_center|LOCUS_53310 203145 204386 gene locus_tag LOCUS_53320 203145 204386 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223087.1 protein_id gnl|my_center|LOCUS_53320 204420 204701 gene locus_tag LOCUS_53330 204420 204701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 204698 205348 gene locus_tag LOCUS_53340 204698 205348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 205365 207071 gene locus_tag LOCUS_53350 205365 207071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 207068 207526 gene locus_tag LOCUS_53360 207068 207526 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 protein_id gnl|my_center|LOCUS_53360 207551 208156 gene locus_tag LOCUS_53370 207551 208156 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_53370 208197 208565 gene locus_tag LOCUS_53380 gene trxA 208197 208565 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_53380 208587 209132 gene locus_tag LOCUS_53390 208587 209132 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_53390 209308 211095 gene locus_tag LOCUS_53400 209308 211095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 213891 211150 gene locus_tag LOCUS_53410 213891 211150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 214459 214019 gene locus_tag LOCUS_53420 214459 214019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225797.1 protein_id gnl|my_center|LOCUS_53420 215066 216829 gene locus_tag LOCUS_53430 215066 216829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 216834 217421 gene locus_tag LOCUS_53440 216834 217421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 217481 218176 gene locus_tag LOCUS_53450 217481 218176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 218173 219564 gene locus_tag LOCUS_53460 218173 219564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 219548 220837 gene locus_tag LOCUS_53470 219548 220837 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 protein_id gnl|my_center|LOCUS_53470 221176 220838 gene locus_tag LOCUS_53480 221176 220838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 221205 221915 gene locus_tag LOCUS_53490 221205 221915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 221973 222683 gene locus_tag LOCUS_53500 221973 222683 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_53500 223977 223225 gene locus_tag LOCUS_53510 223977 223225 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742194.1 protein_id gnl|my_center|LOCUS_53510 224210 225118 gene locus_tag LOCUS_53520 224210 225118 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229913.1 protein_id gnl|my_center|LOCUS_53520 225115 227259 gene locus_tag LOCUS_53530 225115 227259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229912.1 protein_id gnl|my_center|LOCUS_53530 227302 228735 gene locus_tag LOCUS_53540 227302 228735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 228946 229767 gene locus_tag LOCUS_53550 228946 229767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 230784 229777 gene locus_tag LOCUS_53560 230784 229777 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_53560 231562 230855 gene locus_tag LOCUS_53570 231562 230855 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930032.1 protein_id gnl|my_center|LOCUS_53570 231993 231691 gene locus_tag LOCUS_53580 231993 231691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 233464 232079 gene locus_tag LOCUS_53590 233464 232079 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227350.1 protein_id gnl|my_center|LOCUS_53590 233690 234355 gene locus_tag LOCUS_53600 233690 234355 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930032.1 protein_id gnl|my_center|LOCUS_53600 234925 234440 gene locus_tag LOCUS_53610 234925 234440 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 protein_id gnl|my_center|LOCUS_53610 236277 234901 gene locus_tag LOCUS_53620 236277 234901 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 protein_id gnl|my_center|LOCUS_53620 237998 236418 gene locus_tag LOCUS_53630 237998 236418 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840467.1 protein_id gnl|my_center|LOCUS_53630 238186 239352 gene locus_tag LOCUS_53640 238186 239352 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228618.1 protein_id gnl|my_center|LOCUS_53640 240927 239545 gene locus_tag LOCUS_53650 240927 239545 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228605.1 protein_id gnl|my_center|LOCUS_53650 242687 241083 gene locus_tag LOCUS_53660 242687 241083 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831451.1 protein_id gnl|my_center|LOCUS_53660 243666 242689 gene locus_tag LOCUS_53670 243666 242689 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742109.1 protein_id gnl|my_center|LOCUS_53670 245068 243677 gene locus_tag LOCUS_53680 245068 243677 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089659.1 protein_id gnl|my_center|LOCUS_53680 245236 245625 gene locus_tag LOCUS_53690 245236 245625 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228612.1 protein_id gnl|my_center|LOCUS_53690 247446 245785 gene locus_tag LOCUS_53700 247446 245785 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228633.1 protein_id gnl|my_center|LOCUS_53700 248069 247500 gene locus_tag LOCUS_53710 248069 247500 CDS product DUF5987 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228634.1 protein_id gnl|my_center|LOCUS_53710 248726 248475 gene locus_tag LOCUS_53720 248726 248475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 248721 249449 gene locus_tag LOCUS_53730 248721 249449 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228650.1 protein_id gnl|my_center|LOCUS_53730 250921 249557 gene locus_tag LOCUS_53740 250921 249557 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_53740 251892 250918 gene locus_tag LOCUS_53750 251892 250918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228636.1 protein_id gnl|my_center|LOCUS_53750 253880 251940 gene locus_tag LOCUS_53760 253880 251940 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_53760 254863 253877 gene locus_tag LOCUS_53770 254863 253877 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086861803.1 protein_id gnl|my_center|LOCUS_53770 255964 254975 gene locus_tag LOCUS_53780 255964 254975 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228639.1 protein_id gnl|my_center|LOCUS_53780 256175 255996 gene locus_tag LOCUS_53790 256175 255996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 257184 256390 gene locus_tag LOCUS_53800 257184 256390 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228631.1 protein_id gnl|my_center|LOCUS_53800 259415 257412 gene locus_tag LOCUS_53810 gene ligA 259415 257412 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225034.1 protein_id gnl|my_center|LOCUS_53810 259526 260695 gene locus_tag LOCUS_53820 259526 260695 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 protein_id gnl|my_center|LOCUS_53820 260820 262262 gene locus_tag LOCUS_53830 gene argG 260820 262262 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_53830 263373 262357 gene locus_tag LOCUS_53840 263373 262357 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232996.1 protein_id gnl|my_center|LOCUS_53840 264054 263491 gene locus_tag LOCUS_53850 264054 263491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 264174 265538 gene locus_tag LOCUS_53860 264174 265538 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229821.1 protein_id gnl|my_center|LOCUS_53860 265538 268027 gene locus_tag LOCUS_53870 265538 268027 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_53870 270423 268204 gene locus_tag LOCUS_53880 270423 268204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 270856 271986 gene locus_tag LOCUS_53890 270856 271986 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_53890 271990 272901 gene locus_tag LOCUS_53900 271990 272901 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_53900 272889 273677 gene locus_tag LOCUS_53910 272889 273677 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_53910 273680 274723 gene locus_tag LOCUS_53920 273680 274723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_53920 275345 274731 gene locus_tag LOCUS_53930 275345 274731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 277062 275578 gene locus_tag LOCUS_53940 277062 275578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_53940 277231 277854 gene locus_tag LOCUS_53950 277231 277854 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_53950 278036 278944 gene locus_tag LOCUS_53960 278036 278944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_53960 278949 279674 gene locus_tag LOCUS_53970 278949 279674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221994.1 protein_id gnl|my_center|LOCUS_53970 279678 280886 gene locus_tag LOCUS_53980 279678 280886 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_53980 280883 281500 gene locus_tag LOCUS_53990 280883 281500 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_53990 282084 281602 gene locus_tag LOCUS_54000 282084 281602 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226425.1 protein_id gnl|my_center|LOCUS_54000 284397 282172 gene locus_tag LOCUS_54010 gene pucD 284397 282172 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_54010 285749 284394 gene locus_tag LOCUS_54020 285749 284394 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223813.1 protein_id gnl|my_center|LOCUS_54020 286231 285746 gene locus_tag LOCUS_54030 286231 285746 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_54030 287127 286234 gene locus_tag LOCUS_54040 287127 286234 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223811.1 protein_id gnl|my_center|LOCUS_54040 287302 288780 gene locus_tag LOCUS_54050 287302 288780 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_54050 289240 288887 gene locus_tag LOCUS_54060 289240 288887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 290652 289243 gene locus_tag LOCUS_54070 290652 289243 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226218.1 protein_id gnl|my_center|LOCUS_54070 290682 292241 gene locus_tag LOCUS_54080 290682 292241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 292453 294900 gene locus_tag LOCUS_54090 292453 294900 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228183.1 protein_id gnl|my_center|LOCUS_54090 294945 295382 gene locus_tag LOCUS_54100 294945 295382 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_54100 295382 295753 gene locus_tag LOCUS_54110 295382 295753 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228185.1 protein_id gnl|my_center|LOCUS_54110 295734 296327 gene locus_tag LOCUS_54120 295734 296327 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_54120 297740 296373 gene locus_tag LOCUS_54130 297740 296373 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_54130 298787 297750 gene locus_tag LOCUS_54140 298787 297750 CDS product DMATS family aromatic prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031680.1 protein_id gnl|my_center|LOCUS_54140 300097 299276 gene locus_tag LOCUS_54150 300097 299276 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_54150 300258 301286 gene locus_tag LOCUS_54160 300258 301286 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 protein_id gnl|my_center|LOCUS_54160 301886 301425 gene locus_tag LOCUS_54170 301886 301425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 302032 302547 gene locus_tag LOCUS_54180 302032 302547 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_54180 302544 303206 gene locus_tag LOCUS_54190 302544 303206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 304664 303249 gene locus_tag LOCUS_54200 gene eat 304664 303249 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 protein_id gnl|my_center|LOCUS_54200 304843 306183 gene locus_tag LOCUS_54210 304843 306183 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_54210 306164 306874 gene locus_tag LOCUS_54220 306164 306874 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223702.1 protein_id gnl|my_center|LOCUS_54220 306871 308229 gene locus_tag LOCUS_54230 306871 308229 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_54230 308265 309008 gene locus_tag LOCUS_54240 308265 309008 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_54240 309008 309706 gene locus_tag LOCUS_54250 309008 309706 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466719.1 protein_id gnl|my_center|LOCUS_54250 310182 309709 gene locus_tag LOCUS_54260 310182 309709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 310301 310540 gene locus_tag LOCUS_54270 310301 310540 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227773.1 protein_id gnl|my_center|LOCUS_54270 310544 311284 gene locus_tag LOCUS_54280 310544 311284 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227772.1 protein_id gnl|my_center|LOCUS_54280 311488 313458 gene locus_tag LOCUS_54290 gene thrS 311488 313458 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082399.1 protein_id gnl|my_center|LOCUS_54290 313455 314003 gene locus_tag LOCUS_54300 313455 314003 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 protein_id gnl|my_center|LOCUS_54300 314172 315683 gene locus_tag LOCUS_54310 314172 315683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 315680 316888 gene locus_tag LOCUS_54320 315680 316888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 316898 317707 gene locus_tag LOCUS_54330 316898 317707 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_54330 317792 318232 gene locus_tag LOCUS_54340 317792 318232 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061267.1 protein_id gnl|my_center|LOCUS_54340 318229 318930 gene locus_tag LOCUS_54350 318229 318930 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727694.1 protein_id gnl|my_center|LOCUS_54350 319138 319977 gene locus_tag LOCUS_54360 319138 319977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 320038 320646 gene locus_tag LOCUS_54370 320038 320646 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227146.1 protein_id gnl|my_center|LOCUS_54370 320643 321575 gene locus_tag LOCUS_54380 320643 321575 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227145.1 protein_id gnl|my_center|LOCUS_54380 321572 322693 gene locus_tag LOCUS_54390 321572 322693 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_54390 322690 323667 gene locus_tag LOCUS_54400 322690 323667 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090088.1 protein_id gnl|my_center|LOCUS_54400 323664 324008 gene locus_tag LOCUS_54410 323664 324008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 324413 324039 gene locus_tag LOCUS_54420 324413 324039 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_54420 325024 324431 gene locus_tag LOCUS_54430 325024 324431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 326029 325037 gene locus_tag LOCUS_54440 326029 325037 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228421.1 protein_id gnl|my_center|LOCUS_54440 327425 326040 gene locus_tag LOCUS_54450 gene hydA 327425 326040 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_54450 328264 327422 gene locus_tag LOCUS_54460 328264 327422 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_54460 329763 328261 gene locus_tag LOCUS_54470 329763 328261 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228418.1 protein_id gnl|my_center|LOCUS_54470 329996 330970 gene locus_tag LOCUS_54480 329996 330970 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_54480 331135 332577 gene locus_tag LOCUS_54490 331135 332577 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_54490 332837 333310 gene locus_tag LOCUS_54500 332837 333310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 335190 333541 gene locus_tag LOCUS_54510 335190 333541 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228411.1 protein_id gnl|my_center|LOCUS_54510 335297 336571 gene locus_tag LOCUS_54520 335297 336571 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_54520 336568 338061 gene locus_tag LOCUS_54530 336568 338061 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467505.1 protein_id gnl|my_center|LOCUS_54530 340478 338421 gene locus_tag LOCUS_54540 340478 338421 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227139.1 protein_id gnl|my_center|LOCUS_54540 340753 341661 gene locus_tag LOCUS_54550 gene pdxS 340753 341661 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_54550 342472 341870 gene locus_tag LOCUS_54560 342472 341870 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 protein_id gnl|my_center|LOCUS_54560 342484 343167 gene locus_tag LOCUS_54570 342484 343167 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284464.1 protein_id gnl|my_center|LOCUS_54570 343164 343472 gene locus_tag LOCUS_54580 343164 343472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 343908 343534 gene locus_tag LOCUS_54590 343908 343534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 345782 343929 gene locus_tag LOCUS_54600 345782 343929 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229814.1 protein_id gnl|my_center|LOCUS_54600 345901 347487 gene locus_tag LOCUS_54610 gene paaP 345901 347487 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_54610 347975 347502 gene locus_tag LOCUS_54620 347975 347502 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229486.1 protein_id gnl|my_center|LOCUS_54620 348050 349276 gene locus_tag LOCUS_54630 348050 349276 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_54630 349757 350362 gene locus_tag LOCUS_54640 gene pdxT 349757 350362 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_54640 350381 351130 gene locus_tag LOCUS_54650 350381 351130 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227126.1 protein_id gnl|my_center|LOCUS_54650 351251 351766 gene locus_tag LOCUS_54660 351251 351766 CDS product DUF4262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878153.1 protein_id gnl|my_center|LOCUS_54660 352652 352089 gene locus_tag LOCUS_54670 352652 352089 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_54670 352804 354273 gene locus_tag LOCUS_54680 352804 354273 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_54680 355135 354320 gene locus_tag LOCUS_54690 355135 354320 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228572.1 protein_id gnl|my_center|LOCUS_54690 355231 355605 gene locus_tag LOCUS_54700 355231 355605 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228573.1 protein_id gnl|my_center|LOCUS_54700 356986 355688 gene locus_tag LOCUS_54710 356986 355688 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409406.1 protein_id gnl|my_center|LOCUS_54710 357097 357579 gene locus_tag LOCUS_54720 357097 357579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 357567 358067 gene locus_tag LOCUS_54730 357567 358067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 359239 358064 gene locus_tag LOCUS_54740 359239 358064 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226539.1 protein_id gnl|my_center|LOCUS_54740 359331 360389 gene locus_tag LOCUS_54750 359331 360389 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226538.1 protein_id gnl|my_center|LOCUS_54750 360828 360358 gene locus_tag LOCUS_54760 360828 360358 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_54760 362027 360870 gene locus_tag LOCUS_54770 362027 360870 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031689.1 protein_id gnl|my_center|LOCUS_54770 362611 362027 gene locus_tag LOCUS_54780 362611 362027 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226802.1 protein_id gnl|my_center|LOCUS_54780 362747 363298 gene locus_tag LOCUS_54790 362747 363298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 363314 365053 gene locus_tag LOCUS_54800 363314 365053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 365351 366544 gene locus_tag LOCUS_54810 gene egtA 365351 366544 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226794.1 protein_id gnl|my_center|LOCUS_54810 366541 367854 gene locus_tag LOCUS_54820 gene egtB 366541 367854 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_54820 367857 368606 gene locus_tag LOCUS_54830 gene egtC 367857 368606 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226792.1 protein_id gnl|my_center|LOCUS_54830 368603 369577 gene locus_tag LOCUS_54840 gene egtD 368603 369577 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_54840 370511 372106 gene locus_tag LOCUS_54850 370511 372106 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226789.1 protein_id gnl|my_center|LOCUS_54850 373121 372054 gene locus_tag LOCUS_54860 373121 372054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 375188 373134 gene locus_tag LOCUS_54870 375188 373134 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_54870 375296 375895 gene locus_tag LOCUS_54880 375296 375895 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 protein_id gnl|my_center|LOCUS_54880 377642 375942 gene locus_tag LOCUS_54890 377642 375942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 378009 378392 gene locus_tag LOCUS_54900 378009 378392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 381260 378447 gene locus_tag LOCUS_54910 381260 378447 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226785.1 protein_id gnl|my_center|LOCUS_54910 381415 382161 gene locus_tag LOCUS_54920 381415 382161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 382158 382805 gene locus_tag LOCUS_54930 382158 382805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972873.1 protein_id gnl|my_center|LOCUS_54930 382880 383245 gene locus_tag LOCUS_54940 382880 383245 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028740.1 protein_id gnl|my_center|LOCUS_54940 383753 383280 gene locus_tag LOCUS_54950 383753 383280 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079901.1 protein_id gnl|my_center|LOCUS_54950 385411 383876 gene locus_tag LOCUS_54960 385411 383876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 385821 385408 gene locus_tag LOCUS_54970 385821 385408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 385953 386687 gene locus_tag LOCUS_54980 385953 386687 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_54980 386701 387315 gene locus_tag LOCUS_54990 386701 387315 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965276.1 protein_id gnl|my_center|LOCUS_54990 387396 388928 gene locus_tag LOCUS_55000 387396 388928 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_55000 389124 390404 gene locus_tag LOCUS_55010 389124 390404 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226784.1 protein_id gnl|my_center|LOCUS_55010 391211 390411 gene locus_tag LOCUS_55020 391211 390411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 391580 391296 gene locus_tag LOCUS_55030 391580 391296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 392606 391860 gene locus_tag LOCUS_55040 392606 391860 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031514.1 protein_id gnl|my_center|LOCUS_55040 392937 393728 gene locus_tag LOCUS_55050 392937 393728 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 protein_id gnl|my_center|LOCUS_55050 393725 395149 gene locus_tag LOCUS_55060 393725 395149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 395299 396048 gene locus_tag LOCUS_55070 395299 396048 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467632.1 protein_id gnl|my_center|LOCUS_55070 396084 396602 gene locus_tag LOCUS_55080 396084 396602 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226782.1 protein_id gnl|my_center|LOCUS_55080 396738 397769 gene locus_tag LOCUS_55090 396738 397769 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_55090 397766 398716 gene locus_tag LOCUS_55100 397766 398716 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_55100 398716 399681 gene locus_tag LOCUS_55110 398716 399681 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_55110 399691 400272 gene locus_tag LOCUS_55120 399691 400272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 401173 400289 gene locus_tag LOCUS_55130 401173 400289 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226775.1 protein_id gnl|my_center|LOCUS_55130 402525 401170 gene locus_tag LOCUS_55140 402525 401170 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226774.1 protein_id gnl|my_center|LOCUS_55140 403185 402526 gene locus_tag LOCUS_55150 403185 402526 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226773.1 protein_id gnl|my_center|LOCUS_55150 403235 403969 gene locus_tag LOCUS_55160 403235 403969 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227032.1 protein_id gnl|my_center|LOCUS_55160 404103 404816 gene locus_tag LOCUS_55170 404103 404816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 406052 404883 gene locus_tag LOCUS_55180 406052 404883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55180 406757 406146 gene locus_tag LOCUS_55190 406757 406146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55190 407002 407628 gene locus_tag LOCUS_55200 407002 407628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 408892 407597 gene locus_tag LOCUS_55210 408892 407597 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229361.1 protein_id gnl|my_center|LOCUS_55210 410582 409026 gene locus_tag LOCUS_55220 410582 409026 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228746.1 protein_id gnl|my_center|LOCUS_55220 410800 411906 gene locus_tag LOCUS_55230 410800 411906 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229371.1 protein_id gnl|my_center|LOCUS_55230 411903 412919 gene locus_tag LOCUS_55240 411903 412919 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223672.1 protein_id gnl|my_center|LOCUS_55240 412916 413881 gene locus_tag LOCUS_55250 412916 413881 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223671.1 protein_id gnl|my_center|LOCUS_55250 413881 414888 gene locus_tag LOCUS_55260 413881 414888 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223670.1 protein_id gnl|my_center|LOCUS_55260 414885 415850 gene locus_tag LOCUS_55270 414885 415850 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028341.1 protein_id gnl|my_center|LOCUS_55270 415850 416944 gene locus_tag LOCUS_55280 415850 416944 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229366.1 protein_id gnl|my_center|LOCUS_55280 417432 416941 gene locus_tag LOCUS_55290 417432 416941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 418060 417482 gene locus_tag LOCUS_55300 418060 417482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 418397 418080 gene locus_tag LOCUS_55310 418397 418080 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227883.1 protein_id gnl|my_center|LOCUS_55310 418738 418457 gene locus_tag LOCUS_55320 418738 418457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 >Feature sequence10 2883 1771 gene locus_tag LOCUS_55330 gene carA 2883 1771 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224617.1 protein_id gnl|my_center|LOCUS_55330 3365 2880 gene locus_tag LOCUS_55340 3365 2880 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224616.1 protein_id gnl|my_center|LOCUS_55340 4645 3362 gene locus_tag LOCUS_55350 4645 3362 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224615.1 protein_id gnl|my_center|LOCUS_55350 5574 4642 gene locus_tag LOCUS_55360 5574 4642 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224614.1 protein_id gnl|my_center|LOCUS_55360 6143 5571 gene locus_tag LOCUS_55370 gene pyrR 6143 5571 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224613.1 protein_id gnl|my_center|LOCUS_55370 6402 6890 gene locus_tag LOCUS_55380 6402 6890 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096372.1 protein_id gnl|my_center|LOCUS_55380 7965 7546 gene locus_tag LOCUS_55390 gene nusB 7965 7546 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_55390 8530 7967 gene locus_tag LOCUS_55400 gene efp 8530 7967 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_55400 9677 8592 gene locus_tag LOCUS_55410 9677 8592 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_55410 9954 9778 gene locus_tag LOCUS_55420 9954 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 9893 10216 gene locus_tag LOCUS_55430 9893 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55430 10611 10213 gene locus_tag LOCUS_55440 10611 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 11720 10608 gene locus_tag LOCUS_55450 gene aroB 11720 10608 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224604.1 protein_id gnl|my_center|LOCUS_55450 12765 11734 gene locus_tag LOCUS_55460 12765 11734 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223033.1 protein_id gnl|my_center|LOCUS_55460 13289 12771 gene locus_tag LOCUS_55470 13289 12771 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_55470 14485 13286 gene locus_tag LOCUS_55480 gene aroC 14485 13286 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224602.1 protein_id gnl|my_center|LOCUS_55480 14686 15282 gene locus_tag LOCUS_55490 14686 15282 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310114.1 protein_id gnl|my_center|LOCUS_55490 15858 15301 gene locus_tag LOCUS_55500 15858 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 16436 15984 gene locus_tag LOCUS_55510 16436 15984 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224597.1 protein_id gnl|my_center|LOCUS_55510 16669 16433 gene locus_tag LOCUS_55520 16669 16433 CDS product glucose PTS transporter subunit EIIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284356.1 protein_id gnl|my_center|LOCUS_55520 16835 17605 gene locus_tag LOCUS_55530 16835 17605 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224595.1 protein_id gnl|my_center|LOCUS_55530 17602 18918 gene locus_tag LOCUS_55540 17602 18918 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224594.1 protein_id gnl|my_center|LOCUS_55540 18949 19218 gene locus_tag LOCUS_55550 18949 19218 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224593.1 protein_id gnl|my_center|LOCUS_55550 20186 19347 gene locus_tag LOCUS_55560 20186 19347 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852947.1 protein_id gnl|my_center|LOCUS_55560 21409 20189 gene locus_tag LOCUS_55570 21409 20189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 21918 21406 gene locus_tag LOCUS_55580 gene ruvX 21918 21406 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_55580 24577 21905 gene locus_tag LOCUS_55590 gene alaS 24577 21905 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093585.1 protein_id gnl|my_center|LOCUS_55590 24903 24634 gene locus_tag LOCUS_55600 24903 24634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224581.1 protein_id gnl|my_center|LOCUS_55600 25295 24900 gene locus_tag LOCUS_55610 25295 24900 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224580.1 protein_id gnl|my_center|LOCUS_55610 25565 26965 gene locus_tag LOCUS_55620 25565 26965 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904086.1 protein_id gnl|my_center|LOCUS_55620 26962 28635 gene locus_tag LOCUS_55630 26962 28635 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485565.1 protein_id gnl|my_center|LOCUS_55630 28623 29210 gene locus_tag LOCUS_55640 28623 29210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 29207 30523 gene locus_tag LOCUS_55650 29207 30523 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224562.1 protein_id gnl|my_center|LOCUS_55650 30516 32261 gene locus_tag LOCUS_55660 30516 32261 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224563.1 protein_id gnl|my_center|LOCUS_55660 33047 32313 gene locus_tag LOCUS_55670 33047 32313 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226783.1 protein_id gnl|my_center|LOCUS_55670 34428 33082 gene locus_tag LOCUS_55680 34428 33082 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224577.1 protein_id gnl|my_center|LOCUS_55680 34597 35364 gene locus_tag LOCUS_55690 34597 35364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 35364 36383 gene locus_tag LOCUS_55700 35364 36383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 36380 36655 gene locus_tag LOCUS_55710 36380 36655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 36655 36897 gene locus_tag LOCUS_55720 36655 36897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 37775 37008 gene locus_tag LOCUS_55730 37775 37008 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_55730 37830 38606 gene locus_tag LOCUS_55740 37830 38606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55740 39087 38533 gene locus_tag LOCUS_55750 39087 38533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 39737 39099 gene locus_tag LOCUS_55760 39737 39099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 39996 39730 gene locus_tag LOCUS_55770 39996 39730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 41198 39993 gene locus_tag LOCUS_55780 41198 39993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 41647 41195 gene locus_tag LOCUS_55790 41647 41195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 41816 42391 gene locus_tag LOCUS_55800 41816 42391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 42422 42841 gene locus_tag LOCUS_55810 42422 42841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 42955 44247 gene locus_tag LOCUS_55820 42955 44247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031615.1 protein_id gnl|my_center|LOCUS_55820 44389 45522 gene locus_tag LOCUS_55830 44389 45522 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227012.1 protein_id gnl|my_center|LOCUS_55830 46976 45546 gene locus_tag LOCUS_55840 46976 45546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 47293 46973 gene locus_tag LOCUS_55850 47293 46973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 47979 47290 gene locus_tag LOCUS_55860 47979 47290 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104219.1 protein_id gnl|my_center|LOCUS_55860 48348 48040 gene locus_tag LOCUS_55870 48348 48040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 48295 50847 gene locus_tag LOCUS_55880 48295 50847 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_55880 50948 53869 gene locus_tag LOCUS_55890 50948 53869 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_55890 54028 54336 gene locus_tag LOCUS_55900 54028 54336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 54445 55212 gene locus_tag LOCUS_55910 54445 55212 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_55910 55209 55595 gene locus_tag LOCUS_55920 55209 55595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 55592 57313 gene locus_tag LOCUS_55930 55592 57313 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027655.1 protein_id gnl|my_center|LOCUS_55930 57310 58482 gene locus_tag LOCUS_55940 57310 58482 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_55940 58794 58543 gene locus_tag LOCUS_55950 58794 58543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 59493 58885 gene locus_tag LOCUS_55960 59493 58885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 59656 60501 gene locus_tag LOCUS_55970 59656 60501 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_55970 60498 61157 gene locus_tag LOCUS_55980 60498 61157 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093809.1 protein_id gnl|my_center|LOCUS_55980 61182 62660 gene locus_tag LOCUS_55990 61182 62660 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_55990 63614 62667 gene locus_tag LOCUS_56000 63614 62667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56000 64810 63719 gene locus_tag LOCUS_56010 64810 63719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 65377 64988 gene locus_tag LOCUS_56020 65377 64988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 65825 65418 gene locus_tag LOCUS_56030 65825 65418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229861.1 protein_id gnl|my_center|LOCUS_56030 66355 65831 gene locus_tag LOCUS_56040 66355 65831 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326961.1 protein_id gnl|my_center|LOCUS_56040 66425 68035 gene locus_tag LOCUS_56050 66425 68035 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_56050 68724 68002 gene locus_tag LOCUS_56060 68724 68002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 69823 68855 gene locus_tag LOCUS_56070 69823 68855 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226390.1 protein_id gnl|my_center|LOCUS_56070 71615 69900 gene locus_tag LOCUS_56080 71615 69900 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227075.1 protein_id gnl|my_center|LOCUS_56080 72820 71612 gene locus_tag LOCUS_56090 72820 71612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 72711 73013 gene locus_tag LOCUS_56100 72711 73013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 73707 73111 gene locus_tag LOCUS_56110 gene idi 73707 73111 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898999.1 protein_id gnl|my_center|LOCUS_56110 75063 73714 gene locus_tag LOCUS_56120 75063 73714 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222411.1 protein_id gnl|my_center|LOCUS_56120 76143 75070 gene locus_tag LOCUS_56130 76143 75070 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_56130 77026 76229 gene locus_tag LOCUS_56140 77026 76229 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_56140 77233 78195 gene locus_tag LOCUS_56150 77233 78195 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030530.1 protein_id gnl|my_center|LOCUS_56150 78751 78386 gene locus_tag LOCUS_56160 78751 78386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 79171 78830 gene locus_tag LOCUS_56170 79171 78830 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226217.1 protein_id gnl|my_center|LOCUS_56170 79609 79178 gene locus_tag LOCUS_56180 79609 79178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 80943 79606 gene locus_tag LOCUS_56190 80943 79606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 81037 82434 gene locus_tag LOCUS_56200 81037 82434 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_56200 82682 83629 gene locus_tag LOCUS_56210 82682 83629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229889.1 protein_id gnl|my_center|LOCUS_56210 83677 85935 gene locus_tag LOCUS_56220 83677 85935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121008027.1 protein_id gnl|my_center|LOCUS_56220 87179 86028 gene locus_tag LOCUS_56230 87179 86028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211351449.1 protein_id gnl|my_center|LOCUS_56230 88182 87220 gene locus_tag LOCUS_56240 88182 87220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229892.1 protein_id gnl|my_center|LOCUS_56240 91927 88202 gene locus_tag LOCUS_56250 gene fxsT 91927 88202 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184695823.1 protein_id gnl|my_center|LOCUS_56250 92091 91924 gene locus_tag LOCUS_56260 92091 91924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 92309 93421 gene locus_tag LOCUS_56270 92309 93421 CDS product FxsB family radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229894.1 protein_id gnl|my_center|LOCUS_56270 93418 94584 gene locus_tag LOCUS_56280 93418 94584 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229895.1 protein_id gnl|my_center|LOCUS_56280 94644 98126 gene locus_tag LOCUS_56290 94644 98126 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225968.1 protein_id gnl|my_center|LOCUS_56290 98195 98743 gene locus_tag LOCUS_56300 98195 98743 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224707.1 protein_id gnl|my_center|LOCUS_56300 98944 99591 gene locus_tag LOCUS_56310 98944 99591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 100620 99643 gene locus_tag LOCUS_56320 100620 99643 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976918.1 protein_id gnl|my_center|LOCUS_56320 101429 100629 gene locus_tag LOCUS_56330 101429 100629 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028038.1 protein_id gnl|my_center|LOCUS_56330 102373 101426 gene locus_tag LOCUS_56340 102373 101426 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976920.1 protein_id gnl|my_center|LOCUS_56340 103745 102405 gene locus_tag LOCUS_56350 103745 102405 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 protein_id gnl|my_center|LOCUS_56350 104579 103818 gene locus_tag LOCUS_56360 104579 103818 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976922.1 protein_id gnl|my_center|LOCUS_56360 105907 104834 gene locus_tag LOCUS_56370 105907 104834 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 protein_id gnl|my_center|LOCUS_56370 106048 106521 gene locus_tag LOCUS_56380 106048 106521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 108025 106505 gene locus_tag LOCUS_56390 108025 106505 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 protein_id gnl|my_center|LOCUS_56390 108889 108050 gene locus_tag LOCUS_56400 108889 108050 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_56400 109755 108886 gene locus_tag LOCUS_56410 109755 108886 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_56410 111113 109755 gene locus_tag LOCUS_56420 111113 109755 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_56420 112376 111375 gene locus_tag LOCUS_56430 112376 111375 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_56430 112915 112373 gene locus_tag LOCUS_56440 112915 112373 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902271.1 protein_id gnl|my_center|LOCUS_56440 113012 113554 gene locus_tag LOCUS_56450 113012 113554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 113721 116585 gene locus_tag LOCUS_56460 113721 116585 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_56460 116582 116791 gene locus_tag LOCUS_56470 116582 116791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 116882 119806 gene locus_tag LOCUS_56480 116882 119806 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229885.1 protein_id gnl|my_center|LOCUS_56480 119890 120555 gene locus_tag LOCUS_56490 119890 120555 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223479.1 protein_id gnl|my_center|LOCUS_56490 121277 120552 gene locus_tag LOCUS_56500 121277 120552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 121373 122023 gene locus_tag LOCUS_56510 121373 122023 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_56510 122870 122031 gene locus_tag LOCUS_56520 122870 122031 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_56520 125010 122986 gene locus_tag LOCUS_56530 gene paaZ 125010 122986 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223462.1 protein_id gnl|my_center|LOCUS_56530 125149 126402 gene locus_tag LOCUS_56540 125149 126402 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027355.1 protein_id gnl|my_center|LOCUS_56540 126547 127533 gene locus_tag LOCUS_56550 126547 127533 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027444.1 protein_id gnl|my_center|LOCUS_56550 127838 127524 gene locus_tag LOCUS_56560 127838 127524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 128857 127958 gene locus_tag LOCUS_56570 128857 127958 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_56570 129809 128877 gene locus_tag LOCUS_56580 129809 128877 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223519.1 protein_id gnl|my_center|LOCUS_56580 129902 131107 gene locus_tag LOCUS_56590 129902 131107 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226160.1 protein_id gnl|my_center|LOCUS_56590 131130 133001 gene locus_tag LOCUS_56600 131130 133001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_56600 133263 133099 gene locus_tag LOCUS_56610 133263 133099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 133262 133945 gene locus_tag LOCUS_56620 133262 133945 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461579.1 protein_id gnl|my_center|LOCUS_56620 133956 134552 gene locus_tag LOCUS_56630 133956 134552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 134691 135902 gene locus_tag LOCUS_56640 134691 135902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229354.1 protein_id gnl|my_center|LOCUS_56640 137186 136017 gene locus_tag LOCUS_56650 137186 136017 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229356.1 protein_id gnl|my_center|LOCUS_56650 137445 138755 gene locus_tag LOCUS_56660 137445 138755 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229361.1 protein_id gnl|my_center|LOCUS_56660 139879 138689 gene locus_tag LOCUS_56670 139879 138689 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230815.1 protein_id gnl|my_center|LOCUS_56670 140885 140055 gene locus_tag LOCUS_56680 140885 140055 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_56680 144912 140929 gene locus_tag LOCUS_56690 144912 140929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 145160 145750 gene locus_tag LOCUS_56700 145160 145750 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227638.1 protein_id gnl|my_center|LOCUS_56700 146837 145731 gene locus_tag LOCUS_56710 146837 145731 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227639.1 protein_id gnl|my_center|LOCUS_56710 147553 146834 gene locus_tag LOCUS_56720 147553 146834 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227640.1 protein_id gnl|my_center|LOCUS_56720 147714 148496 gene locus_tag LOCUS_56730 147714 148496 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459537.1 protein_id gnl|my_center|LOCUS_56730 148513 149691 gene locus_tag LOCUS_56740 148513 149691 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029609.1 protein_id gnl|my_center|LOCUS_56740 150786 149704 gene locus_tag LOCUS_56750 150786 149704 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978297.1 protein_id gnl|my_center|LOCUS_56750 152111 151431 gene locus_tag LOCUS_56760 gene lipB 152111 151431 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976622.1 protein_id gnl|my_center|LOCUS_56760 152553 152113 gene locus_tag LOCUS_56770 gene fabZ 152553 152113 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_56770 152885 152550 gene locus_tag LOCUS_56780 gene fabZ 152885 152550 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080862.1 protein_id gnl|my_center|LOCUS_56780 153841 152882 gene locus_tag LOCUS_56790 153841 152882 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_56790 155062 153851 gene locus_tag LOCUS_56800 155062 153851 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_56800 155282 155049 gene locus_tag LOCUS_56810 155282 155049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 155374 156012 gene locus_tag LOCUS_56820 155374 156012 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851304.1 protein_id gnl|my_center|LOCUS_56820 156661 155996 gene locus_tag LOCUS_56830 156661 155996 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_56830 156781 157332 gene locus_tag LOCUS_56840 156781 157332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 157329 158246 gene locus_tag LOCUS_56850 157329 158246 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 protein_id gnl|my_center|LOCUS_56850 158800 158234 gene locus_tag LOCUS_56860 158800 158234 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304888.1 protein_id gnl|my_center|LOCUS_56860 159624 158884 gene locus_tag LOCUS_56870 159624 158884 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230869.1 protein_id gnl|my_center|LOCUS_56870 159938 160528 gene locus_tag LOCUS_56880 159938 160528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 161620 160568 gene locus_tag LOCUS_56890 161620 160568 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229865.1 protein_id gnl|my_center|LOCUS_56890 161937 162065 gene locus_tag LOCUS_56900 161937 162065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 163563 162058 gene locus_tag LOCUS_56910 163563 162058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 164004 166832 gene locus_tag LOCUS_56920 164004 166832 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742130.1 protein_id gnl|my_center|LOCUS_56920 167828 167112 gene locus_tag LOCUS_56930 167828 167112 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731532.1 protein_id gnl|my_center|LOCUS_56930 168134 168457 gene locus_tag LOCUS_56940 168134 168457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 169118 168411 gene locus_tag LOCUS_56950 169118 168411 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226718.1 protein_id gnl|my_center|LOCUS_56950 169219 170259 gene locus_tag LOCUS_56960 169219 170259 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850119.1 protein_id gnl|my_center|LOCUS_56960 170481 170308 gene locus_tag LOCUS_56970 170481 170308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 171353 170478 gene locus_tag LOCUS_56980 171353 170478 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_56980 171509 171775 gene locus_tag LOCUS_56990 171509 171775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 172654 171809 gene locus_tag LOCUS_57000 172654 171809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 172779 174080 gene locus_tag LOCUS_57010 172779 174080 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119811.1 protein_id gnl|my_center|LOCUS_57010 174910 174077 gene locus_tag LOCUS_57020 174910 174077 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728493.1 protein_id gnl|my_center|LOCUS_57020 176025 174907 gene locus_tag LOCUS_57030 176025 174907 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_57030 177161 176022 gene locus_tag LOCUS_57040 177161 176022 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_57040 177280 178320 gene locus_tag LOCUS_57050 177280 178320 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228701.1 protein_id gnl|my_center|LOCUS_57050 178473 179798 gene locus_tag LOCUS_57060 178473 179798 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_57060 179795 180829 gene locus_tag LOCUS_57070 179795 180829 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226804.1 protein_id gnl|my_center|LOCUS_57070 181537 180878 gene locus_tag LOCUS_57080 181537 180878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 181710 182288 gene locus_tag LOCUS_57090 181710 182288 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_57090 182281 183210 gene locus_tag LOCUS_57100 182281 183210 CDS product CU044_5270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225196.1 protein_id gnl|my_center|LOCUS_57100 183273 183560 gene locus_tag LOCUS_57110 183273 183560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 184778 183588 gene locus_tag LOCUS_57120 184778 183588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225280.1 protein_id gnl|my_center|LOCUS_57120 184845 185201 gene locus_tag LOCUS_57130 184845 185201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 185206 186090 gene locus_tag LOCUS_57140 185206 186090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_57140 186188 187969 gene locus_tag LOCUS_57150 186188 187969 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222107.1 protein_id gnl|my_center|LOCUS_57150 188199 188729 gene locus_tag LOCUS_57160 188199 188729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 189736 188777 gene locus_tag LOCUS_57170 189736 188777 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_57170 189765 190187 gene locus_tag LOCUS_57180 189765 190187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 193130 190242 gene locus_tag LOCUS_57190 gene gcvP 193130 190242 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226813.1 protein_id gnl|my_center|LOCUS_57190 194040 193474 gene locus_tag LOCUS_57200 194040 193474 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226814.1 protein_id gnl|my_center|LOCUS_57200 195566 195093 gene locus_tag LOCUS_57210 195566 195093 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_57210 196385 195711 gene locus_tag LOCUS_57220 196385 195711 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_57220 196861 196400 gene locus_tag LOCUS_57230 196861 196400 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559567.1 protein_id gnl|my_center|LOCUS_57230 197358 196975 gene locus_tag LOCUS_57240 gene gcvH 197358 196975 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_57240 198007 197420 gene locus_tag LOCUS_57250 198007 197420 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_57250 198332 198090 gene locus_tag LOCUS_57260 198332 198090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 198778 199197 gene locus_tag LOCUS_57270 198778 199197 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731058.1 protein_id gnl|my_center|LOCUS_57270 199976 199221 gene locus_tag LOCUS_57280 199976 199221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 200102 200533 gene locus_tag LOCUS_57290 200102 200533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 200530 201321 gene locus_tag LOCUS_57300 200530 201321 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227037.1 protein_id gnl|my_center|LOCUS_57300 201799 201509 gene locus_tag LOCUS_57310 201799 201509 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_57310 202903 201920 gene locus_tag LOCUS_57320 202903 201920 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_57320 204697 202913 gene locus_tag LOCUS_57330 204697 202913 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 protein_id gnl|my_center|LOCUS_57330 204857 207313 gene locus_tag LOCUS_57340 gene ppsA 204857 207313 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_57340 207553 207759 gene locus_tag LOCUS_57350 207553 207759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 208277 207651 gene locus_tag LOCUS_57360 208277 207651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 208368 209312 gene locus_tag LOCUS_57370 208368 209312 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031422.1 protein_id gnl|my_center|LOCUS_57370 210200 209427 gene locus_tag LOCUS_57380 210200 209427 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222268.1 protein_id gnl|my_center|LOCUS_57380 210938 210528 gene locus_tag LOCUS_57390 210938 210528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 210819 211775 gene locus_tag LOCUS_57400 210819 211775 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_57400 212607 211906 gene locus_tag LOCUS_57410 212607 211906 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227870.1 protein_id gnl|my_center|LOCUS_57410 213182 212604 gene locus_tag LOCUS_57420 213182 212604 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 protein_id gnl|my_center|LOCUS_57420 214170 213262 gene locus_tag LOCUS_57430 214170 213262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 214669 214202 gene locus_tag LOCUS_57440 214669 214202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 216059 214932 gene locus_tag LOCUS_57450 216059 214932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 216656 216270 gene locus_tag LOCUS_57460 216656 216270 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_57460 216781 217677 gene locus_tag LOCUS_57470 216781 217677 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_57470 218262 217765 gene locus_tag LOCUS_57480 218262 217765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 220112 218367 gene locus_tag LOCUS_57490 220112 218367 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_57490 222244 220124 gene locus_tag LOCUS_57500 222244 220124 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_57500 225097 222332 gene locus_tag LOCUS_57510 225097 222332 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224347.1 protein_id gnl|my_center|LOCUS_57510 226238 225168 gene locus_tag LOCUS_57520 226238 225168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 226971 226231 gene locus_tag LOCUS_57530 226971 226231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 227121 228314 gene locus_tag LOCUS_57540 227121 228314 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_57540 228957 228325 gene locus_tag LOCUS_57550 228957 228325 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907497.1 protein_id gnl|my_center|LOCUS_57550 229129 230112 gene locus_tag LOCUS_57560 229129 230112 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228756.1 protein_id gnl|my_center|LOCUS_57560 231156 230152 gene locus_tag LOCUS_57570 231156 230152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 231369 232124 gene locus_tag LOCUS_57580 231369 232124 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226657.1 protein_id gnl|my_center|LOCUS_57580 232131 232805 gene locus_tag LOCUS_57590 232131 232805 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_57590 232890 233516 gene locus_tag LOCUS_57600 232890 233516 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226659.1 protein_id gnl|my_center|LOCUS_57600 234825 233521 gene locus_tag LOCUS_57610 234825 233521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226660.1 protein_id gnl|my_center|LOCUS_57610 238084 234920 gene locus_tag LOCUS_57620 238084 234920 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226661.1 protein_id gnl|my_center|LOCUS_57620 239167 238088 gene locus_tag LOCUS_57630 239167 238088 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226662.1 protein_id gnl|my_center|LOCUS_57630 239751 239236 gene locus_tag LOCUS_57640 239751 239236 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_57640 241691 239748 gene locus_tag LOCUS_57650 241691 239748 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226664.1 protein_id gnl|my_center|LOCUS_57650 242101 241688 gene locus_tag LOCUS_57660 242101 241688 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_57660 242393 242103 gene locus_tag LOCUS_57670 242393 242103 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226666.1 protein_id gnl|my_center|LOCUS_57670 244213 242399 gene locus_tag LOCUS_57680 244213 242399 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_57680 244964 244203 gene locus_tag LOCUS_57690 244964 244203 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_57690 245400 244969 gene locus_tag LOCUS_57700 245400 244969 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226669.1 protein_id gnl|my_center|LOCUS_57700 246110 245406 gene locus_tag LOCUS_57710 246110 245406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 246121 246588 gene locus_tag LOCUS_57720 246121 246588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 246694 247083 gene locus_tag LOCUS_57730 246694 247083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 247225 247563 gene locus_tag LOCUS_57740 247225 247563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 247893 247735 gene locus_tag LOCUS_57750 247893 247735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098516.1 protein_id gnl|my_center|LOCUS_57750 248324 247890 gene locus_tag LOCUS_57760 248324 247890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_57760 248772 248329 gene locus_tag LOCUS_57770 248772 248329 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226672.1 protein_id gnl|my_center|LOCUS_57770 250329 248800 gene locus_tag LOCUS_57780 250329 248800 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226673.1 protein_id gnl|my_center|LOCUS_57780 251211 250522 gene locus_tag LOCUS_57790 251211 250522 CDS product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226675.1 protein_id gnl|my_center|LOCUS_57790 253310 251310 gene locus_tag LOCUS_57800 253310 251310 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_57800 253915 253307 gene locus_tag LOCUS_57810 253915 253307 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 protein_id gnl|my_center|LOCUS_57810 254497 254012 gene locus_tag LOCUS_57820 254497 254012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 254657 255484 gene locus_tag LOCUS_57830 254657 255484 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224161.1 protein_id gnl|my_center|LOCUS_57830 255488 255721 gene locus_tag LOCUS_57840 255488 255721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 255981 256583 gene locus_tag LOCUS_57850 255981 256583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 257362 256592 gene locus_tag LOCUS_57860 257362 256592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 258728 257436 gene locus_tag LOCUS_57870 258728 257436 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228794.1 protein_id gnl|my_center|LOCUS_57870 259842 258742 gene locus_tag LOCUS_57880 259842 258742 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228044.1 protein_id gnl|my_center|LOCUS_57880 260726 259839 gene locus_tag LOCUS_57890 260726 259839 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_57890 262576 260723 gene locus_tag LOCUS_57900 262576 260723 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063644.1 protein_id gnl|my_center|LOCUS_57900 263376 262573 gene locus_tag LOCUS_57910 263376 262573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_57910 264158 263373 gene locus_tag LOCUS_57920 264158 263373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_57920 264370 264744 gene locus_tag LOCUS_57930 gene rsbW 264370 264744 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893193.1 protein_id gnl|my_center|LOCUS_57930 264732 265487 gene locus_tag LOCUS_57940 264732 265487 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227037.1 protein_id gnl|my_center|LOCUS_57940 265542 265910 gene locus_tag LOCUS_57950 265542 265910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 266066 266989 gene locus_tag LOCUS_57960 266066 266989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 268571 267615 gene locus_tag LOCUS_57970 268571 267615 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_57970 268717 269805 gene locus_tag LOCUS_57980 268717 269805 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730643.1 protein_id gnl|my_center|LOCUS_57980 269864 270223 gene locus_tag LOCUS_57990 269864 270223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 270580 270230 gene locus_tag LOCUS_58000 270580 270230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 271082 270639 gene locus_tag LOCUS_58010 271082 270639 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224765.1 protein_id gnl|my_center|LOCUS_58010 273750 271135 gene locus_tag LOCUS_58020 273750 271135 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223261.1 protein_id gnl|my_center|LOCUS_58020 273836 275038 gene locus_tag LOCUS_58030 273836 275038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 275217 275849 gene locus_tag LOCUS_58040 275217 275849 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_58040 275815 276279 gene locus_tag LOCUS_58050 275815 276279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 276366 277904 gene locus_tag LOCUS_58060 276366 277904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 278610 277858 gene locus_tag LOCUS_58070 278610 277858 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222729.1 protein_id gnl|my_center|LOCUS_58070 279282 278686 gene locus_tag LOCUS_58080 279282 278686 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_58080 279752 279330 gene locus_tag LOCUS_58090 279752 279330 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085368.1 protein_id gnl|my_center|LOCUS_58090 282961 279749 gene locus_tag LOCUS_58100 282961 279749 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230257.1 protein_id gnl|my_center|LOCUS_58100 284181 283204 gene locus_tag LOCUS_58110 284181 283204 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225347.1 protein_id gnl|my_center|LOCUS_58110 284412 285617 gene locus_tag LOCUS_58120 284412 285617 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027711.1 protein_id gnl|my_center|LOCUS_58120 287044 286160 gene locus_tag LOCUS_58130 287044 286160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230261.1 protein_id gnl|my_center|LOCUS_58130 287847 287041 gene locus_tag LOCUS_58140 287847 287041 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_58140 288617 287844 gene locus_tag LOCUS_58150 288617 287844 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_58150 292540 288773 gene locus_tag LOCUS_58160 292540 288773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 protein_id gnl|my_center|LOCUS_58160 293479 292718 gene locus_tag LOCUS_58170 293479 292718 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227800.1 protein_id gnl|my_center|LOCUS_58170 294125 293472 gene locus_tag LOCUS_58180 gene scpB 294125 293472 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227801.1 protein_id gnl|my_center|LOCUS_58180 295045 294122 gene locus_tag LOCUS_58190 295045 294122 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227802.1 protein_id gnl|my_center|LOCUS_58190 295362 295042 gene locus_tag LOCUS_58200 295362 295042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227803.1 protein_id gnl|my_center|LOCUS_58200 296333 295359 gene locus_tag LOCUS_58210 296333 295359 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_58210 296792 296448 gene locus_tag LOCUS_58220 296792 296448 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259894.1 protein_id gnl|my_center|LOCUS_58220 297764 296880 gene locus_tag LOCUS_58230 gene xerD 297764 296880 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_58230 299121 297976 gene locus_tag LOCUS_58240 gene ald 299121 297976 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894041.1 protein_id gnl|my_center|LOCUS_58240 299214 299843 gene locus_tag LOCUS_58250 299214 299843 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227806.1 protein_id gnl|my_center|LOCUS_58250 300212 299832 gene locus_tag LOCUS_58260 300212 299832 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408005.1 protein_id gnl|my_center|LOCUS_58260 300987 300367 gene locus_tag LOCUS_58270 300987 300367 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227807.1 protein_id gnl|my_center|LOCUS_58270 302675 300984 gene locus_tag LOCUS_58280 302675 300984 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_58280 304032 303094 gene locus_tag LOCUS_58290 304032 303094 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_58290 305213 304029 gene locus_tag LOCUS_58300 gene steA 305213 304029 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286379.1 protein_id gnl|my_center|LOCUS_58300 306038 305289 gene locus_tag LOCUS_58310 306038 305289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 306818 306150 gene locus_tag LOCUS_58320 306818 306150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 308596 306815 gene locus_tag LOCUS_58330 gene recN 308596 306815 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467394.1 protein_id gnl|my_center|LOCUS_58330 309562 308669 gene locus_tag LOCUS_58340 309562 308669 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227821.1 protein_id gnl|my_center|LOCUS_58340 310380 309574 gene locus_tag LOCUS_58350 310380 309574 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_58350 310557 310384 gene locus_tag LOCUS_58360 310557 310384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227823.1 protein_id gnl|my_center|LOCUS_58360 311351 310563 gene locus_tag LOCUS_58370 311351 310563 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227824.1 protein_id gnl|my_center|LOCUS_58370 313829 311442 gene locus_tag LOCUS_58380 313829 311442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 >Feature sequence11 280 642 gene locus_tag LOCUS_58390 280 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 1075 650 gene locus_tag LOCUS_58400 1075 650 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229580.1 protein_id gnl|my_center|LOCUS_58400 2249 1275 gene locus_tag LOCUS_58410 2249 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 3487 2663 gene locus_tag LOCUS_58420 3487 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 3446 3667 gene locus_tag LOCUS_58430 3446 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 7381 3776 gene locus_tag LOCUS_58440 7381 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 9929 7512 gene locus_tag LOCUS_58450 9929 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 14209 9935 gene locus_tag LOCUS_58460 14209 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 15008 14430 gene locus_tag LOCUS_58470 15008 14430 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727835.1 protein_id gnl|my_center|LOCUS_58470 15112 16536 gene locus_tag LOCUS_58480 15112 16536 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227506.1 protein_id gnl|my_center|LOCUS_58480 16649 17983 gene locus_tag LOCUS_58490 16649 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027710.1 protein_id gnl|my_center|LOCUS_58490 18049 19284 gene locus_tag LOCUS_58500 18049 19284 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977524.1 protein_id gnl|my_center|LOCUS_58500 19281 20504 gene locus_tag LOCUS_58510 19281 20504 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 protein_id gnl|my_center|LOCUS_58510 21573 20491 gene locus_tag LOCUS_58520 21573 20491 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 protein_id gnl|my_center|LOCUS_58520 22334 21570 gene locus_tag LOCUS_58530 22334 21570 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223575.1 protein_id gnl|my_center|LOCUS_58530 23248 22331 gene locus_tag LOCUS_58540 23248 22331 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226278.1 protein_id gnl|my_center|LOCUS_58540 23367 23245 gene locus_tag LOCUS_58550 23367 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 23469 24704 gene locus_tag LOCUS_58560 23469 24704 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226428.1 protein_id gnl|my_center|LOCUS_58560 26062 25280 gene locus_tag LOCUS_58570 26062 25280 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224974.1 protein_id gnl|my_center|LOCUS_58570 27903 26059 gene locus_tag LOCUS_58580 27903 26059 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227185.1 protein_id gnl|my_center|LOCUS_58580 28942 27932 gene locus_tag LOCUS_58590 28942 27932 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_58590 29188 30159 gene locus_tag LOCUS_58600 29188 30159 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804968.1 protein_id gnl|my_center|LOCUS_58600 30186 31046 gene locus_tag LOCUS_58610 30186 31046 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804067.1 protein_id gnl|my_center|LOCUS_58610 31102 32745 gene locus_tag LOCUS_58620 31102 32745 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179748936.1 protein_id gnl|my_center|LOCUS_58620 32851 33537 gene locus_tag LOCUS_58630 32851 33537 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_58630 33643 35223 gene locus_tag LOCUS_58640 33643 35223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 35686 35237 gene locus_tag LOCUS_58650 35686 35237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 35830 36222 gene locus_tag LOCUS_58660 35830 36222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 36280 36984 gene locus_tag LOCUS_58670 36280 36984 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222253.1 protein_id gnl|my_center|LOCUS_58670 37198 37407 gene locus_tag LOCUS_58680 37198 37407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 37674 40106 gene locus_tag LOCUS_58690 37674 40106 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229380.1 protein_id gnl|my_center|LOCUS_58690 40159 40395 gene locus_tag LOCUS_58700 40159 40395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 40441 40833 gene locus_tag LOCUS_58710 40441 40833 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224984.1 protein_id gnl|my_center|LOCUS_58710 42453 40837 gene locus_tag LOCUS_58720 42453 40837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 42567 42797 gene locus_tag LOCUS_58730 42567 42797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306656.1 protein_id gnl|my_center|LOCUS_58730 43225 42803 gene locus_tag LOCUS_58740 43225 42803 CDS product DUF6292 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226102.1 protein_id gnl|my_center|LOCUS_58740 44036 43374 gene locus_tag LOCUS_58750 gene lexA 44036 43374 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225332.1 protein_id gnl|my_center|LOCUS_58750 44126 44797 gene locus_tag LOCUS_58760 44126 44797 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079467.1 protein_id gnl|my_center|LOCUS_58760 46028 44805 gene locus_tag LOCUS_58770 46028 44805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 48151 46217 gene locus_tag LOCUS_58780 48151 46217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 48987 48400 gene locus_tag LOCUS_58790 48987 48400 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510041.1 protein_id gnl|my_center|LOCUS_58790 50070 49081 gene locus_tag LOCUS_58800 50070 49081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 52052 50445 gene locus_tag LOCUS_58810 52052 50445 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228626.1 protein_id gnl|my_center|LOCUS_58810 53071 52049 gene locus_tag LOCUS_58820 53071 52049 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228627.1 protein_id gnl|my_center|LOCUS_58820 53603 53106 gene locus_tag LOCUS_58830 53603 53106 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228628.1 protein_id gnl|my_center|LOCUS_58830 54067 53609 gene locus_tag LOCUS_58840 54067 53609 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_58840 59819 54069 gene locus_tag LOCUS_58850 59819 54069 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831510.1 protein_id gnl|my_center|LOCUS_58850 60256 61239 gene locus_tag LOCUS_58860 60256 61239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224152.1 protein_id gnl|my_center|LOCUS_58860 61212 62330 gene locus_tag LOCUS_58870 61212 62330 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 protein_id gnl|my_center|LOCUS_58870 62527 63609 gene locus_tag LOCUS_58880 62527 63609 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742109.1 protein_id gnl|my_center|LOCUS_58880 64460 63696 gene locus_tag LOCUS_58890 64460 63696 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228650.1 protein_id gnl|my_center|LOCUS_58890 65532 64783 gene locus_tag LOCUS_58900 65532 64783 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228640.1 protein_id gnl|my_center|LOCUS_58900 66680 66976 gene locus_tag LOCUS_58910 66680 66976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 67055 67765 gene locus_tag LOCUS_58920 67055 67765 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228507.1 protein_id gnl|my_center|LOCUS_58920 68444 67752 gene locus_tag LOCUS_58930 68444 67752 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_58930 69535 68786 gene locus_tag LOCUS_58940 69535 68786 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228650.1 protein_id gnl|my_center|LOCUS_58940 70815 71378 gene locus_tag LOCUS_58950 70815 71378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228656.1 protein_id gnl|my_center|LOCUS_58950 71383 72603 gene locus_tag LOCUS_58960 71383 72603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 72810 72607 gene locus_tag LOCUS_58970 72810 72607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 72785 73129 gene locus_tag LOCUS_58980 72785 73129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 73455 73036 gene locus_tag LOCUS_58990 73455 73036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 73748 74086 gene locus_tag LOCUS_59000 73748 74086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 74856 74440 gene locus_tag LOCUS_59010 74856 74440 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_59010 76322 74862 gene locus_tag LOCUS_59020 76322 74862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 77195 76632 gene locus_tag LOCUS_59030 77195 76632 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969624.1 protein_id gnl|my_center|LOCUS_59030 77581 77255 gene locus_tag LOCUS_59040 77581 77255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 78152 77586 gene locus_tag LOCUS_59050 78152 77586 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081838.1 protein_id gnl|my_center|LOCUS_59050 78282 79139 gene locus_tag LOCUS_59060 78282 79139 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223238.1 protein_id gnl|my_center|LOCUS_59060 79446 80714 gene locus_tag LOCUS_59070 79446 80714 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027838.1 protein_id gnl|my_center|LOCUS_59070 80711 81682 gene locus_tag LOCUS_59080 80711 81682 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871104.1 protein_id gnl|my_center|LOCUS_59080 81679 82515 gene locus_tag LOCUS_59090 81679 82515 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977289.1 protein_id gnl|my_center|LOCUS_59090 82520 83101 gene locus_tag LOCUS_59100 82520 83101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 83492 83163 gene locus_tag LOCUS_59110 83492 83163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 84632 83706 gene locus_tag LOCUS_59120 84632 83706 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804930.1 protein_id gnl|my_center|LOCUS_59120 84819 86024 gene locus_tag LOCUS_59130 84819 86024 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 protein_id gnl|my_center|LOCUS_59130 88332 85975 gene locus_tag LOCUS_59140 88332 85975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 89021 88329 gene locus_tag LOCUS_59150 89021 88329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_59150 89192 90532 gene locus_tag LOCUS_59160 89192 90532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 90529 91197 gene locus_tag LOCUS_59170 90529 91197 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_59170 94342 91304 gene locus_tag LOCUS_59180 94342 91304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 94480 95346 gene locus_tag LOCUS_59190 94480 95346 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027427.1 protein_id gnl|my_center|LOCUS_59190 96503 95502 gene locus_tag LOCUS_59200 96503 95502 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_59200 96522 96701 gene locus_tag LOCUS_59210 96522 96701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 96781 97140 gene locus_tag LOCUS_59220 96781 97140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 97187 97720 gene locus_tag LOCUS_59230 97187 97720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 99671 97728 gene locus_tag LOCUS_59240 gene otr(A) 99671 97728 CDS product tetracycline resistance ribosomal protection protein Otr(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027352.1 protein_id gnl|my_center|LOCUS_59240 100325 100870 gene locus_tag LOCUS_59250 100325 100870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227099.1 protein_id gnl|my_center|LOCUS_59250 104208 100924 gene locus_tag LOCUS_59260 104208 100924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 105605 104187 gene locus_tag LOCUS_59270 105605 104187 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617363.1 protein_id gnl|my_center|LOCUS_59270 106519 105707 gene locus_tag LOCUS_59280 106519 105707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59280 107417 106614 gene locus_tag LOCUS_59290 107417 106614 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225267.1 protein_id gnl|my_center|LOCUS_59290 108232 107414 gene locus_tag LOCUS_59300 108232 107414 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225266.1 protein_id gnl|my_center|LOCUS_59300 109616 108390 gene locus_tag LOCUS_59310 109616 108390 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225265.1 protein_id gnl|my_center|LOCUS_59310 111597 109681 gene locus_tag LOCUS_59320 111597 109681 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803839.1 protein_id gnl|my_center|LOCUS_59320 111767 112792 gene locus_tag LOCUS_59330 111767 112792 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_59330 115179 112888 gene locus_tag LOCUS_59340 115179 112888 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_59340 116134 115172 gene locus_tag LOCUS_59350 116134 115172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_59350 116446 116240 gene locus_tag LOCUS_59360 116446 116240 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_59360 116785 116504 gene locus_tag LOCUS_59370 116785 116504 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228661.1 protein_id gnl|my_center|LOCUS_59370 117176 116985 gene locus_tag LOCUS_59380 117176 116985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 117403 118764 gene locus_tag LOCUS_59390 117403 118764 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_59390 118761 118952 gene locus_tag LOCUS_59400 118761 118952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 119174 119980 gene locus_tag LOCUS_59410 119174 119980 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_59410 120225 120013 gene locus_tag LOCUS_59420 120225 120013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 122515 120395 gene locus_tag LOCUS_59430 122515 120395 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_59430 123711 122512 gene locus_tag LOCUS_59440 123711 122512 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_59440 123842 124705 gene locus_tag LOCUS_59450 123842 124705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 124714 125052 gene locus_tag LOCUS_59460 gene cmtR 124714 125052 CDS product Cd(II)/Pb(II)-sensing metalloregulatory transcriptional regulator CmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410018.1 protein_id gnl|my_center|LOCUS_59460 125049 125711 gene locus_tag LOCUS_59470 125049 125711 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_59470 125776 126480 gene locus_tag LOCUS_59480 125776 126480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 126728 127885 gene locus_tag LOCUS_59490 126728 127885 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 protein_id gnl|my_center|LOCUS_59490 127965 128375 gene locus_tag LOCUS_59500 127965 128375 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_59500 131342 128391 gene locus_tag LOCUS_59510 131342 128391 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228172.1 protein_id gnl|my_center|LOCUS_59510 132680 131466 gene locus_tag LOCUS_59520 132680 131466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 133758 132673 gene locus_tag LOCUS_59530 133758 132673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 133962 133831 gene locus_tag LOCUS_59540 133962 133831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 135763 134183 gene locus_tag LOCUS_59550 135763 134183 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027742.1 protein_id gnl|my_center|LOCUS_59550 136592 135963 gene locus_tag LOCUS_59560 136592 135963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225122.1 protein_id gnl|my_center|LOCUS_59560 137022 136585 gene locus_tag LOCUS_59570 137022 136585 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466936.1 protein_id gnl|my_center|LOCUS_59570 137702 137115 gene locus_tag LOCUS_59580 137702 137115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 138669 137713 gene locus_tag LOCUS_59590 138669 137713 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284362.1 protein_id gnl|my_center|LOCUS_59590 138770 139576 gene locus_tag LOCUS_59600 138770 139576 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027270.1 protein_id gnl|my_center|LOCUS_59600 139944 139771 gene locus_tag LOCUS_59610 139944 139771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 139963 140367 gene locus_tag LOCUS_59620 139963 140367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 140378 140863 gene locus_tag LOCUS_59630 140378 140863 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 protein_id gnl|my_center|LOCUS_59630 140931 141848 gene locus_tag LOCUS_59640 140931 141848 CDS product anti-sigma factor RsbA family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027235.1 protein_id gnl|my_center|LOCUS_59640 141984 142724 gene locus_tag LOCUS_59650 141984 142724 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228494.1 protein_id gnl|my_center|LOCUS_59650 142892 143539 gene locus_tag LOCUS_59660 142892 143539 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_59660 143548 144504 gene locus_tag LOCUS_59670 143548 144504 CDS product TIGR03557 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227034.1 protein_id gnl|my_center|LOCUS_59670 145845 144532 gene locus_tag LOCUS_59680 145845 144532 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225012.1 protein_id gnl|my_center|LOCUS_59680 146563 146087 gene locus_tag LOCUS_59690 146563 146087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 147899 146610 gene locus_tag LOCUS_59700 147899 146610 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_59700 147966 149219 gene locus_tag LOCUS_59710 gene gabT 147966 149219 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223100.1 protein_id gnl|my_center|LOCUS_59710 149216 150646 gene locus_tag LOCUS_59720 149216 150646 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223099.1 protein_id gnl|my_center|LOCUS_59720 150650 151348 gene locus_tag LOCUS_59730 150650 151348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 151433 152938 gene locus_tag LOCUS_59740 151433 152938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091320502.1 protein_id gnl|my_center|LOCUS_59740 152935 153930 gene locus_tag LOCUS_59750 152935 153930 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229640.1 protein_id gnl|my_center|LOCUS_59750 153927 158252 gene locus_tag LOCUS_59760 gene fxsT 153927 158252 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091320500.1 protein_id gnl|my_center|LOCUS_59760 160002 158257 gene locus_tag LOCUS_59770 160002 158257 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317561.1 protein_id gnl|my_center|LOCUS_59770 160220 159999 gene locus_tag LOCUS_59780 160220 159999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 160299 160445 gene locus_tag LOCUS_59790 160299 160445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 161168 160458 gene locus_tag LOCUS_59800 161168 160458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 161352 161179 gene locus_tag LOCUS_59810 161352 161179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 161567 161349 gene locus_tag LOCUS_59820 161567 161349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 162289 161807 gene locus_tag LOCUS_59830 162289 161807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 162482 163465 gene locus_tag LOCUS_59840 162482 163465 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229597.1 protein_id gnl|my_center|LOCUS_59840 163677 164687 gene locus_tag LOCUS_59850 163677 164687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 165253 164843 gene locus_tag LOCUS_59860 165253 164843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 165722 166237 gene locus_tag LOCUS_59870 165722 166237 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225333.1 protein_id gnl|my_center|LOCUS_59870 167124 166396 gene locus_tag LOCUS_59880 167124 166396 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231034.1 protein_id gnl|my_center|LOCUS_59880 167418 167137 gene locus_tag LOCUS_59890 167418 167137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 167374 168738 gene locus_tag LOCUS_59900 167374 168738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091320502.1 protein_id gnl|my_center|LOCUS_59900 168743 169762 gene locus_tag LOCUS_59910 168743 169762 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229640.1 protein_id gnl|my_center|LOCUS_59910 169807 173859 gene locus_tag LOCUS_59920 169807 173859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 175521 173860 gene locus_tag LOCUS_59930 175521 173860 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317561.1 protein_id gnl|my_center|LOCUS_59930 175681 175514 gene locus_tag LOCUS_59940 175681 175514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 175659 175883 gene locus_tag LOCUS_59950 175659 175883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 176265 176092 gene locus_tag LOCUS_59960 176265 176092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 176713 176531 gene locus_tag LOCUS_59970 176713 176531 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_59970 176786 177145 gene locus_tag LOCUS_59980 176786 177145 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226104.1 protein_id gnl|my_center|LOCUS_59980 177261 177857 gene locus_tag LOCUS_59990 177261 177857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 179589 177835 gene locus_tag LOCUS_60000 gene treZ 179589 177835 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_60000 181997 179598 gene locus_tag LOCUS_60010 gene treY 181997 179598 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_60010 184120 181994 gene locus_tag LOCUS_60020 gene glgX 184120 181994 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224463.1 protein_id gnl|my_center|LOCUS_60020 184517 184173 gene locus_tag LOCUS_60030 184517 184173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 186498 184609 gene locus_tag LOCUS_60040 gene malQ 186498 184609 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224462.1 protein_id gnl|my_center|LOCUS_60040 187549 186620 gene locus_tag LOCUS_60050 187549 186620 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054086.1 protein_id gnl|my_center|LOCUS_60050 187650 188114 gene locus_tag LOCUS_60060 gene bcpB 187650 188114 CDS product peroxiredoxin BcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407974.1 protein_id gnl|my_center|LOCUS_60060 188705 188121 gene locus_tag LOCUS_60070 188705 188121 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_60070 189658 188708 gene locus_tag LOCUS_60080 189658 188708 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_60080 190755 189934 gene locus_tag LOCUS_60090 190755 189934 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222712.1 protein_id gnl|my_center|LOCUS_60090 193284 191164 gene locus_tag LOCUS_60100 193284 191164 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 protein_id gnl|my_center|LOCUS_60100 194611 193508 gene locus_tag LOCUS_60110 194611 193508 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223243.1 protein_id gnl|my_center|LOCUS_60110 195332 194634 gene locus_tag LOCUS_60120 195332 194634 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468912.1 protein_id gnl|my_center|LOCUS_60120 195962 195510 gene locus_tag LOCUS_60130 195962 195510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 196019 196846 gene locus_tag LOCUS_60140 196019 196846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_60140 196872 197081 gene locus_tag LOCUS_60150 196872 197081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60150 197086 197652 gene locus_tag LOCUS_60160 197086 197652 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_60160 198288 197665 gene locus_tag LOCUS_60170 198288 197665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 199120 198314 gene locus_tag LOCUS_60180 199120 198314 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230751.1 protein_id gnl|my_center|LOCUS_60180 199417 199794 gene locus_tag LOCUS_60190 199417 199794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 199930 202062 gene locus_tag LOCUS_60200 199930 202062 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 protein_id gnl|my_center|LOCUS_60200 203414 202716 gene locus_tag LOCUS_60210 203414 202716 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_60210 203585 204325 gene locus_tag LOCUS_60220 203585 204325 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466882.1 protein_id gnl|my_center|LOCUS_60220 204386 205957 gene locus_tag LOCUS_60230 204386 205957 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224830.1 protein_id gnl|my_center|LOCUS_60230 207747 205984 gene locus_tag LOCUS_60240 207747 205984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_60240 209219 208404 gene locus_tag LOCUS_60250 209219 208404 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_60250 209495 209286 gene locus_tag LOCUS_60260 209495 209286 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221457660.1 protein_id gnl|my_center|LOCUS_60260 211301 209673 gene locus_tag LOCUS_60270 211301 209673 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224728.1 protein_id gnl|my_center|LOCUS_60270 211445 212218 gene locus_tag LOCUS_60280 211445 212218 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_60280 212857 212414 gene locus_tag LOCUS_60290 212857 212414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 213365 212850 gene locus_tag LOCUS_60300 213365 212850 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_60300 213865 213362 gene locus_tag LOCUS_60310 213865 213362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 214497 213862 gene locus_tag LOCUS_60320 214497 213862 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_60320 215123 214539 gene locus_tag LOCUS_60330 215123 214539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 215423 216400 gene locus_tag LOCUS_60340 215423 216400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_60340 219254 216462 gene locus_tag LOCUS_60350 219254 216462 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224726.1 protein_id gnl|my_center|LOCUS_60350 221063 219399 gene locus_tag LOCUS_60360 gene dgt 221063 219399 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224725.1 protein_id gnl|my_center|LOCUS_60360 221080 221376 gene locus_tag LOCUS_60370 221080 221376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 221378 222943 gene locus_tag LOCUS_60380 221378 222943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 >Feature sequence12 656 2890 gene locus_tag LOCUS_60390 656 2890 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_60390 3106 6048 gene locus_tag LOCUS_60400 3106 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 6165 9104 gene locus_tag LOCUS_60410 6165 9104 CDS product glycoside hydrolase family 48 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227017.1 protein_id gnl|my_center|LOCUS_60410 9375 11939 gene locus_tag LOCUS_60420 9375 11939 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226193.1 protein_id gnl|my_center|LOCUS_60420 11941 12939 gene locus_tag LOCUS_60430 11941 12939 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 protein_id gnl|my_center|LOCUS_60430 13012 14973 gene locus_tag LOCUS_60440 13012 14973 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226188.1 protein_id gnl|my_center|LOCUS_60440 14999 16618 gene locus_tag LOCUS_60450 14999 16618 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804967.1 protein_id gnl|my_center|LOCUS_60450 16605 17579 gene locus_tag LOCUS_60460 16605 17579 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804968.1 protein_id gnl|my_center|LOCUS_60460 17576 18520 gene locus_tag LOCUS_60470 17576 18520 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804969.1 protein_id gnl|my_center|LOCUS_60470 18517 20475 gene locus_tag LOCUS_60480 18517 20475 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_60480 20472 20798 gene locus_tag LOCUS_60490 20472 20798 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_60490 23561 20919 gene locus_tag LOCUS_60500 23561 20919 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_60500 23651 24355 gene locus_tag LOCUS_60510 23651 24355 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226771.1 protein_id gnl|my_center|LOCUS_60510 24414 25181 gene locus_tag LOCUS_60520 gene fabI 24414 25181 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_60520 25501 26523 gene locus_tag LOCUS_60530 25501 26523 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_60530 26520 26993 gene locus_tag LOCUS_60540 26520 26993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 27027 27824 gene locus_tag LOCUS_60550 27027 27824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226765.1 protein_id gnl|my_center|LOCUS_60550 28253 30076 gene locus_tag LOCUS_60560 28253 30076 CDS product cellulose 1,4-beta-cellobiosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031002.1 protein_id gnl|my_center|LOCUS_60560 30191 31060 gene locus_tag LOCUS_60570 30191 31060 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226502.1 protein_id gnl|my_center|LOCUS_60570 31245 32648 gene locus_tag LOCUS_60580 31245 32648 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_60580 32645 34579 gene locus_tag LOCUS_60590 32645 34579 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_60590 36398 34611 gene locus_tag LOCUS_60600 gene ctaD 36398 34611 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_60600 36788 37972 gene locus_tag LOCUS_60610 gene mshC 36788 37972 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226760.1 protein_id gnl|my_center|LOCUS_60610 39832 38027 gene locus_tag LOCUS_60620 39832 38027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 40531 40031 gene locus_tag LOCUS_60630 40531 40031 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867895.1 protein_id gnl|my_center|LOCUS_60630 40635 41555 gene locus_tag LOCUS_60640 40635 41555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_60640 41552 43144 gene locus_tag LOCUS_60650 41552 43144 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_60650 43197 43754 gene locus_tag LOCUS_60660 43197 43754 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 protein_id gnl|my_center|LOCUS_60660 43751 44989 gene locus_tag LOCUS_60670 43751 44989 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226756.1 protein_id gnl|my_center|LOCUS_60670 46012 45116 gene locus_tag LOCUS_60680 46012 45116 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226750.1 protein_id gnl|my_center|LOCUS_60680 46063 46488 gene locus_tag LOCUS_60690 46063 46488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 46508 47170 gene locus_tag LOCUS_60700 46508 47170 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_60700 47905 47171 gene locus_tag LOCUS_60710 47905 47171 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_60710 48102 47917 gene locus_tag LOCUS_60720 48102 47917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 49023 48373 gene locus_tag LOCUS_60730 49023 48373 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027474.1 protein_id gnl|my_center|LOCUS_60730 49042 50103 gene locus_tag LOCUS_60740 49042 50103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 51298 50123 gene locus_tag LOCUS_60750 51298 50123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 51306 51836 gene locus_tag LOCUS_60760 51306 51836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 51892 52155 gene locus_tag LOCUS_60770 51892 52155 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 protein_id gnl|my_center|LOCUS_60770 52152 52439 gene locus_tag LOCUS_60780 52152 52439 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_60780 53056 52424 gene locus_tag LOCUS_60790 53056 52424 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226101.1 protein_id gnl|my_center|LOCUS_60790 53868 53095 gene locus_tag LOCUS_60800 53868 53095 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_60800 54744 53878 gene locus_tag LOCUS_60810 54744 53878 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_60810 55953 54799 gene locus_tag LOCUS_60820 55953 54799 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226999.1 protein_id gnl|my_center|LOCUS_60820 56041 56754 gene locus_tag LOCUS_60830 56041 56754 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_60830 56797 57927 gene locus_tag LOCUS_60840 56797 57927 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226740.1 protein_id gnl|my_center|LOCUS_60840 58576 57902 gene locus_tag LOCUS_60850 58576 57902 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_60850 59700 58573 gene locus_tag LOCUS_60860 59700 58573 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_60860 59800 60399 gene locus_tag LOCUS_60870 59800 60399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100682.1 protein_id gnl|my_center|LOCUS_60870 60498 61325 gene locus_tag LOCUS_60880 60498 61325 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226739.1 protein_id gnl|my_center|LOCUS_60880 62195 61395 gene locus_tag LOCUS_60890 62195 61395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 62436 64235 gene locus_tag LOCUS_60900 gene arc 62436 64235 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284603.1 protein_id gnl|my_center|LOCUS_60900 64958 64314 gene locus_tag LOCUS_60910 64958 64314 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222860.1 protein_id gnl|my_center|LOCUS_60910 66040 64955 gene locus_tag LOCUS_60920 66040 64955 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222861.1 protein_id gnl|my_center|LOCUS_60920 66173 67081 gene locus_tag LOCUS_60930 66173 67081 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975592.1 protein_id gnl|my_center|LOCUS_60930 67078 67470 gene locus_tag LOCUS_60940 67078 67470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 67467 68234 gene locus_tag LOCUS_60950 67467 68234 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_60950 68315 69244 gene locus_tag LOCUS_60960 68315 69244 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226729.1 protein_id gnl|my_center|LOCUS_60960 69975 69676 gene locus_tag LOCUS_60970 69975 69676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 70460 69966 gene locus_tag LOCUS_60980 70460 69966 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226727.1 protein_id gnl|my_center|LOCUS_60980 70565 73045 gene locus_tag LOCUS_60990 70565 73045 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_60990 73098 74591 gene locus_tag LOCUS_61000 gene dop 73098 74591 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_61000 74676 74870 gene locus_tag LOCUS_61010 74676 74870 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226725.1 protein_id gnl|my_center|LOCUS_61010 74905 75753 gene locus_tag LOCUS_61020 gene prcB 74905 75753 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226724.1 protein_id gnl|my_center|LOCUS_61020 75809 76615 gene locus_tag LOCUS_61030 gene prcA 75809 76615 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_61030 78237 76681 gene locus_tag LOCUS_61040 78237 76681 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977164.1 protein_id gnl|my_center|LOCUS_61040 79720 78230 gene locus_tag LOCUS_61050 gene glpK 79720 78230 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_61050 80459 79749 gene locus_tag LOCUS_61060 80459 79749 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977166.1 protein_id gnl|my_center|LOCUS_61060 81324 80563 gene locus_tag LOCUS_61070 81324 80563 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226255.1 protein_id gnl|my_center|LOCUS_61070 81709 81371 gene locus_tag LOCUS_61080 81709 81371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 81866 82384 gene locus_tag LOCUS_61090 81866 82384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 83340 82444 gene locus_tag LOCUS_61100 83340 82444 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085299.1 protein_id gnl|my_center|LOCUS_61100 84800 83379 gene locus_tag LOCUS_61110 84800 83379 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226721.1 protein_id gnl|my_center|LOCUS_61110 84893 86251 gene locus_tag LOCUS_61120 gene pafA 84893 86251 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226720.1 protein_id gnl|my_center|LOCUS_61120 86352 86909 gene locus_tag LOCUS_61130 86352 86909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 86902 87771 gene locus_tag LOCUS_61140 86902 87771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 88387 87758 gene locus_tag LOCUS_61150 88387 87758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029548.1 protein_id gnl|my_center|LOCUS_61150 89349 88384 gene locus_tag LOCUS_61160 89349 88384 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029547.1 protein_id gnl|my_center|LOCUS_61160 89494 90000 gene locus_tag LOCUS_61170 89494 90000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61170 90319 91305 gene locus_tag LOCUS_61180 90319 91305 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_61180 91302 92273 gene locus_tag LOCUS_61190 91302 92273 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_61190 92292 92558 gene locus_tag LOCUS_61200 92292 92558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 92551 92937 gene locus_tag LOCUS_61210 92551 92937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 92974 93969 gene locus_tag LOCUS_61220 gene tatC 92974 93969 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226711.1 protein_id gnl|my_center|LOCUS_61220 94044 94922 gene locus_tag LOCUS_61230 94044 94922 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226710.1 protein_id gnl|my_center|LOCUS_61230 95376 94906 gene locus_tag LOCUS_61240 95376 94906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61240 95520 98285 gene locus_tag LOCUS_61250 95520 98285 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226708.1 protein_id gnl|my_center|LOCUS_61250 98418 99113 gene locus_tag LOCUS_61260 98418 99113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 99239 100456 gene locus_tag LOCUS_61270 99239 100456 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878254.1 protein_id gnl|my_center|LOCUS_61270 101872 100901 gene locus_tag LOCUS_61280 101872 100901 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226704.1 protein_id gnl|my_center|LOCUS_61280 102185 103366 gene locus_tag LOCUS_61290 102185 103366 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_61290 103462 103812 gene locus_tag LOCUS_61300 103462 103812 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092399.1 protein_id gnl|my_center|LOCUS_61300 104700 103816 gene locus_tag LOCUS_61310 104700 103816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 105494 104745 gene locus_tag LOCUS_61320 105494 104745 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 protein_id gnl|my_center|LOCUS_61320 105573 106688 gene locus_tag LOCUS_61330 105573 106688 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876756.1 protein_id gnl|my_center|LOCUS_61330 106702 107325 gene locus_tag LOCUS_61340 106702 107325 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_61340 108473 107535 gene locus_tag LOCUS_61350 108473 107535 CDS product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 protein_id gnl|my_center|LOCUS_61350 108593 109789 gene locus_tag LOCUS_61360 108593 109789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847962.1 protein_id gnl|my_center|LOCUS_61360 109893 111047 gene locus_tag LOCUS_61370 109893 111047 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_61370 111502 112755 gene locus_tag LOCUS_61380 111502 112755 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847989.1 protein_id gnl|my_center|LOCUS_61380 112866 116177 gene locus_tag LOCUS_61390 112866 116177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 117169 116228 gene locus_tag LOCUS_61400 117169 116228 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_61400 117460 121815 gene locus_tag LOCUS_61410 117460 121815 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227339.1 protein_id gnl|my_center|LOCUS_61410 121876 128640 gene locus_tag LOCUS_61420 121876 128640 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157376789.1 protein_id gnl|my_center|LOCUS_61420 128663 128926 gene locus_tag LOCUS_61430 128663 128926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 130463 129033 gene locus_tag LOCUS_61440 130463 129033 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530004.1 protein_id gnl|my_center|LOCUS_61440 130483 131787 gene locus_tag LOCUS_61450 130483 131787 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484272.1 protein_id gnl|my_center|LOCUS_61450 133482 131797 gene locus_tag LOCUS_61460 133482 131797 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_61460 133748 134512 gene locus_tag LOCUS_61470 133748 134512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 134650 135636 gene locus_tag LOCUS_61480 134650 135636 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_61480 135883 136917 gene locus_tag LOCUS_61490 135883 136917 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390592.1 protein_id gnl|my_center|LOCUS_61490 137521 136937 gene locus_tag LOCUS_61500 137521 136937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886848.1 protein_id gnl|my_center|LOCUS_61500 137746 137531 gene locus_tag LOCUS_61510 137746 137531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 138930 137845 gene locus_tag LOCUS_61520 138930 137845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 139430 138927 gene locus_tag LOCUS_61530 139430 138927 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224154.1 protein_id gnl|my_center|LOCUS_61530 140465 139638 gene locus_tag LOCUS_61540 140465 139638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 141330 140458 gene locus_tag LOCUS_61550 141330 140458 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_61550 143264 141327 gene locus_tag LOCUS_61560 143264 141327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 143588 144814 gene locus_tag LOCUS_61570 143588 144814 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_61570 144831 145841 gene locus_tag LOCUS_61580 144831 145841 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226330.1 protein_id gnl|my_center|LOCUS_61580 146783 145860 gene locus_tag LOCUS_61590 146783 145860 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_61590 146917 147816 gene locus_tag LOCUS_61600 146917 147816 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223330.1 protein_id gnl|my_center|LOCUS_61600 148033 148425 gene locus_tag LOCUS_61610 148033 148425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 148452 149894 gene locus_tag LOCUS_61620 148452 149894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 149891 150166 gene locus_tag LOCUS_61630 gene fdxC 149891 150166 CDS product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_61630 152052 150229 gene locus_tag LOCUS_61640 152052 150229 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_61640 152094 152684 gene locus_tag LOCUS_61650 152094 152684 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224261.1 protein_id gnl|my_center|LOCUS_61650 153479 152730 gene locus_tag LOCUS_61660 153479 152730 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222836.1 protein_id gnl|my_center|LOCUS_61660 153682 154833 gene locus_tag LOCUS_61670 153682 154833 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015602777.1 protein_id gnl|my_center|LOCUS_61670 155998 154883 gene locus_tag LOCUS_61680 155998 154883 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031759.1 protein_id gnl|my_center|LOCUS_61680 157723 156518 gene locus_tag LOCUS_61690 157723 156518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 157826 160216 gene locus_tag LOCUS_61700 157826 160216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 160234 160500 gene locus_tag LOCUS_61710 160234 160500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 160643 167683 gene locus_tag LOCUS_61720 160643 167683 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031213.1 protein_id gnl|my_center|LOCUS_61720 167680 169134 gene locus_tag LOCUS_61730 167680 169134 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_61730 170794 169142 gene locus_tag LOCUS_61740 170794 169142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61740 170860 171090 gene locus_tag LOCUS_61750 170860 171090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 171410 172567 gene locus_tag LOCUS_61760 171410 172567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031811.1 protein_id gnl|my_center|LOCUS_61760 173631 172735 gene locus_tag LOCUS_61770 173631 172735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 173795 174946 gene locus_tag LOCUS_61780 173795 174946 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390556.1 protein_id gnl|my_center|LOCUS_61780 174943 175353 gene locus_tag LOCUS_61790 174943 175353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61790 176292 175375 gene locus_tag LOCUS_61800 176292 175375 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_61800 176518 177786 gene locus_tag LOCUS_61810 176518 177786 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973891.1 protein_id gnl|my_center|LOCUS_61810 177783 179012 gene locus_tag LOCUS_61820 177783 179012 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030048.1 protein_id gnl|my_center|LOCUS_61820 179009 179257 gene locus_tag LOCUS_61830 179009 179257 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 protein_id gnl|my_center|LOCUS_61830 179292 180998 gene locus_tag LOCUS_61840 179292 180998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 180995 181501 gene locus_tag LOCUS_61850 180995 181501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 181512 182882 gene locus_tag LOCUS_61860 gene accC 181512 182882 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_61860 182891 183676 gene locus_tag LOCUS_61870 182891 183676 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973892.1 protein_id gnl|my_center|LOCUS_61870 183715 184656 gene locus_tag LOCUS_61880 183715 184656 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030049.1 protein_id gnl|my_center|LOCUS_61880 184656 185747 gene locus_tag LOCUS_61890 gene actVA 184656 185747 CDS product actinorhodin polyketide dimerase ActVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030043.1 protein_id gnl|my_center|LOCUS_61890 185744 186187 gene locus_tag LOCUS_61900 185744 186187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 186264 187328 gene locus_tag LOCUS_61910 186264 187328 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_61910 187325 188278 gene locus_tag LOCUS_61920 187325 188278 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030038.1 protein_id gnl|my_center|LOCUS_61920 188265 188702 gene locus_tag LOCUS_61930 188265 188702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61930 188754 189599 gene locus_tag LOCUS_61940 188754 189599 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_61940 189704 190999 gene locus_tag LOCUS_61950 189704 190999 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_61950 191007 191588 gene locus_tag LOCUS_61960 gene actVB 191007 191588 CDS product actinorhodin polyketide dimerase ActVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973886.1 protein_id gnl|my_center|LOCUS_61960 191582 192154 gene locus_tag LOCUS_61970 191582 192154 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_61970 192250 193221 gene locus_tag LOCUS_61980 192250 193221 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222572.1 protein_id gnl|my_center|LOCUS_61980 193214 194515 gene locus_tag LOCUS_61990 gene rfbH 193214 194515 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227240.1 protein_id gnl|my_center|LOCUS_61990 195446 194607 gene locus_tag LOCUS_62000 195446 194607 CDS product AfsR/SARP family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228641.1 protein_id gnl|my_center|LOCUS_62000 196049 196891 gene locus_tag LOCUS_62010 196049 196891 CDS product AfsR/SARP family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228641.1 protein_id gnl|my_center|LOCUS_62010 198401 196986 gene locus_tag LOCUS_62020 198401 196986 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_62020 198991 198431 gene locus_tag LOCUS_62030 198991 198431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62030 200598 199177 gene locus_tag LOCUS_62040 200598 199177 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091305175.1 protein_id gnl|my_center|LOCUS_62040 201611 200748 gene locus_tag LOCUS_62050 201611 200748 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 protein_id gnl|my_center|LOCUS_62050 201941 202996 gene locus_tag LOCUS_62060 201941 202996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 203076 203885 gene locus_tag LOCUS_62070 203076 203885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 203882 204778 gene locus_tag LOCUS_62080 gene rfbA 203882 204778 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227213.1 protein_id gnl|my_center|LOCUS_62080 204825 205538 gene locus_tag LOCUS_62090 204825 205538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 205642 206637 gene locus_tag LOCUS_62100 205642 206637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 206625 207080 gene locus_tag LOCUS_62110 206625 207080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 207005 207634 gene locus_tag LOCUS_62120 207005 207634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 207876 207544 gene locus_tag LOCUS_62130 207876 207544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 207790 208959 gene locus_tag LOCUS_62140 gene iroB 207790 208959 CDS product salmochelin biosynthesis C-glycosyltransferase IroB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703469.1 protein_id gnl|my_center|LOCUS_62140 210227 209184 gene locus_tag LOCUS_62150 210227 209184 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 protein_id gnl|my_center|LOCUS_62150 212820 210439 gene locus_tag LOCUS_62160 212820 210439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 213235 212828 gene locus_tag LOCUS_62170 213235 212828 CDS product RIP homotypic interaction motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229547.1 protein_id gnl|my_center|LOCUS_62170 214325 213336 gene locus_tag LOCUS_62180 214325 213336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 214936 214322 gene locus_tag LOCUS_62190 214936 214322 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_62190 215871 215011 gene locus_tag LOCUS_62200 215871 215011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 >Feature sequence13 842 468 gene locus_tag LOCUS_62210 842 468 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222125.1 protein_id gnl|my_center|LOCUS_62210 1801 839 gene locus_tag LOCUS_62220 1801 839 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_62220 1822 2622 gene locus_tag LOCUS_62230 1822 2622 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_62230 2933 2589 gene locus_tag LOCUS_62240 2933 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 3955 2936 gene locus_tag LOCUS_62250 3955 2936 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225876.1 protein_id gnl|my_center|LOCUS_62250 4608 3979 gene locus_tag LOCUS_62260 4608 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 5278 4682 gene locus_tag LOCUS_62270 5278 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 5392 6198 gene locus_tag LOCUS_62280 5392 6198 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 protein_id gnl|my_center|LOCUS_62280 6198 7409 gene locus_tag LOCUS_62290 6198 7409 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029167.1 protein_id gnl|my_center|LOCUS_62290 7893 7369 gene locus_tag LOCUS_62300 7893 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62300 8343 7978 gene locus_tag LOCUS_62310 8343 7978 CDS product peptidase inhibitor family I36 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228604.1 protein_id gnl|my_center|LOCUS_62310 9222 8410 gene locus_tag LOCUS_62320 9222 8410 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230275.1 protein_id gnl|my_center|LOCUS_62320 9325 10071 gene locus_tag LOCUS_62330 9325 10071 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_62330 10810 10064 gene locus_tag LOCUS_62340 10810 10064 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230275.1 protein_id gnl|my_center|LOCUS_62340 12043 10898 gene locus_tag LOCUS_62350 12043 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 12559 12164 gene locus_tag LOCUS_62360 12559 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 13428 12664 gene locus_tag LOCUS_62370 13428 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 13751 13425 gene locus_tag LOCUS_62380 13751 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 14428 13748 gene locus_tag LOCUS_62390 14428 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 14585 14848 gene locus_tag LOCUS_62400 14585 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 16244 14838 gene locus_tag LOCUS_62410 16244 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 16747 16340 gene locus_tag LOCUS_62420 16747 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 18923 16812 gene locus_tag LOCUS_62430 18923 16812 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_62430 20095 18920 gene locus_tag LOCUS_62440 20095 18920 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_62440 20673 20224 gene locus_tag LOCUS_62450 20673 20224 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222821.1 protein_id gnl|my_center|LOCUS_62450 21566 20670 gene locus_tag LOCUS_62460 21566 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 protein_id gnl|my_center|LOCUS_62460 21652 22332 gene locus_tag LOCUS_62470 21652 22332 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 protein_id gnl|my_center|LOCUS_62470 23589 22393 gene locus_tag LOCUS_62480 23589 22393 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224510.1 protein_id gnl|my_center|LOCUS_62480 24421 23705 gene locus_tag LOCUS_62490 24421 23705 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156987.1 protein_id gnl|my_center|LOCUS_62490 24676 25839 gene locus_tag LOCUS_62500 24676 25839 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230328.1 protein_id gnl|my_center|LOCUS_62500 26616 26080 gene locus_tag LOCUS_62510 26616 26080 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284339.1 protein_id gnl|my_center|LOCUS_62510 26715 27767 gene locus_tag LOCUS_62520 gene hemE 26715 27767 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_62520 27779 29176 gene locus_tag LOCUS_62530 gene hemG 27779 29176 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_62530 29193 29885 gene locus_tag LOCUS_62540 29193 29885 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224514.1 protein_id gnl|my_center|LOCUS_62540 33150 29938 gene locus_tag LOCUS_62550 33150 29938 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_62550 36455 33252 gene locus_tag LOCUS_62560 36455 33252 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_62560 36349 36741 gene locus_tag LOCUS_62570 36349 36741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 39950 36726 gene locus_tag LOCUS_62580 39950 36726 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_62580 40678 40142 gene locus_tag LOCUS_62590 40678 40142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086843828.1 protein_id gnl|my_center|LOCUS_62590 41004 40660 gene locus_tag LOCUS_62600 41004 40660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 41642 41001 gene locus_tag LOCUS_62610 41642 41001 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224517.1 protein_id gnl|my_center|LOCUS_62610 41526 41846 gene locus_tag LOCUS_62620 41526 41846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 43471 42647 gene locus_tag LOCUS_62630 43471 42647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 44390 43413 gene locus_tag LOCUS_62640 44390 43413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 45339 44431 gene locus_tag LOCUS_62650 45339 44431 CDS product TIGR04222 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224518.1 protein_id gnl|my_center|LOCUS_62650 46026 45589 gene locus_tag LOCUS_62660 gene msrB 46026 45589 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224520.1 protein_id gnl|my_center|LOCUS_62660 46398 46084 gene locus_tag LOCUS_62670 46398 46084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284340.1 protein_id gnl|my_center|LOCUS_62670 47382 46438 gene locus_tag LOCUS_62680 47382 46438 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_62680 47502 48101 gene locus_tag LOCUS_62690 47502 48101 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536888.1 protein_id gnl|my_center|LOCUS_62690 49362 48193 gene locus_tag LOCUS_62700 49362 48193 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_62700 50533 49382 gene locus_tag LOCUS_62710 50533 49382 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_62710 50611 51225 gene locus_tag LOCUS_62720 50611 51225 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_62720 51780 51241 gene locus_tag LOCUS_62730 51780 51241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 51945 52937 gene locus_tag LOCUS_62740 51945 52937 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224524.1 protein_id gnl|my_center|LOCUS_62740 53463 53738 gene locus_tag LOCUS_62750 53463 53738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 53797 54666 gene locus_tag LOCUS_62760 53797 54666 CDS product aminoglycoside 3'-phosphotransferase/choline kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975557.1 protein_id gnl|my_center|LOCUS_62760 54804 55001 gene locus_tag LOCUS_62770 54804 55001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62770 55126 57894 gene locus_tag LOCUS_62780 55126 57894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 57932 58879 gene locus_tag LOCUS_62790 57932 58879 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226393.1 protein_id gnl|my_center|LOCUS_62790 58976 59578 gene locus_tag LOCUS_62800 58976 59578 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_62800 59629 60318 gene locus_tag LOCUS_62810 59629 60318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 63096 61579 gene locus_tag LOCUS_62820 63096 61579 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224537.1 protein_id gnl|my_center|LOCUS_62820 63232 64143 gene locus_tag LOCUS_62830 63232 64143 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_62830 64147 64584 gene locus_tag LOCUS_62840 64147 64584 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_62840 65057 64581 gene locus_tag LOCUS_62850 65057 64581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 66158 65085 gene locus_tag LOCUS_62860 66158 65085 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224538.1 protein_id gnl|my_center|LOCUS_62860 66718 66185 gene locus_tag LOCUS_62870 66718 66185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 67215 66715 gene locus_tag LOCUS_62880 67215 66715 CDS product DUF6286 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224540.1 protein_id gnl|my_center|LOCUS_62880 67533 67216 gene locus_tag LOCUS_62890 67533 67216 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224541.1 protein_id gnl|my_center|LOCUS_62890 67706 67530 gene locus_tag LOCUS_62900 67706 67530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 67966 67703 gene locus_tag LOCUS_62910 67966 67703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62910 68412 67963 gene locus_tag LOCUS_62920 68412 67963 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224543.1 protein_id gnl|my_center|LOCUS_62920 69245 68466 gene locus_tag LOCUS_62930 69245 68466 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_62930 69279 70289 gene locus_tag LOCUS_62940 gene zapE 69279 70289 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224547.1 protein_id gnl|my_center|LOCUS_62940 70357 70599 gene locus_tag LOCUS_62950 70357 70599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 70748 72385 gene locus_tag LOCUS_62960 70748 72385 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_62960 72415 73263 gene locus_tag LOCUS_62970 72415 73263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 73293 73439 gene locus_tag LOCUS_62980 73293 73439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 74234 73467 gene locus_tag LOCUS_62990 74234 73467 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227682.1 protein_id gnl|my_center|LOCUS_62990 74277 74912 gene locus_tag LOCUS_63000 74277 74912 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140133.1 protein_id gnl|my_center|LOCUS_63000 76251 74878 gene locus_tag LOCUS_63010 76251 74878 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224551.1 protein_id gnl|my_center|LOCUS_63010 77540 76314 gene locus_tag LOCUS_63020 gene rocD 77540 76314 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224552.1 protein_id gnl|my_center|LOCUS_63020 77682 78551 gene locus_tag LOCUS_63030 77682 78551 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224555.1 protein_id gnl|my_center|LOCUS_63030 78638 79771 gene locus_tag LOCUS_63040 78638 79771 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 protein_id gnl|my_center|LOCUS_63040 79827 80573 gene locus_tag LOCUS_63050 79827 80573 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_63050 80855 81667 gene locus_tag LOCUS_63060 80855 81667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_63060 81651 82040 gene locus_tag LOCUS_63070 81651 82040 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_63070 82130 83269 gene locus_tag LOCUS_63080 82130 83269 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224737.1 protein_id gnl|my_center|LOCUS_63080 84548 83352 gene locus_tag LOCUS_63090 84548 83352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 84586 85314 gene locus_tag LOCUS_63100 84586 85314 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_63100 85461 85318 gene locus_tag LOCUS_63110 85461 85318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 85656 86423 gene locus_tag LOCUS_63120 85656 86423 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_63120 86464 87801 gene locus_tag LOCUS_63130 86464 87801 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227747.1 protein_id gnl|my_center|LOCUS_63130 87806 89656 gene locus_tag LOCUS_63140 87806 89656 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_63140 91011 89704 gene locus_tag LOCUS_63150 91011 89704 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227742.1 protein_id gnl|my_center|LOCUS_63150 91407 91673 gene locus_tag LOCUS_63160 91407 91673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 94052 91734 gene locus_tag LOCUS_63170 gene secA2 94052 91734 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_63170 94262 95149 gene locus_tag LOCUS_63180 94262 95149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 96484 95198 gene locus_tag LOCUS_63190 96484 95198 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225849.1 protein_id gnl|my_center|LOCUS_63190 99464 96498 gene locus_tag LOCUS_63200 99464 96498 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_63200 99622 100419 gene locus_tag LOCUS_63210 99622 100419 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484222.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_63210 100572 100844 gene locus_tag LOCUS_63220 100572 100844 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_63220 101610 100990 gene locus_tag LOCUS_63230 101610 100990 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_63230 101701 102846 gene locus_tag LOCUS_63240 101701 102846 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072191.1 protein_id gnl|my_center|LOCUS_63240 102866 104068 gene locus_tag LOCUS_63250 102866 104068 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_63250 104069 104830 gene locus_tag LOCUS_63260 104069 104830 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_63260 104929 106122 gene locus_tag LOCUS_63270 104929 106122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63270 106119 107579 gene locus_tag LOCUS_63280 106119 107579 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 protein_id gnl|my_center|LOCUS_63280 107596 108321 gene locus_tag LOCUS_63290 107596 108321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 108344 108931 gene locus_tag LOCUS_63300 108344 108931 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224998.1 protein_id gnl|my_center|LOCUS_63300 108928 109491 gene locus_tag LOCUS_63310 108928 109491 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_63310 110067 109612 gene locus_tag LOCUS_63320 110067 109612 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_63320 110831 110070 gene locus_tag LOCUS_63330 gene fabG 110831 110070 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225006.1 protein_id gnl|my_center|LOCUS_63330 110979 111773 gene locus_tag LOCUS_63340 110979 111773 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033260715.1 protein_id gnl|my_center|LOCUS_63340 111779 112732 gene locus_tag LOCUS_63350 111779 112732 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229986.1 protein_id gnl|my_center|LOCUS_63350 113005 112793 gene locus_tag LOCUS_63360 113005 112793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 112938 113510 gene locus_tag LOCUS_63370 112938 113510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 114082 113612 gene locus_tag LOCUS_63380 114082 113612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 114234 114524 gene locus_tag LOCUS_63390 114234 114524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 115651 114737 gene locus_tag LOCUS_63400 115651 114737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 115973 115752 gene locus_tag LOCUS_63410 115973 115752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 117188 115992 gene locus_tag LOCUS_63420 117188 115992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 118443 117328 gene locus_tag LOCUS_63430 118443 117328 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227797.1 protein_id gnl|my_center|LOCUS_63430 119000 118518 gene locus_tag LOCUS_63440 119000 118518 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 protein_id gnl|my_center|LOCUS_63440 119071 120129 gene locus_tag LOCUS_63450 119071 120129 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225994.1 protein_id gnl|my_center|LOCUS_63450 120276 120506 gene locus_tag LOCUS_63460 120276 120506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63460 120568 121296 gene locus_tag LOCUS_63470 gene cmk 120568 121296 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227793.1 protein_id gnl|my_center|LOCUS_63470 121293 121937 gene locus_tag LOCUS_63480 121293 121937 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227792.1 protein_id gnl|my_center|LOCUS_63480 121934 123340 gene locus_tag LOCUS_63490 gene der 121934 123340 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467391.1 protein_id gnl|my_center|LOCUS_63490 123384 124034 gene locus_tag LOCUS_63500 123384 124034 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230063.1 protein_id gnl|my_center|LOCUS_63500 124028 125146 gene locus_tag LOCUS_63510 124028 125146 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029135.1 protein_id gnl|my_center|LOCUS_63510 125325 125399 gene locus_tag LOCUS_t00560 125325 125399 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 125516 126475 gene locus_tag LOCUS_63520 gene xerD 125516 126475 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_63520 126504 127136 gene locus_tag LOCUS_63530 126504 127136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63530 127239 128030 gene locus_tag LOCUS_63540 127239 128030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63540 128027 129253 gene locus_tag LOCUS_63550 128027 129253 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 protein_id gnl|my_center|LOCUS_63550 130015 129380 gene locus_tag LOCUS_63560 130015 129380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_63560 130364 130179 gene locus_tag LOCUS_63570 130364 130179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 130720 130983 gene locus_tag LOCUS_63580 130720 130983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 132052 131153 gene locus_tag LOCUS_63590 132052 131153 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 protein_id gnl|my_center|LOCUS_63590 133031 132186 gene locus_tag LOCUS_63600 133031 132186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63600 133502 134779 gene locus_tag LOCUS_63610 133502 134779 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_63610 134824 135702 gene locus_tag LOCUS_63620 134824 135702 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_63620 135699 136571 gene locus_tag LOCUS_63630 135699 136571 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_63630 136641 137639 gene locus_tag LOCUS_63640 136641 137639 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_63640 137917 139524 gene locus_tag LOCUS_63650 137917 139524 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027200.1 protein_id gnl|my_center|LOCUS_63650 139777 141138 gene locus_tag LOCUS_63660 139777 141138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63660 141254 143506 gene locus_tag LOCUS_63670 141254 143506 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 protein_id gnl|my_center|LOCUS_63670 143628 145406 gene locus_tag LOCUS_63680 143628 145406 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742058.1 protein_id gnl|my_center|LOCUS_63680 145418 146746 gene locus_tag LOCUS_63690 145418 146746 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638993.1 protein_id gnl|my_center|LOCUS_63690 146766 146951 gene locus_tag LOCUS_63700 146766 146951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 147018 148514 gene locus_tag LOCUS_63710 147018 148514 CDS product ISL3-like element IS466 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029008.1 protein_id gnl|my_center|LOCUS_63710 148923 148555 gene locus_tag LOCUS_63720 148923 148555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 149403 149110 gene locus_tag LOCUS_63730 149403 149110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 150065 149439 gene locus_tag LOCUS_63740 150065 149439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 151525 150452 gene locus_tag LOCUS_63750 151525 150452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 150760 150850 gene locus_tag LOCUS_t00570 150760 150850 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 151691 152242 gene locus_tag LOCUS_63760 151691 152242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 152855 153037 gene locus_tag LOCUS_63770 152855 153037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63770 153102 156158 gene locus_tag LOCUS_63780 153102 156158 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 protein_id gnl|my_center|LOCUS_63780 156155 157327 gene locus_tag LOCUS_63790 156155 157327 CDS product lanthionine synthetase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 protein_id gnl|my_center|LOCUS_63790 157349 158599 gene locus_tag LOCUS_63800 157349 158599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63800 161473 158675 gene locus_tag LOCUS_63810 161473 158675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 162967 161981 gene locus_tag LOCUS_63820 162967 161981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222307.1 protein_id gnl|my_center|LOCUS_63820 163170 162964 gene locus_tag LOCUS_63830 163170 162964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 163796 163167 gene locus_tag LOCUS_63840 163796 163167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 164023 163793 gene locus_tag LOCUS_63850 164023 163793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 164905 165483 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggaccacccccgctcgcgcggggaaga 166050 165544 gene locus_tag LOCUS_63860 166050 165544 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_63860 166640 166236 gene locus_tag LOCUS_63870 166640 166236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 169696 167315 gene locus_tag LOCUS_63880 169696 167315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 169819 169989 gene locus_tag LOCUS_63890 169819 169989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63890 170026 170331 gene locus_tag LOCUS_63900 170026 170331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_63900 170385 170693 gene locus_tag LOCUS_63910 170385 170693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63910 171014 170778 gene locus_tag LOCUS_63920 171014 170778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 170896 171450 gene locus_tag LOCUS_63930 170896 171450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 171803 172357 gene locus_tag LOCUS_63940 171803 172357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 173082 173645 gene locus_tag LOCUS_63950 173082 173645 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116008.1 protein_id gnl|my_center|LOCUS_63950 173661 174401 gene locus_tag LOCUS_63960 gene tpiA 173661 174401 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 protein_id gnl|my_center|LOCUS_63960 175159 174605 gene locus_tag LOCUS_63970 175159 174605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 175664 175293 gene locus_tag LOCUS_63980 175664 175293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63980 176206 175661 gene locus_tag LOCUS_63990 176206 175661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63990 176929 176537 gene locus_tag LOCUS_64000 176929 176537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64000 177593 177039 gene locus_tag LOCUS_64010 177593 177039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64010 179620 177833 gene locus_tag LOCUS_64020 179620 177833 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661123.1 protein_id gnl|my_center|LOCUS_64020 180784 179876 gene locus_tag LOCUS_64030 180784 179876 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_64030 181496 180903 gene locus_tag LOCUS_64040 181496 180903 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410207.1 protein_id gnl|my_center|LOCUS_64040 183000 181552 gene locus_tag LOCUS_64050 183000 181552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64050 183911 182997 gene locus_tag LOCUS_64060 183911 182997 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111818.1 protein_id gnl|my_center|LOCUS_64060 188680 183908 gene locus_tag LOCUS_64070 188680 183908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 189996 188677 gene locus_tag LOCUS_64080 189996 188677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 190465 190031 gene locus_tag LOCUS_64090 190465 190031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 191511 192956 gene locus_tag LOCUS_64100 191511 192956 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 protein_id gnl|my_center|LOCUS_64100 193605 195239 gene locus_tag LOCUS_64110 193605 195239 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_64110 197367 196186 gene locus_tag LOCUS_64120 197367 196186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 198171 198356 gene locus_tag LOCUS_64130 198171 198356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 199368 198349 gene locus_tag LOCUS_64140 199368 198349 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978029.1 protein_id gnl|my_center|LOCUS_64140 200273 199365 gene locus_tag LOCUS_64150 200273 199365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978028.1 protein_id gnl|my_center|LOCUS_64150 201016 200270 gene locus_tag LOCUS_64160 201016 200270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 201246 201061 gene locus_tag LOCUS_64170 201246 201061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 201700 201323 gene locus_tag LOCUS_64180 201700 201323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 202386 201856 gene locus_tag LOCUS_64190 202386 201856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 202799 203722 gene locus_tag LOCUS_64200 202799 203722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 204390 203893 gene locus_tag LOCUS_64210 204390 203893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 204974 205843 gene locus_tag LOCUS_64220 204974 205843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64220 206765 206289 gene locus_tag LOCUS_64230 206765 206289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 207736 207242 gene locus_tag LOCUS_64240 207736 207242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 208262 207828 gene locus_tag LOCUS_64250 208262 207828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 209050 210300 gene locus_tag LOCUS_64260 209050 210300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 210499 210834 gene locus_tag LOCUS_64270 210499 210834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 211302 210853 gene locus_tag LOCUS_64280 211302 210853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 213455 211452 gene locus_tag LOCUS_64290 213455 211452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 >Feature sequence14 1385 144 gene locus_tag LOCUS_64300 1385 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64300 1888 1382 gene locus_tag LOCUS_64310 1888 1382 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_64310 3088 2018 gene locus_tag LOCUS_64320 3088 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64320 3674 3081 gene locus_tag LOCUS_64330 3674 3081 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_64330 4843 3734 gene locus_tag LOCUS_64340 4843 3734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_64340 5724 4843 gene locus_tag LOCUS_64350 5724 4843 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_64350 6575 5901 gene locus_tag LOCUS_64360 6575 5901 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_64360 7858 6572 gene locus_tag LOCUS_64370 7858 6572 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_64370 7442 7368 gene locus_tag LOCUS_t00580 7442 7368 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8931 7912 gene locus_tag LOCUS_64380 8931 7912 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_64380 9014 9826 gene locus_tag LOCUS_64390 9014 9826 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_64390 10759 9830 gene locus_tag LOCUS_64400 10759 9830 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229693.1 protein_id gnl|my_center|LOCUS_64400 11474 10797 gene locus_tag LOCUS_64410 gene fabG 11474 10797 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388175.1 protein_id gnl|my_center|LOCUS_64410 11887 11471 gene locus_tag LOCUS_64420 11887 11471 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225249.1 protein_id gnl|my_center|LOCUS_64420 11934 12611 gene locus_tag LOCUS_64430 11934 12611 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225250.1 protein_id gnl|my_center|LOCUS_64430 13711 12575 gene locus_tag LOCUS_64440 13711 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 14749 13760 gene locus_tag LOCUS_64450 14749 13760 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229214.1 protein_id gnl|my_center|LOCUS_64450 15627 14746 gene locus_tag LOCUS_64460 15627 14746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229213.1 protein_id gnl|my_center|LOCUS_64460 16028 15624 gene locus_tag LOCUS_64470 16028 15624 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284752.1 protein_id gnl|my_center|LOCUS_64470 17728 16157 gene locus_tag LOCUS_64480 17728 16157 CDS product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866890.1 protein_id gnl|my_center|LOCUS_64480 19387 17939 gene locus_tag LOCUS_64490 19387 17939 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486261.1 protein_id gnl|my_center|LOCUS_64490 19962 19525 gene locus_tag LOCUS_64500 19962 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 20573 19959 gene locus_tag LOCUS_64510 20573 19959 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 protein_id gnl|my_center|LOCUS_64510 21271 20570 gene locus_tag LOCUS_64520 21271 20570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 21876 21373 gene locus_tag LOCUS_64530 21876 21373 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055566559.1 protein_id gnl|my_center|LOCUS_64530 21950 22516 gene locus_tag LOCUS_64540 21950 22516 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031763.1 protein_id gnl|my_center|LOCUS_64540 22847 23440 gene locus_tag LOCUS_64550 22847 23440 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_64550 23437 24273 gene locus_tag LOCUS_64560 23437 24273 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 protein_id gnl|my_center|LOCUS_64560 24264 26321 gene locus_tag LOCUS_64570 24264 26321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 26502 27455 gene locus_tag LOCUS_64580 26502 27455 CDS product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028255.1 protein_id gnl|my_center|LOCUS_64580 28056 27652 gene locus_tag LOCUS_64590 28056 27652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 28108 28341 gene locus_tag LOCUS_64600 28108 28341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 28730 28269 gene locus_tag LOCUS_64610 28730 28269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 29288 28785 gene locus_tag LOCUS_64620 29288 28785 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_64620 30535 29285 gene locus_tag LOCUS_64630 30535 29285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 31713 30562 gene locus_tag LOCUS_64640 31713 30562 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416097.1 protein_id gnl|my_center|LOCUS_64640 33135 31771 gene locus_tag LOCUS_64650 33135 31771 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222690.1 protein_id gnl|my_center|LOCUS_64650 34623 33445 gene locus_tag LOCUS_64660 34623 33445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 34622 34834 gene locus_tag LOCUS_64670 34622 34834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 36335 35103 gene locus_tag LOCUS_64680 36335 35103 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_64680 37318 36491 gene locus_tag LOCUS_64690 37318 36491 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028204.1 protein_id gnl|my_center|LOCUS_64690 38214 37417 gene locus_tag LOCUS_64700 38214 37417 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211260731.1 protein_id gnl|my_center|LOCUS_64700 39120 38227 gene locus_tag LOCUS_64710 39120 38227 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227465.1 protein_id gnl|my_center|LOCUS_64710 40652 39153 gene locus_tag LOCUS_64720 40652 39153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64720 41377 40682 gene locus_tag LOCUS_64730 41377 40682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227467.1 protein_id gnl|my_center|LOCUS_64730 42332 41364 gene locus_tag LOCUS_64740 42332 41364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227468.1 protein_id gnl|my_center|LOCUS_64740 43984 42410 gene locus_tag LOCUS_64750 43984 42410 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033293987.1 protein_id gnl|my_center|LOCUS_64750 45001 44018 gene locus_tag LOCUS_64760 45001 44018 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033294040.1 protein_id gnl|my_center|LOCUS_64760 47605 45239 gene locus_tag LOCUS_64770 47605 45239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227471.1 protein_id gnl|my_center|LOCUS_64770 49152 47602 gene locus_tag LOCUS_64780 gene pstS 49152 47602 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227472.1 protein_id gnl|my_center|LOCUS_64780 50219 49161 gene locus_tag LOCUS_64790 gene pstA 50219 49161 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227473.1 protein_id gnl|my_center|LOCUS_64790 51231 50221 gene locus_tag LOCUS_64800 gene pstC 51231 50221 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227474.1 protein_id gnl|my_center|LOCUS_64800 51853 51395 gene locus_tag LOCUS_64810 51853 51395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 52772 51996 gene locus_tag LOCUS_64820 52772 51996 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975593.1 protein_id gnl|my_center|LOCUS_64820 53701 52769 gene locus_tag LOCUS_64830 53701 52769 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975592.1 protein_id gnl|my_center|LOCUS_64830 53958 53698 gene locus_tag LOCUS_64840 53958 53698 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229283.1 protein_id gnl|my_center|LOCUS_64840 54386 53958 gene locus_tag LOCUS_64850 54386 53958 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229282.1 protein_id gnl|my_center|LOCUS_64850 55728 54502 gene locus_tag LOCUS_64860 55728 54502 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_64860 57952 55826 gene locus_tag LOCUS_64870 57952 55826 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831565.1 protein_id gnl|my_center|LOCUS_64870 58108 59541 gene locus_tag LOCUS_64880 58108 59541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64880 59959 61266 gene locus_tag LOCUS_64890 59959 61266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64890 61903 61316 gene locus_tag LOCUS_64900 61903 61316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029884.1 protein_id gnl|my_center|LOCUS_64900 62301 61978 gene locus_tag LOCUS_64910 62301 61978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 64634 62337 gene locus_tag LOCUS_64920 64634 62337 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029885.1 protein_id gnl|my_center|LOCUS_64920 65471 64941 gene locus_tag LOCUS_64930 65471 64941 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086853930.1 protein_id gnl|my_center|LOCUS_64930 65988 65593 gene locus_tag LOCUS_64940 65988 65593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 66706 66185 gene locus_tag LOCUS_64950 66706 66185 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228949.1 protein_id gnl|my_center|LOCUS_64950 67760 66783 gene locus_tag LOCUS_64960 67760 66783 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_64960 69077 67884 gene locus_tag LOCUS_64970 gene metK 69077 67884 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284357.1 protein_id gnl|my_center|LOCUS_64970 69807 69103 gene locus_tag LOCUS_64980 69807 69103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64980 73188 69829 gene locus_tag LOCUS_64990 73188 69829 CDS product carboxylic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111486.1 protein_id gnl|my_center|LOCUS_64990 73949 73485 gene locus_tag LOCUS_65000 73949 73485 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228548.1 protein_id gnl|my_center|LOCUS_65000 73839 74060 gene locus_tag LOCUS_65010 73839 74060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 74784 76748 gene locus_tag LOCUS_65020 74784 76748 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_65020 79015 76829 gene locus_tag LOCUS_65030 gene phzE 79015 76829 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_65030 79671 79012 gene locus_tag LOCUS_65040 gene phzD 79671 79012 CDS product phenazine biosynthesis protein PhzD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093625.1 protein_id gnl|my_center|LOCUS_65040 81078 79909 gene locus_tag LOCUS_65050 81078 79909 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083700.1 protein_id gnl|my_center|LOCUS_65050 81685 82965 gene locus_tag LOCUS_65060 81685 82965 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083703.1 protein_id gnl|my_center|LOCUS_65060 84266 83091 gene locus_tag LOCUS_65070 84266 83091 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_65070 85005 84463 gene locus_tag LOCUS_65080 85005 84463 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228548.1 protein_id gnl|my_center|LOCUS_65080 85260 86690 gene locus_tag LOCUS_65090 85260 86690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284773.1 protein_id gnl|my_center|LOCUS_65090 86817 88781 gene locus_tag LOCUS_65100 86817 88781 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_65100 88823 89212 gene locus_tag LOCUS_65110 88823 89212 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729021.1 protein_id gnl|my_center|LOCUS_65110 89602 89408 gene locus_tag LOCUS_65120 89602 89408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 89940 89596 gene locus_tag LOCUS_65130 89940 89596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65130 90835 90317 gene locus_tag LOCUS_65140 90835 90317 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228717.1 protein_id gnl|my_center|LOCUS_65140 91778 90927 gene locus_tag LOCUS_65150 91778 90927 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928730.1 protein_id gnl|my_center|LOCUS_65150 91863 92429 gene locus_tag LOCUS_65160 91863 92429 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866867.1 protein_id gnl|my_center|LOCUS_65160 92499 93104 gene locus_tag LOCUS_65170 92499 93104 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_65170 93106 93657 gene locus_tag LOCUS_65180 93106 93657 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_65180 93779 96904 gene locus_tag LOCUS_65190 93779 96904 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_65190 98509 96980 gene locus_tag LOCUS_65200 98509 96980 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_65200 98713 100260 gene locus_tag LOCUS_65210 98713 100260 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_65210 100569 100375 gene locus_tag LOCUS_65220 100569 100375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 100842 100573 gene locus_tag LOCUS_65230 100842 100573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 100861 101418 gene locus_tag LOCUS_65240 100861 101418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 102029 101607 gene locus_tag LOCUS_65250 102029 101607 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868971.1 protein_id gnl|my_center|LOCUS_65250 102121 103068 gene locus_tag LOCUS_65260 102121 103068 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 protein_id gnl|my_center|LOCUS_65260 105316 103154 gene locus_tag LOCUS_65270 105316 103154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 106022 107299 gene locus_tag LOCUS_65280 106022 107299 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972783.1 protein_id gnl|my_center|LOCUS_65280 107296 107946 gene locus_tag LOCUS_65290 107296 107946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972782.1 protein_id gnl|my_center|LOCUS_65290 108417 108031 gene locus_tag LOCUS_65300 108417 108031 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730014.1 protein_id gnl|my_center|LOCUS_65300 109095 108535 gene locus_tag LOCUS_65310 109095 108535 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225840.1 protein_id gnl|my_center|LOCUS_65310 109301 109900 gene locus_tag LOCUS_65320 109301 109900 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225839.1 protein_id gnl|my_center|LOCUS_65320 110776 109922 gene locus_tag LOCUS_65330 110776 109922 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224948.1 protein_id gnl|my_center|LOCUS_65330 110979 111830 gene locus_tag LOCUS_65340 110979 111830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 113408 111930 gene locus_tag LOCUS_65350 113408 111930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 115246 113399 gene locus_tag LOCUS_65360 115246 113399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 116492 115476 gene locus_tag LOCUS_65370 116492 115476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 116880 120293 gene locus_tag LOCUS_65380 116880 120293 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 protein_id gnl|my_center|LOCUS_65380 120366 121037 gene locus_tag LOCUS_65390 120366 121037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 121319 121116 gene locus_tag LOCUS_65400 121319 121116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 122800 121391 gene locus_tag LOCUS_65410 122800 121391 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_65410 123903 122797 gene locus_tag LOCUS_65420 gene eboE 123903 122797 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028848.1 protein_id gnl|my_center|LOCUS_65420 124751 123900 gene locus_tag LOCUS_65430 124751 123900 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_65430 126178 124751 gene locus_tag LOCUS_65440 126178 124751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 127029 126175 gene locus_tag LOCUS_65450 127029 126175 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 protein_id gnl|my_center|LOCUS_65450 128183 127026 gene locus_tag LOCUS_65460 128183 127026 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_65460 133155 128335 gene locus_tag LOCUS_65470 133155 128335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 134079 133222 gene locus_tag LOCUS_65480 134079 133222 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969271.1 protein_id gnl|my_center|LOCUS_65480 135291 134110 gene locus_tag LOCUS_65490 135291 134110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65490 136324 135317 gene locus_tag LOCUS_65500 136324 135317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 protein_id gnl|my_center|LOCUS_65500 137334 136321 gene locus_tag LOCUS_65510 137334 136321 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315915.1 protein_id gnl|my_center|LOCUS_65510 138833 137331 gene locus_tag LOCUS_65520 138833 137331 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_65520 139963 138830 gene locus_tag LOCUS_65530 139963 138830 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_65530 139986 141239 gene locus_tag LOCUS_65540 139986 141239 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223433.1 protein_id gnl|my_center|LOCUS_65540 141293 142330 gene locus_tag LOCUS_65550 141293 142330 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134732678.1 protein_id gnl|my_center|LOCUS_65550 143774 142416 gene locus_tag LOCUS_65560 143774 142416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65560 143936 144121 gene locus_tag LOCUS_65570 143936 144121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65570 144127 146310 gene locus_tag LOCUS_65580 144127 146310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 146316 148568 gene locus_tag LOCUS_65590 146316 148568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65590 150281 148755 gene locus_tag LOCUS_65600 150281 148755 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229871.1 protein_id gnl|my_center|LOCUS_65600 152817 150364 gene locus_tag LOCUS_65610 152817 150364 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_65610 153011 154729 gene locus_tag LOCUS_65620 153011 154729 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043792085.1 protein_id gnl|my_center|LOCUS_65620 156029 154869 gene locus_tag LOCUS_65630 156029 154869 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225591.1 protein_id gnl|my_center|LOCUS_65630 155917 156378 gene locus_tag LOCUS_65640 155917 156378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 156686 156312 gene locus_tag LOCUS_65650 156686 156312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 157550 156744 gene locus_tag LOCUS_65660 gene murQ 157550 156744 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_65660 157728 157597 gene locus_tag LOCUS_65670 157728 157597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65670 159164 157791 gene locus_tag LOCUS_65680 159164 157791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65680 160639 159161 gene locus_tag LOCUS_65690 160639 159161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 164360 160641 gene locus_tag LOCUS_65700 164360 160641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65700 166135 164684 gene locus_tag LOCUS_65710 166135 164684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65710 166943 166686 gene locus_tag LOCUS_65720 166943 166686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65720 167568 167212 gene locus_tag LOCUS_65730 167568 167212 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229578.1 protein_id gnl|my_center|LOCUS_65730 168909 168637 gene locus_tag LOCUS_65740 168909 168637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65740 168859 169110 gene locus_tag LOCUS_65750 168859 169110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65750 169128 169634 gene locus_tag LOCUS_65760 169128 169634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 169701 169964 gene locus_tag LOCUS_65770 169701 169964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65770 170222 170659 gene locus_tag LOCUS_65780 170222 170659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65780 170851 170540 gene locus_tag LOCUS_65790 170851 170540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65790 172571 170925 gene locus_tag LOCUS_65800 172571 170925 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225269715.1 protein_id gnl|my_center|LOCUS_65800 173449 172568 gene locus_tag LOCUS_65810 173449 172568 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385806.1 protein_id gnl|my_center|LOCUS_65810 175242 173446 gene locus_tag LOCUS_65820 175242 173446 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385805.1 protein_id gnl|my_center|LOCUS_65820 176180 175239 gene locus_tag LOCUS_65830 176180 175239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054291694.1 protein_id gnl|my_center|LOCUS_65830 177758 176220 gene locus_tag LOCUS_65840 177758 176220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 177933 178589 gene locus_tag LOCUS_65850 177933 178589 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767352.1 protein_id gnl|my_center|LOCUS_65850 178661 180940 gene locus_tag LOCUS_65860 178661 180940 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728432.1 protein_id gnl|my_center|LOCUS_65860 180970 182142 gene locus_tag LOCUS_65870 180970 182142 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_65870 182352 183662 gene locus_tag LOCUS_65880 182352 183662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65880 184416 183790 gene locus_tag LOCUS_65890 184416 183790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 184518 184790 gene locus_tag LOCUS_65900 184518 184790 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_65900 184960 185487 gene locus_tag LOCUS_65910 184960 185487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 >Feature sequence15 1795 164 gene locus_tag LOCUS_65920 1795 164 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 protein_id gnl|my_center|LOCUS_65920 2363 1848 gene locus_tag LOCUS_65930 2363 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 3111 2812 gene locus_tag LOCUS_65940 3111 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65940 3229 3438 gene locus_tag LOCUS_65950 3229 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 3639 4049 gene locus_tag LOCUS_65960 3639 4049 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229580.1 protein_id gnl|my_center|LOCUS_65960 5315 4458 gene locus_tag LOCUS_65970 5315 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65970 6388 5342 gene locus_tag LOCUS_65980 6388 5342 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229169.1 protein_id gnl|my_center|LOCUS_65980 5693 5618 gene locus_tag LOCUS_t00590 5693 5618 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8081 6498 gene locus_tag LOCUS_65990 8081 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 9383 8166 gene locus_tag LOCUS_66000 9383 8166 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224914.1 protein_id gnl|my_center|LOCUS_66000 10378 9380 gene locus_tag LOCUS_66010 10378 9380 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224915.1 protein_id gnl|my_center|LOCUS_66010 10827 10375 gene locus_tag LOCUS_66020 10827 10375 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224916.1 protein_id gnl|my_center|LOCUS_66020 11224 10814 gene locus_tag LOCUS_66030 11224 10814 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224917.1 protein_id gnl|my_center|LOCUS_66030 12108 11221 gene locus_tag LOCUS_66040 12108 11221 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224918.1 protein_id gnl|my_center|LOCUS_66040 12769 12257 gene locus_tag LOCUS_66050 12769 12257 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224919.1 protein_id gnl|my_center|LOCUS_66050 12928 14037 gene locus_tag LOCUS_66060 12928 14037 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031879.1 protein_id gnl|my_center|LOCUS_66060 15863 14163 gene locus_tag LOCUS_66070 15863 14163 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 protein_id gnl|my_center|LOCUS_66070 18720 15895 gene locus_tag LOCUS_66080 18720 15895 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_66080 21071 18816 gene locus_tag LOCUS_66090 21071 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 20971 21228 gene locus_tag LOCUS_66100 20971 21228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66100 23178 21625 gene locus_tag LOCUS_66110 23178 21625 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226093.1 protein_id gnl|my_center|LOCUS_66110 24839 23229 gene locus_tag LOCUS_66120 24839 23229 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_66120 27906 24934 gene locus_tag LOCUS_66130 27906 24934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 28814 27954 gene locus_tag LOCUS_66140 28814 27954 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_66140 29686 28811 gene locus_tag LOCUS_66150 29686 28811 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_66150 31163 29781 gene locus_tag LOCUS_66160 31163 29781 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_66160 32802 31183 gene locus_tag LOCUS_66170 32802 31183 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972134.1 protein_id gnl|my_center|LOCUS_66170 32970 34019 gene locus_tag LOCUS_66180 32970 34019 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_66180 35252 34071 gene locus_tag LOCUS_66190 35252 34071 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228204.1 protein_id gnl|my_center|LOCUS_66190 38284 35249 gene locus_tag LOCUS_66200 38284 35249 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228205.1 protein_id gnl|my_center|LOCUS_66200 39333 38284 gene locus_tag LOCUS_66210 39333 38284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228206.1 protein_id gnl|my_center|LOCUS_66210 40325 39342 gene locus_tag LOCUS_66220 40325 39342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 41856 40711 gene locus_tag LOCUS_66230 41856 40711 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222819.1 protein_id gnl|my_center|LOCUS_66230 42837 41899 gene locus_tag LOCUS_66240 42837 41899 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827543.1 protein_id gnl|my_center|LOCUS_66240 43802 42834 gene locus_tag LOCUS_66250 43802 42834 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064872.1 protein_id gnl|my_center|LOCUS_66250 44803 43802 gene locus_tag LOCUS_66260 44803 43802 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_66260 45690 44791 gene locus_tag LOCUS_66270 45690 44791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66270 46777 45704 gene locus_tag LOCUS_66280 gene hppD 46777 45704 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975586.1 protein_id gnl|my_center|LOCUS_66280 47006 46758 gene locus_tag LOCUS_66290 47006 46758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66290 48415 47003 gene locus_tag LOCUS_66300 48415 47003 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_66300 49882 48566 gene locus_tag LOCUS_66310 49882 48566 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583230.1 protein_id gnl|my_center|LOCUS_66310 51531 49879 gene locus_tag LOCUS_66320 51531 49879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66320 53181 51535 gene locus_tag LOCUS_66330 gene fadD5 53181 51535 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_66330 54343 53342 gene locus_tag LOCUS_66340 54343 53342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 55431 54340 gene locus_tag LOCUS_66350 55431 54340 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226447.1 protein_id gnl|my_center|LOCUS_66350 55539 56468 gene locus_tag LOCUS_66360 55539 56468 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225871.1 protein_id gnl|my_center|LOCUS_66360 56495 56776 gene locus_tag LOCUS_66370 56495 56776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66370 56776 57567 gene locus_tag LOCUS_66380 56776 57567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66380 58995 57583 gene locus_tag LOCUS_66390 58995 57583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66390 60205 58988 gene locus_tag LOCUS_66400 gene fabF 60205 58988 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_66400 60480 60220 gene locus_tag LOCUS_66410 60480 60220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66410 60608 62050 gene locus_tag LOCUS_66420 60608 62050 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222162.1 protein_id gnl|my_center|LOCUS_66420 62041 62817 gene locus_tag LOCUS_66430 62041 62817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 62811 63320 gene locus_tag LOCUS_66440 62811 63320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 63323 64792 gene locus_tag LOCUS_66450 63323 64792 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891673.1 protein_id gnl|my_center|LOCUS_66450 64789 65733 gene locus_tag LOCUS_66460 64789 65733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_66460 65730 67484 gene locus_tag LOCUS_66470 65730 67484 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225487.1 protein_id gnl|my_center|LOCUS_66470 68683 67493 gene locus_tag LOCUS_66480 68683 67493 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_66480 68957 70954 gene locus_tag LOCUS_66490 68957 70954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227357.1 protein_id gnl|my_center|LOCUS_66490 70951 72738 gene locus_tag LOCUS_66500 70951 72738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227358.1 protein_id gnl|my_center|LOCUS_66500 72735 73832 gene locus_tag LOCUS_66510 72735 73832 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872371.1 protein_id gnl|my_center|LOCUS_66510 74606 73998 gene locus_tag LOCUS_66520 74606 73998 CDS product ABATE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729490.1 protein_id gnl|my_center|LOCUS_66520 74746 75681 gene locus_tag LOCUS_66530 74746 75681 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111553.1 protein_id gnl|my_center|LOCUS_66530 75696 76163 gene locus_tag LOCUS_66540 75696 76163 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 protein_id gnl|my_center|LOCUS_66540 79929 76255 gene locus_tag LOCUS_66550 79929 76255 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_66550 81565 79961 gene locus_tag LOCUS_66560 81565 79961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 81863 81543 gene locus_tag LOCUS_66570 81863 81543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66570 85038 81892 gene locus_tag LOCUS_66580 85038 81892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 85174 85311 gene locus_tag LOCUS_66590 85174 85311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 85722 85315 gene locus_tag LOCUS_66600 85722 85315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 85929 88562 gene locus_tag LOCUS_66610 85929 88562 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003078144.1 protein_id gnl|my_center|LOCUS_66610 98260 88553 gene locus_tag LOCUS_66620 98260 88553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66620 98502 98801 gene locus_tag LOCUS_66630 98502 98801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66630 100214 98922 gene locus_tag LOCUS_66640 100214 98922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259400.1 protein_id gnl|my_center|LOCUS_66640 100727 100401 gene locus_tag LOCUS_66650 100727 100401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66650 101212 101051 gene locus_tag LOCUS_66660 gene rpmF 101212 101051 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978430.1 protein_id gnl|my_center|LOCUS_66660 101465 101214 gene locus_tag LOCUS_66670 101465 101214 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226832.1 protein_id gnl|my_center|LOCUS_66670 102556 101462 gene locus_tag LOCUS_66680 102556 101462 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400804.1 protein_id gnl|my_center|LOCUS_66680 102604 102843 gene locus_tag LOCUS_66690 gene rpmB 102604 102843 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 protein_id gnl|my_center|LOCUS_66690 102843 103010 gene locus_tag LOCUS_66700 gene rpmG 102843 103010 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226831.1 protein_id gnl|my_center|LOCUS_66700 103010 103306 gene locus_tag LOCUS_66710 gene rpsN 103010 103306 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_66710 103303 103545 gene locus_tag LOCUS_66720 gene rpsR 103303 103545 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_66720 105209 103596 gene locus_tag LOCUS_66730 105209 103596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 106534 105206 gene locus_tag LOCUS_66740 106534 105206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 107412 106531 gene locus_tag LOCUS_66750 107412 106531 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_66750 108161 107409 gene locus_tag LOCUS_66760 108161 107409 CDS product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 protein_id gnl|my_center|LOCUS_66760 108945 108154 gene locus_tag LOCUS_66770 108945 108154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 110459 108933 gene locus_tag LOCUS_66780 110459 108933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 110637 111284 gene locus_tag LOCUS_66790 110637 111284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 111281 111913 gene locus_tag LOCUS_66800 111281 111913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66800 113099 112074 gene locus_tag LOCUS_66810 113099 112074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 114171 113128 gene locus_tag LOCUS_66820 114171 113128 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 protein_id gnl|my_center|LOCUS_66820 115481 114168 gene locus_tag LOCUS_66830 115481 114168 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026955.1 protein_id gnl|my_center|LOCUS_66830 115632 116030 gene locus_tag LOCUS_66840 115632 116030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 116139 116927 gene locus_tag LOCUS_66850 116139 116927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66850 117938 117018 gene locus_tag LOCUS_66860 117938 117018 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225561.1 protein_id gnl|my_center|LOCUS_66860 118025 118531 gene locus_tag LOCUS_66870 118025 118531 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225564.1 protein_id gnl|my_center|LOCUS_66870 118680 121082 gene locus_tag LOCUS_66880 118680 121082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66880 121079 122320 gene locus_tag LOCUS_66890 121079 122320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 122622 125279 gene locus_tag LOCUS_66900 122622 125279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031530.1 protein_id gnl|my_center|LOCUS_66900 125800 127851 gene locus_tag LOCUS_66910 125800 127851 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225763.1 protein_id gnl|my_center|LOCUS_66910 128461 132147 gene locus_tag LOCUS_66920 128461 132147 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_66920 132147 133817 gene locus_tag LOCUS_66930 gene narH 132147 133817 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030994.1 protein_id gnl|my_center|LOCUS_66930 133814 134488 gene locus_tag LOCUS_66940 gene narJ 133814 134488 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026934.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66940 134485 135210 gene locus_tag LOCUS_66950 gene narI 134485 135210 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026935.1 protein_id gnl|my_center|LOCUS_66950 136050 135223 gene locus_tag LOCUS_66960 136050 135223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 137072 136233 gene locus_tag LOCUS_66970 137072 136233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 137782 137177 gene locus_tag LOCUS_66980 137782 137177 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027066.1 protein_id gnl|my_center|LOCUS_66980 137865 139448 gene locus_tag LOCUS_66990 137865 139448 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 protein_id gnl|my_center|LOCUS_66990 140526 139489 gene locus_tag LOCUS_67000 140526 139489 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_67000 140751 142073 gene locus_tag LOCUS_67010 140751 142073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67010 142253 146215 gene locus_tag LOCUS_67020 142253 146215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67020 147406 146246 gene locus_tag LOCUS_67030 147406 146246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 148806 147403 gene locus_tag LOCUS_67040 148806 147403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67040 149043 149222 gene locus_tag LOCUS_67050 149043 149222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 153445 149267 gene locus_tag LOCUS_67060 153445 149267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 protein_id gnl|my_center|LOCUS_67060 155624 153513 gene locus_tag LOCUS_67070 155624 153513 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_67070 156527 155730 gene locus_tag LOCUS_67080 156527 155730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67080 156865 156524 gene locus_tag LOCUS_67090 156865 156524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67090 156932 160852 gene locus_tag LOCUS_67100 156932 160852 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_67100 161028 163148 gene locus_tag LOCUS_67110 161028 163148 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_67110 164004 163156 gene locus_tag LOCUS_67120 164004 163156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67120 165714 164008 gene locus_tag LOCUS_67130 165714 164008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67130 165915 170513 gene locus_tag LOCUS_67140 165915 170513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 171375 170470 gene locus_tag LOCUS_67150 171375 170470 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222527.1 protein_id gnl|my_center|LOCUS_67150 171863 171441 gene locus_tag LOCUS_67160 171863 171441 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528430.1 protein_id gnl|my_center|LOCUS_67160 171946 172464 gene locus_tag LOCUS_67170 171946 172464 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229400.1 protein_id gnl|my_center|LOCUS_67170 172527 172982 gene locus_tag LOCUS_67180 172527 172982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 >Feature sequence16 712 155 gene locus_tag LOCUS_67190 712 155 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228628.1 protein_id gnl|my_center|LOCUS_67190 956 1165 gene locus_tag LOCUS_67200 956 1165 CDS product DUF5988 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304002.1 protein_id gnl|my_center|LOCUS_67200 1915 1262 gene locus_tag LOCUS_67210 1915 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 2493 1915 gene locus_tag LOCUS_67220 2493 1915 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892804.1 protein_id gnl|my_center|LOCUS_67220 4021 2579 gene locus_tag LOCUS_67230 4021 2579 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730801.1 protein_id gnl|my_center|LOCUS_67230 4320 5225 gene locus_tag LOCUS_67240 4320 5225 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227355.1 protein_id gnl|my_center|LOCUS_67240 5222 7114 gene locus_tag LOCUS_67250 5222 7114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227357.1 protein_id gnl|my_center|LOCUS_67250 7111 8895 gene locus_tag LOCUS_67260 7111 8895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227358.1 protein_id gnl|my_center|LOCUS_67260 9169 8933 gene locus_tag LOCUS_67270 9169 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 9074 9310 gene locus_tag LOCUS_67280 9074 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 10209 9307 gene locus_tag LOCUS_67290 10209 9307 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030816.1 protein_id gnl|my_center|LOCUS_67290 10317 11297 gene locus_tag LOCUS_67300 10317 11297 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030815.1 protein_id gnl|my_center|LOCUS_67300 11294 12247 gene locus_tag LOCUS_67310 11294 12247 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030814.1 protein_id gnl|my_center|LOCUS_67310 12263 13384 gene locus_tag LOCUS_67320 12263 13384 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030813.1 protein_id gnl|my_center|LOCUS_67320 13381 14385 gene locus_tag LOCUS_67330 13381 14385 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_67330 14382 15320 gene locus_tag LOCUS_67340 14382 15320 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_67340 15322 16251 gene locus_tag LOCUS_67350 15322 16251 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030810.1 protein_id gnl|my_center|LOCUS_67350 17205 16213 gene locus_tag LOCUS_67360 17205 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 17325 18101 gene locus_tag LOCUS_67370 17325 18101 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845593.1 protein_id gnl|my_center|LOCUS_67370 19887 18121 gene locus_tag LOCUS_67380 19887 18121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_67380 20189 20755 gene locus_tag LOCUS_67390 20189 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67390 21596 20835 gene locus_tag LOCUS_67400 gene lieB 21596 20835 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_67400 22432 21593 gene locus_tag LOCUS_67410 22432 21593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017474.1 protein_id gnl|my_center|LOCUS_67410 22797 22429 gene locus_tag LOCUS_67420 22797 22429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 23858 23154 gene locus_tag LOCUS_67430 23858 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 24047 24247 gene locus_tag LOCUS_67440 24047 24247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67440 24244 25164 gene locus_tag LOCUS_67450 24244 25164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 25386 26174 gene locus_tag LOCUS_67460 25386 26174 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029509.1 protein_id gnl|my_center|LOCUS_67460 26548 28137 gene locus_tag LOCUS_67470 26548 28137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 29612 28416 gene locus_tag LOCUS_67480 29612 28416 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194774.1 protein_id gnl|my_center|LOCUS_67480 30910 29609 gene locus_tag LOCUS_67490 30910 29609 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_67490 31709 30921 gene locus_tag LOCUS_67500 31709 30921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_67500 34869 31702 gene locus_tag LOCUS_67510 34869 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 36583 35015 gene locus_tag LOCUS_67520 36583 35015 CDS product nodulation protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084826.1 protein_id gnl|my_center|LOCUS_67520 38326 36674 gene locus_tag LOCUS_67530 38326 36674 CDS product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199726868.1 protein_id gnl|my_center|LOCUS_67530 39324 38320 gene locus_tag LOCUS_67540 gene sbnB 39324 38320 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226628.1 protein_id gnl|my_center|LOCUS_67540 40246 39311 gene locus_tag LOCUS_67550 gene sbnA 40246 39311 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228013.1 protein_id gnl|my_center|LOCUS_67550 43689 40378 gene locus_tag LOCUS_67560 gene carB 43689 40378 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224620.1 protein_id gnl|my_center|LOCUS_67560 44765 43689 gene locus_tag LOCUS_67570 gene carA 44765 43689 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224617.1 protein_id gnl|my_center|LOCUS_67570 45640 46788 gene locus_tag LOCUS_67580 45640 46788 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_67580 46962 47795 gene locus_tag LOCUS_67590 46962 47795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67590 48908 47880 gene locus_tag LOCUS_67600 48908 47880 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346352.1 protein_id gnl|my_center|LOCUS_67600 49088 51253 gene locus_tag LOCUS_67610 49088 51253 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_67610 51250 52137 gene locus_tag LOCUS_67620 51250 52137 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804377.1 protein_id gnl|my_center|LOCUS_67620 52149 53039 gene locus_tag LOCUS_67630 52149 53039 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804376.1 protein_id gnl|my_center|LOCUS_67630 53074 54420 gene locus_tag LOCUS_67640 53074 54420 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 protein_id gnl|my_center|LOCUS_67640 54456 57059 gene locus_tag LOCUS_67650 54456 57059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67650 57351 57136 gene locus_tag LOCUS_67660 57351 57136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 57492 61490 gene locus_tag LOCUS_67670 57492 61490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 61487 61933 gene locus_tag LOCUS_67680 61487 61933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 63337 62054 gene locus_tag LOCUS_67690 63337 62054 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225610.1 protein_id gnl|my_center|LOCUS_67690 64301 64939 gene locus_tag LOCUS_67700 64301 64939 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226222.1 protein_id gnl|my_center|LOCUS_67700 65519 64944 gene locus_tag LOCUS_67710 65519 64944 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_67710 65569 67113 gene locus_tag LOCUS_67720 65569 67113 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729718.1 protein_id gnl|my_center|LOCUS_67720 67164 68420 gene locus_tag LOCUS_67730 67164 68420 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_67730 68502 69926 gene locus_tag LOCUS_67740 68502 69926 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185757.1 protein_id gnl|my_center|LOCUS_67740 70483 69938 gene locus_tag LOCUS_67750 70483 69938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67750 70639 71466 gene locus_tag LOCUS_67760 70639 71466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67760 71489 72679 gene locus_tag LOCUS_67770 71489 72679 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014331.1 protein_id gnl|my_center|LOCUS_67770 74035 72755 gene locus_tag LOCUS_67780 74035 72755 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 protein_id gnl|my_center|LOCUS_67780 74179 75459 gene locus_tag LOCUS_67790 74179 75459 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376739.1 protein_id gnl|my_center|LOCUS_67790 75510 75779 gene locus_tag LOCUS_67800 75510 75779 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080896.1 protein_id gnl|my_center|LOCUS_67800 75828 81224 gene locus_tag LOCUS_67810 75828 81224 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141952.1 protein_id gnl|my_center|LOCUS_67810 81245 85927 gene locus_tag LOCUS_67820 81245 85927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 85936 86763 gene locus_tag LOCUS_67830 85936 86763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 86760 87899 gene locus_tag LOCUS_67840 86760 87899 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_67840 87910 89115 gene locus_tag LOCUS_67850 87910 89115 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_67850 89112 90845 gene locus_tag LOCUS_67860 89112 90845 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226325.1 protein_id gnl|my_center|LOCUS_67860 90842 91072 gene locus_tag LOCUS_67870 90842 91072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 91161 91853 gene locus_tag LOCUS_67880 91161 91853 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028974.1 protein_id gnl|my_center|LOCUS_67880 92315 91899 gene locus_tag LOCUS_67890 92315 91899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 92807 93697 gene locus_tag LOCUS_67900 92807 93697 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_67900 93711 94814 gene locus_tag LOCUS_67910 93711 94814 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_67910 94811 95596 gene locus_tag LOCUS_67920 94811 95596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 protein_id gnl|my_center|LOCUS_67920 95636 96670 gene locus_tag LOCUS_67930 95636 96670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67930 96701 97180 gene locus_tag LOCUS_67940 96701 97180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67940 97177 98082 gene locus_tag LOCUS_67950 97177 98082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67950 98107 98970 gene locus_tag LOCUS_67960 98107 98970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 98967 99908 gene locus_tag LOCUS_67970 98967 99908 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225886.1 protein_id gnl|my_center|LOCUS_67970 99933 100751 gene locus_tag LOCUS_67980 99933 100751 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142165.1 protein_id gnl|my_center|LOCUS_67980 100748 101410 gene locus_tag LOCUS_67990 100748 101410 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_67990 101763 102890 gene locus_tag LOCUS_68000 101763 102890 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225511.1 protein_id gnl|my_center|LOCUS_68000 102895 103680 gene locus_tag LOCUS_68010 102895 103680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68010 103888 104991 gene locus_tag LOCUS_68020 103888 104991 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_68020 105091 106137 gene locus_tag LOCUS_68030 105091 106137 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_68030 108592 106154 gene locus_tag LOCUS_68040 gene fxsT 108592 106154 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173078242.1 protein_id gnl|my_center|LOCUS_68040 109110 110540 gene locus_tag LOCUS_68050 109110 110540 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_68050 110537 111943 gene locus_tag LOCUS_68060 110537 111943 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225100.1 protein_id gnl|my_center|LOCUS_68060 112007 112864 gene locus_tag LOCUS_68070 112007 112864 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225103.1 protein_id gnl|my_center|LOCUS_68070 113404 114510 gene locus_tag LOCUS_68080 113404 114510 CDS product family 2 encapsulin nanocompartment cargo protein terpene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225102.1 protein_id gnl|my_center|LOCUS_68080 114591 115091 gene locus_tag LOCUS_68090 114591 115091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68090 116272 115859 gene locus_tag LOCUS_68100 116272 115859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68100 119296 116558 gene locus_tag LOCUS_68110 119296 116558 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225837.1 protein_id gnl|my_center|LOCUS_68110 120737 119373 gene locus_tag LOCUS_68120 120737 119373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68120 122227 120950 gene locus_tag LOCUS_68130 122227 120950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68130 123666 122302 gene locus_tag LOCUS_68140 123666 122302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68140 126227 124194 gene locus_tag LOCUS_68150 126227 124194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68150 127889 126366 gene locus_tag LOCUS_68160 127889 126366 CDS product non-reducing end alpha-L-arabinofuranosidase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224773.1 protein_id gnl|my_center|LOCUS_68160 129363 127936 gene locus_tag LOCUS_68170 129363 127936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68170 130400 129606 gene locus_tag LOCUS_68180 130400 129606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68180 131239 130397 gene locus_tag LOCUS_68190 131239 130397 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_68190 132582 131236 gene locus_tag LOCUS_68200 132582 131236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68200 132686 133792 gene locus_tag LOCUS_68210 132686 133792 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775815.1 protein_id gnl|my_center|LOCUS_68210 134102 135757 gene locus_tag LOCUS_68220 134102 135757 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229143.1 protein_id gnl|my_center|LOCUS_68220 135754 137133 gene locus_tag LOCUS_68230 135754 137133 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225147.1 protein_id gnl|my_center|LOCUS_68230 137399 138664 gene locus_tag LOCUS_68240 137399 138664 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_68240 138669 139622 gene locus_tag LOCUS_68250 138669 139622 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_68250 139619 140467 gene locus_tag LOCUS_68260 139619 140467 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_68260 140492 142033 gene locus_tag LOCUS_68270 140492 142033 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_68270 143391 142111 gene locus_tag LOCUS_68280 143391 142111 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225835.1 protein_id gnl|my_center|LOCUS_68280 144135 143473 gene locus_tag LOCUS_68290 144135 143473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 147551 144132 gene locus_tag LOCUS_68300 147551 144132 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_68300 148686 147901 gene locus_tag LOCUS_68310 148686 147901 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190909.1 protein_id gnl|my_center|LOCUS_68310 151675 148844 gene locus_tag LOCUS_68320 151675 148844 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225834.1 protein_id gnl|my_center|LOCUS_68320 152130 154925 gene locus_tag LOCUS_68330 152130 154925 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_68330 154948 156645 gene locus_tag LOCUS_68340 154948 156645 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 protein_id gnl|my_center|LOCUS_68340 156662 158029 gene locus_tag LOCUS_68350 156662 158029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 159187 158132 gene locus_tag LOCUS_68360 159187 158132 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258589.1 protein_id gnl|my_center|LOCUS_68360 159463 160734 gene locus_tag LOCUS_68370 159463 160734 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225804.1 protein_id gnl|my_center|LOCUS_68370 160738 161679 gene locus_tag LOCUS_68380 160738 161679 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310187.1 protein_id gnl|my_center|LOCUS_68380 161679 162506 gene locus_tag LOCUS_68390 161679 162506 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225802.1 protein_id gnl|my_center|LOCUS_68390 162508 163698 gene locus_tag LOCUS_68400 162508 163698 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225801.1 protein_id gnl|my_center|LOCUS_68400 163761 166139 gene locus_tag LOCUS_68410 163761 166139 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225154.1 protein_id gnl|my_center|LOCUS_68410 166121 167506 gene locus_tag LOCUS_68420 166121 167506 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225151.1 protein_id gnl|my_center|LOCUS_68420 >Feature sequence17 272 718 gene locus_tag LOCUS_68430 272 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68430 715 1110 gene locus_tag LOCUS_68440 715 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 1107 1808 gene locus_tag LOCUS_68450 gene fabG 1107 1808 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_68450 2459 1812 gene locus_tag LOCUS_68460 2459 1812 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_68460 3655 2456 gene locus_tag LOCUS_68470 3655 2456 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_68470 3813 4136 gene locus_tag LOCUS_68480 3813 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68480 4167 4376 gene locus_tag LOCUS_68490 4167 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68490 5262 4462 gene locus_tag LOCUS_68500 5262 4462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_68500 6212 5259 gene locus_tag LOCUS_68510 6212 5259 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_68510 6811 6209 gene locus_tag LOCUS_68520 6811 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030213.1 protein_id gnl|my_center|LOCUS_68520 7669 6845 gene locus_tag LOCUS_68530 gene fabI 7669 6845 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_68530 8653 7673 gene locus_tag LOCUS_68540 8653 7673 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975576.1 protein_id gnl|my_center|LOCUS_68540 9438 8665 gene locus_tag LOCUS_68550 9438 8665 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939553.1 protein_id gnl|my_center|LOCUS_68550 9688 9476 gene locus_tag LOCUS_68560 gene mbtH 9688 9476 CDS product mycobactin NRPS accessory protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412265.1 protein_id gnl|my_center|LOCUS_68560 13575 9685 gene locus_tag LOCUS_68570 13575 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68570 24479 13572 gene locus_tag LOCUS_68580 24479 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68580 33853 24476 gene locus_tag LOCUS_68590 33853 24476 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028843.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68590 34557 34865 gene locus_tag LOCUS_68600 34557 34865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68600 36703 35453 gene locus_tag LOCUS_68610 gene fabF 36703 35453 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412656.1 protein_id gnl|my_center|LOCUS_68610 38451 36730 gene locus_tag LOCUS_68620 38451 36730 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388037.1 protein_id gnl|my_center|LOCUS_68620 41162 38472 gene locus_tag LOCUS_68630 41162 38472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68630 42694 42308 gene locus_tag LOCUS_68640 42694 42308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68640 43153 42758 gene locus_tag LOCUS_68650 43153 42758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68650 43271 44467 gene locus_tag LOCUS_68660 43271 44467 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_68660 44678 47725 gene locus_tag LOCUS_68670 44678 47725 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_68670 47887 48801 gene locus_tag LOCUS_68680 47887 48801 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 protein_id gnl|my_center|LOCUS_68680 48798 49592 gene locus_tag LOCUS_68690 48798 49592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225024.1 protein_id gnl|my_center|LOCUS_68690 49592 49759 gene locus_tag LOCUS_68700 49592 49759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 49756 50445 gene locus_tag LOCUS_68710 49756 50445 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225022.1 protein_id gnl|my_center|LOCUS_68710 50451 51902 gene locus_tag LOCUS_68720 50451 51902 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_68720 52004 53194 gene locus_tag LOCUS_68730 52004 53194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68730 53239 54093 gene locus_tag LOCUS_68740 53239 54093 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028933.1 protein_id gnl|my_center|LOCUS_68740 54246 55040 gene locus_tag LOCUS_68750 54246 55040 CDS product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 protein_id gnl|my_center|LOCUS_68750 55216 55455 gene locus_tag LOCUS_68760 55216 55455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68760 56034 55459 gene locus_tag LOCUS_68770 56034 55459 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973632.1 protein_id gnl|my_center|LOCUS_68770 56138 56515 gene locus_tag LOCUS_68780 56138 56515 CDS product DUF4267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726623.1 protein_id gnl|my_center|LOCUS_68780 57312 56524 gene locus_tag LOCUS_68790 57312 56524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68790 58465 57440 gene locus_tag LOCUS_68800 58465 57440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68800 58707 58546 gene locus_tag LOCUS_68810 58707 58546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68810 59652 58726 gene locus_tag LOCUS_68820 59652 58726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68820 61811 59649 gene locus_tag LOCUS_68830 61811 59649 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226869.1 protein_id gnl|my_center|LOCUS_68830 63033 61852 gene locus_tag LOCUS_68840 63033 61852 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_68840 63950 63084 gene locus_tag LOCUS_68850 63950 63084 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971654.1 protein_id gnl|my_center|LOCUS_68850 64885 63947 gene locus_tag LOCUS_68860 64885 63947 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_68860 66288 64897 gene locus_tag LOCUS_68870 66288 64897 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 protein_id gnl|my_center|LOCUS_68870 66503 67264 gene locus_tag LOCUS_68880 66503 67264 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 protein_id gnl|my_center|LOCUS_68880 67269 68612 gene locus_tag LOCUS_68890 67269 68612 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_68890 68600 69670 gene locus_tag LOCUS_68900 68600 69670 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_68900 69814 70653 gene locus_tag LOCUS_68910 69814 70653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68910 70806 71414 gene locus_tag LOCUS_68920 70806 71414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68920 72731 71823 gene locus_tag LOCUS_68930 gene mmuM 72731 71823 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030679.1 protein_id gnl|my_center|LOCUS_68930 73398 72751 gene locus_tag LOCUS_68940 73398 72751 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865141.1 protein_id gnl|my_center|LOCUS_68940 73842 74144 gene locus_tag LOCUS_68950 73842 74144 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173256.1 protein_id gnl|my_center|LOCUS_68950 74820 74146 gene locus_tag LOCUS_68960 74820 74146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68960 76391 74982 gene locus_tag LOCUS_68970 76391 74982 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971507.1 protein_id gnl|my_center|LOCUS_68970 77130 76543 gene locus_tag LOCUS_68980 77130 76543 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010430079.1 protein_id gnl|my_center|LOCUS_68980 77873 77145 gene locus_tag LOCUS_68990 77873 77145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 78145 77804 gene locus_tag LOCUS_69000 78145 77804 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_69000 78235 78654 gene locus_tag LOCUS_69010 78235 78654 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027303.1 protein_id gnl|my_center|LOCUS_69010 80101 78728 gene locus_tag LOCUS_69020 80101 78728 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466941.1 protein_id gnl|my_center|LOCUS_69020 81841 80669 gene locus_tag LOCUS_69030 81841 80669 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089160.1 protein_id gnl|my_center|LOCUS_69030 81979 82794 gene locus_tag LOCUS_69040 81979 82794 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731472.1 protein_id gnl|my_center|LOCUS_69040 84219 82732 gene locus_tag LOCUS_69050 84219 82732 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225131.1 protein_id gnl|my_center|LOCUS_69050 85555 84233 gene locus_tag LOCUS_69060 85555 84233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467055.1 protein_id gnl|my_center|LOCUS_69060 86022 85564 gene locus_tag LOCUS_69070 gene htdZ 86022 85564 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_69070 86912 86019 gene locus_tag LOCUS_69080 gene couO 86912 86019 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_69080 87825 86914 gene locus_tag LOCUS_69090 87825 86914 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_69090 88817 87960 gene locus_tag LOCUS_69100 88817 87960 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531211.1 protein_id gnl|my_center|LOCUS_69100 88911 89789 gene locus_tag LOCUS_69110 88911 89789 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727741.1 protein_id gnl|my_center|LOCUS_69110 89877 92624 gene locus_tag LOCUS_69120 gene fxsT 89877 92624 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190714.1 protein_id gnl|my_center|LOCUS_69120 94527 92662 gene locus_tag LOCUS_69130 gene htpG 94527 92662 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467081.1 protein_id gnl|my_center|LOCUS_69130 94816 96978 gene locus_tag LOCUS_69140 94816 96978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69140 96888 97271 gene locus_tag LOCUS_69150 96888 97271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69150 97277 97708 gene locus_tag LOCUS_69160 97277 97708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69160 97724 98311 gene locus_tag LOCUS_69170 97724 98311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 98806 98357 gene locus_tag LOCUS_69180 98806 98357 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973660.1 protein_id gnl|my_center|LOCUS_69180 98999 98926 gene locus_tag LOCUS_t00600 98999 98926 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 99077 99004 gene locus_tag LOCUS_t00610 99077 99004 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101031 99307 gene locus_tag LOCUS_69190 101031 99307 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 protein_id gnl|my_center|LOCUS_69190 102500 101028 gene locus_tag LOCUS_69200 102500 101028 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031070.1 protein_id gnl|my_center|LOCUS_69200 102607 103260 gene locus_tag LOCUS_69210 102607 103260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 104643 103285 gene locus_tag LOCUS_69220 104643 103285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69220 105295 104720 gene locus_tag LOCUS_69230 105295 104720 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_69230 106101 105400 gene locus_tag LOCUS_69240 106101 105400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223232.1 protein_id gnl|my_center|LOCUS_69240 107822 106569 gene locus_tag LOCUS_69250 107822 106569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69250 107972 110947 gene locus_tag LOCUS_69260 107972 110947 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225870.1 protein_id gnl|my_center|LOCUS_69260 111766 111002 gene locus_tag LOCUS_69270 111766 111002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69270 112317 114407 gene locus_tag LOCUS_69280 112317 114407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69280 116481 114493 gene locus_tag LOCUS_69290 116481 114493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69290 116916 118544 gene locus_tag LOCUS_69300 116916 118544 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948038.1 protein_id gnl|my_center|LOCUS_69300 118816 118610 gene locus_tag LOCUS_69310 118816 118610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 119374 120192 gene locus_tag LOCUS_69320 119374 120192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 120461 121486 gene locus_tag LOCUS_69330 120461 121486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 121476 123155 gene locus_tag LOCUS_69340 121476 123155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 123152 125854 gene locus_tag LOCUS_69350 123152 125854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 126136 126720 gene locus_tag LOCUS_69360 126136 126720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 128344 127334 gene locus_tag LOCUS_69370 128344 127334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 128565 128493 gene locus_tag LOCUS_t00620 128565 128493 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 128679 128609 gene locus_tag LOCUS_t00630 128679 128609 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 128872 128799 gene locus_tag LOCUS_t00640 128872 128799 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 128983 128911 gene locus_tag LOCUS_t00650 128983 128911 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 129115 129042 gene locus_tag LOCUS_t00660 129115 129042 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 129217 129144 gene locus_tag LOCUS_t00670 129217 129144 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 129328 129253 gene locus_tag LOCUS_t00680 129328 129253 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 129410 129339 gene locus_tag LOCUS_t00690 129410 129339 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 129512 129439 gene locus_tag LOCUS_t00700 129512 129439 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 129728 129659 gene locus_tag LOCUS_t00710 129728 129659 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 131075 130767 gene locus_tag LOCUS_69380 131075 130767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 131695 131273 gene locus_tag LOCUS_69390 131695 131273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69390 133584 131872 gene locus_tag LOCUS_69400 133584 131872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467722.1 protein_id gnl|my_center|LOCUS_69400 135251 133581 gene locus_tag LOCUS_69410 135251 133581 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803733.1 protein_id gnl|my_center|LOCUS_69410 136272 135277 gene locus_tag LOCUS_69420 136272 135277 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803732.1 protein_id gnl|my_center|LOCUS_69420 137192 136272 gene locus_tag LOCUS_69430 137192 136272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929818.1 protein_id gnl|my_center|LOCUS_69430 140032 137315 gene locus_tag LOCUS_69440 140032 137315 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035749.1 protein_id gnl|my_center|LOCUS_69440 140697 140032 gene locus_tag LOCUS_69450 140697 140032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086062.1 protein_id gnl|my_center|LOCUS_69450 141533 140694 gene locus_tag LOCUS_69460 141533 140694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086063.1 protein_id gnl|my_center|LOCUS_69460 142879 141530 gene locus_tag LOCUS_69470 142879 141530 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296526.1 protein_id gnl|my_center|LOCUS_69470 143119 142892 gene locus_tag LOCUS_69480 143119 142892 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058882.1 protein_id gnl|my_center|LOCUS_69480 144096 143287 gene locus_tag LOCUS_69490 144096 143287 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091866.1 protein_id gnl|my_center|LOCUS_69490 144291 145241 gene locus_tag LOCUS_69500 144291 145241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69500 145261 146064 gene locus_tag LOCUS_69510 145261 146064 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531396.1 protein_id gnl|my_center|LOCUS_69510 146952 146188 gene locus_tag LOCUS_69520 146952 146188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080101.1 protein_id gnl|my_center|LOCUS_69520 147970 146945 gene locus_tag LOCUS_69530 147970 146945 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726676.1 protein_id gnl|my_center|LOCUS_69530 148770 147988 gene locus_tag LOCUS_69540 148770 147988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086514.1 protein_id gnl|my_center|LOCUS_69540 149110 148901 gene locus_tag LOCUS_69550 149110 148901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 149587 149123 gene locus_tag LOCUS_69560 149587 149123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 150059 149601 gene locus_tag LOCUS_69570 150059 149601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69570 150078 151412 gene locus_tag LOCUS_69580 150078 151412 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225537.1 protein_id gnl|my_center|LOCUS_69580 151625 151371 gene locus_tag LOCUS_69590 151625 151371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69590 >Feature sequence18 1247 2905 gene locus_tag LOCUS_69600 1247 2905 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731180.1 protein_id gnl|my_center|LOCUS_69600 3021 4280 gene locus_tag LOCUS_69610 3021 4280 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_69610 4670 5500 gene locus_tag LOCUS_69620 4670 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69620 5497 6474 gene locus_tag LOCUS_69630 5497 6474 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225143.1 protein_id gnl|my_center|LOCUS_69630 6508 7470 gene locus_tag LOCUS_69640 6508 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69640 9860 7530 gene locus_tag LOCUS_69650 9860 7530 CDS product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229207.1 protein_id gnl|my_center|LOCUS_69650 10512 9970 gene locus_tag LOCUS_69660 10512 9970 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 protein_id gnl|my_center|LOCUS_69660 12157 10526 gene locus_tag LOCUS_69670 12157 10526 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_69670 12518 12225 gene locus_tag LOCUS_69680 12518 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228327.1 protein_id gnl|my_center|LOCUS_69680 12992 12567 gene locus_tag LOCUS_69690 12992 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69690 13027 14238 gene locus_tag LOCUS_69700 13027 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 14235 14894 gene locus_tag LOCUS_69710 14235 14894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_69710 14994 15395 gene locus_tag LOCUS_69720 14994 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 15398 16768 gene locus_tag LOCUS_69730 15398 16768 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152603799.1 protein_id gnl|my_center|LOCUS_69730 17054 16689 gene locus_tag LOCUS_69740 17054 16689 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228264.1 protein_id gnl|my_center|LOCUS_69740 18278 17244 gene locus_tag LOCUS_69750 18278 17244 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977963.1 protein_id gnl|my_center|LOCUS_69750 18506 19204 gene locus_tag LOCUS_69760 18506 19204 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228306.1 protein_id gnl|my_center|LOCUS_69760 19390 20262 gene locus_tag LOCUS_69770 19390 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 20430 21200 gene locus_tag LOCUS_69780 20430 21200 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230371.1 protein_id gnl|my_center|LOCUS_69780 21930 22502 gene locus_tag LOCUS_69790 21930 22502 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 protein_id gnl|my_center|LOCUS_69790 22575 23369 gene locus_tag LOCUS_69800 22575 23369 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223848.1 protein_id gnl|my_center|LOCUS_69800 23621 23382 gene locus_tag LOCUS_69810 23621 23382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69810 24469 23618 gene locus_tag LOCUS_69820 24469 23618 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_69820 25362 24466 gene locus_tag LOCUS_69830 25362 24466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_69830 25584 26480 gene locus_tag LOCUS_69840 25584 26480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69840 26471 27094 gene locus_tag LOCUS_69850 26471 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69850 28543 27101 gene locus_tag LOCUS_69860 28543 27101 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168137.1 protein_id gnl|my_center|LOCUS_69860 29297 28782 gene locus_tag LOCUS_69870 29297 28782 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229654.1 protein_id gnl|my_center|LOCUS_69870 30330 29389 gene locus_tag LOCUS_69880 30330 29389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 30521 31717 gene locus_tag LOCUS_69890 30521 31717 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221975.1 protein_id gnl|my_center|LOCUS_69890 31910 33874 gene locus_tag LOCUS_69900 31910 33874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69900 33871 39183 gene locus_tag LOCUS_69910 33871 39183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 39180 40499 gene locus_tag LOCUS_69920 39180 40499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69920 40496 41437 gene locus_tag LOCUS_69930 40496 41437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 41913 41491 gene locus_tag LOCUS_69940 41913 41491 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487417.1 protein_id gnl|my_center|LOCUS_69940 42294 42043 gene locus_tag LOCUS_69950 42294 42043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69950 43703 42396 gene locus_tag LOCUS_69960 43703 42396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69960 44407 43700 gene locus_tag LOCUS_69970 44407 43700 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224523.1 protein_id gnl|my_center|LOCUS_69970 44894 44625 gene locus_tag LOCUS_69980 44894 44625 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730282.1 protein_id gnl|my_center|LOCUS_69980 44983 45768 gene locus_tag LOCUS_69990 gene map 44983 45768 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730281.1 protein_id gnl|my_center|LOCUS_69990 49038 45823 gene locus_tag LOCUS_70000 49038 45823 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027471.1 protein_id gnl|my_center|LOCUS_70000 51538 49262 gene locus_tag LOCUS_70010 gene katG 51538 49262 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225954.1 protein_id gnl|my_center|LOCUS_70010 51988 51539 gene locus_tag LOCUS_70020 51988 51539 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225955.1 protein_id gnl|my_center|LOCUS_70020 52277 52642 gene locus_tag LOCUS_70030 52277 52642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70030 52721 55027 gene locus_tag LOCUS_70040 gene tcrA 52721 55027 CDS product AfsR-like transcriptional regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030244.1 protein_id gnl|my_center|LOCUS_70040 55178 55765 gene locus_tag LOCUS_70050 55178 55765 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152894621.1 protein_id gnl|my_center|LOCUS_70050 55777 57285 gene locus_tag LOCUS_70060 55777 57285 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031846.1 protein_id gnl|my_center|LOCUS_70060 57306 57959 gene locus_tag LOCUS_70070 57306 57959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031847.1 protein_id gnl|my_center|LOCUS_70070 58054 59082 gene locus_tag LOCUS_70080 58054 59082 CDS product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420436.1 protein_id gnl|my_center|LOCUS_70080 59140 60336 gene locus_tag LOCUS_70090 gene trpB 59140 60336 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124343.1 protein_id gnl|my_center|LOCUS_70090 60333 61130 gene locus_tag LOCUS_70100 gene trpA 60333 61130 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_70100 61150 61914 gene locus_tag LOCUS_70110 61150 61914 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_70110 62862 61927 gene locus_tag LOCUS_70120 62862 61927 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_70120 64688 62964 gene locus_tag LOCUS_70130 64688 62964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70130 68188 64685 gene locus_tag LOCUS_70140 68188 64685 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220451701.1 protein_id gnl|my_center|LOCUS_70140 69326 68181 gene locus_tag LOCUS_70150 69326 68181 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_70150 74137 69323 gene locus_tag LOCUS_70160 74137 69323 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031105.1 protein_id gnl|my_center|LOCUS_70160 75036 74134 gene locus_tag LOCUS_70170 75036 74134 CDS product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027634.1 protein_id gnl|my_center|LOCUS_70170 75798 75469 gene locus_tag LOCUS_70180 75798 75469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 75778 76893 gene locus_tag LOCUS_70190 75778 76893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 78309 76849 gene locus_tag LOCUS_70200 78309 76849 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223372.1 protein_id gnl|my_center|LOCUS_70200 80018 78309 gene locus_tag LOCUS_70210 80018 78309 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_70210 80157 80918 gene locus_tag LOCUS_70220 80157 80918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 81002 81193 gene locus_tag LOCUS_70230 81002 81193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 81197 84019 gene locus_tag LOCUS_70240 81197 84019 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_70240 84680 86596 gene locus_tag LOCUS_70250 84680 86596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_70250 86589 87962 gene locus_tag LOCUS_70260 86589 87962 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093303.1 protein_id gnl|my_center|LOCUS_70260 88362 87949 gene locus_tag LOCUS_70270 88362 87949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 88564 91716 gene locus_tag LOCUS_70280 88564 91716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70280 92343 91921 gene locus_tag LOCUS_70290 92343 91921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 93130 92441 gene locus_tag LOCUS_70300 93130 92441 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222065.1 protein_id gnl|my_center|LOCUS_70300 94356 93139 gene locus_tag LOCUS_70310 94356 93139 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_70310 94916 94356 gene locus_tag LOCUS_70320 94916 94356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70320 95178 96359 gene locus_tag LOCUS_70330 gene phzC 95178 96359 CDS product phenazine biosynthesis protein PhzC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093621.1 protein_id gnl|my_center|LOCUS_70330 96372 97361 gene locus_tag LOCUS_70340 96372 97361 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764578.1 protein_id gnl|my_center|LOCUS_70340 97379 98995 gene locus_tag LOCUS_70350 97379 98995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 99476 99177 gene locus_tag LOCUS_70360 99476 99177 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225091.1 protein_id gnl|my_center|LOCUS_70360 101328 99679 gene locus_tag LOCUS_70370 101328 99679 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226235.1 protein_id gnl|my_center|LOCUS_70370 101470 102333 gene locus_tag LOCUS_70380 101470 102333 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222877.1 protein_id gnl|my_center|LOCUS_70380 102405 103778 gene locus_tag LOCUS_70390 102405 103778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 103857 104801 gene locus_tag LOCUS_70400 103857 104801 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728156.1 protein_id gnl|my_center|LOCUS_70400 104967 106241 gene locus_tag LOCUS_70410 104967 106241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70410 106763 106365 gene locus_tag LOCUS_70420 106763 106365 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_70420 106896 107603 gene locus_tag LOCUS_70430 106896 107603 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_70430 109247 107610 gene locus_tag LOCUS_70440 109247 107610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70440 109460 109825 gene locus_tag LOCUS_70450 109460 109825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70450 109959 110504 gene locus_tag LOCUS_70460 109959 110504 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 protein_id gnl|my_center|LOCUS_70460 110501 112516 gene locus_tag LOCUS_70470 110501 112516 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222260.1 protein_id gnl|my_center|LOCUS_70470 112539 112925 gene locus_tag LOCUS_70480 112539 112925 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031404.1 protein_id gnl|my_center|LOCUS_70480 112965 113567 gene locus_tag LOCUS_70490 112965 113567 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730774.1 protein_id gnl|my_center|LOCUS_70490 116798 113589 gene locus_tag LOCUS_70500 116798 113589 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_70500 116998 118038 gene locus_tag LOCUS_70510 116998 118038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70510 118993 118097 gene locus_tag LOCUS_70520 118993 118097 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030054.1 protein_id gnl|my_center|LOCUS_70520 119018 119923 gene locus_tag LOCUS_70530 119018 119923 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030055.1 protein_id gnl|my_center|LOCUS_70530 120734 119982 gene locus_tag LOCUS_70540 120734 119982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 122656 120923 gene locus_tag LOCUS_70550 122656 120923 CDS product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866890.1 protein_id gnl|my_center|LOCUS_70550 123946 123095 gene locus_tag LOCUS_70560 123946 123095 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_70560 124044 125177 gene locus_tag LOCUS_70570 124044 125177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70570 125858 125178 gene locus_tag LOCUS_70580 gene kdpE 125858 125178 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405305.1 protein_id gnl|my_center|LOCUS_70580 128395 125855 gene locus_tag LOCUS_70590 128395 125855 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223788.1 protein_id gnl|my_center|LOCUS_70590 128578 130269 gene locus_tag LOCUS_70600 128578 130269 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030684.1 protein_id gnl|my_center|LOCUS_70600 130269 130814 gene locus_tag LOCUS_70610 130269 130814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70610 131180 130734 gene locus_tag LOCUS_70620 131180 130734 CDS product DUF6010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029381.1 protein_id gnl|my_center|LOCUS_70620 132911 131358 gene locus_tag LOCUS_70630 132911 131358 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227193.1 protein_id gnl|my_center|LOCUS_70630 133366 132908 gene locus_tag LOCUS_70640 133366 132908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70640 133556 133963 gene locus_tag LOCUS_70650 133556 133963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70650 133960 134361 gene locus_tag LOCUS_70660 133960 134361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70660 134842 134363 gene locus_tag LOCUS_70670 134842 134363 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226865.1 protein_id gnl|my_center|LOCUS_70670 135476 134877 gene locus_tag LOCUS_70680 135476 134877 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224777.1 protein_id gnl|my_center|LOCUS_70680 137078 135543 gene locus_tag LOCUS_70690 137078 135543 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 protein_id gnl|my_center|LOCUS_70690 137752 137141 gene locus_tag LOCUS_70700 137752 137141 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027253.1 protein_id gnl|my_center|LOCUS_70700 138541 137831 gene locus_tag LOCUS_70710 138541 137831 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970686.1 protein_id gnl|my_center|LOCUS_70710 138775 139059 gene locus_tag LOCUS_70720 138775 139059 CDS product isoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228175.1 protein_id gnl|my_center|LOCUS_70720 140449 139052 gene locus_tag LOCUS_70730 140449 139052 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220208744.1 protein_id gnl|my_center|LOCUS_70730 140601 141524 gene locus_tag LOCUS_70740 gene pip 140601 141524 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_70740 141597 142412 gene locus_tag LOCUS_70750 141597 142412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70750 143644 142388 gene locus_tag LOCUS_70760 143644 142388 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_70760 143910 144761 gene locus_tag LOCUS_70770 143910 144761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70770 144758 145417 gene locus_tag LOCUS_70780 144758 145417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405134.1 protein_id gnl|my_center|LOCUS_70780 >Feature sequence19 1278 133 gene locus_tag LOCUS_70790 1278 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70790 2149 1667 gene locus_tag LOCUS_70800 2149 1667 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030665.1 protein_id gnl|my_center|LOCUS_70800 3196 2213 gene locus_tag LOCUS_70810 3196 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70810 3387 3755 gene locus_tag LOCUS_70820 3387 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70820 3804 4493 gene locus_tag LOCUS_70830 3804 4493 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 protein_id gnl|my_center|LOCUS_70830 4494 5195 gene locus_tag LOCUS_70840 4494 5195 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_70840 5192 5605 gene locus_tag LOCUS_70850 5192 5605 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_70850 5764 6480 gene locus_tag LOCUS_70860 5764 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 6722 7099 gene locus_tag LOCUS_70870 6722 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70870 8838 7318 gene locus_tag LOCUS_70880 8838 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70880 10483 8984 gene locus_tag LOCUS_70890 10483 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 10686 13973 gene locus_tag LOCUS_70900 10686 13973 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_70900 13989 16253 gene locus_tag LOCUS_70910 13989 16253 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202102.1 protein_id gnl|my_center|LOCUS_70910 16285 17763 gene locus_tag LOCUS_70920 16285 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_70920 17760 18251 gene locus_tag LOCUS_70930 17760 18251 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090730.1 protein_id gnl|my_center|LOCUS_70930 18552 20252 gene locus_tag LOCUS_70940 18552 20252 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209441393.1 protein_id gnl|my_center|LOCUS_70940 20668 20276 gene locus_tag LOCUS_70950 20668 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70950 21040 20762 gene locus_tag LOCUS_70960 21040 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70960 21567 21172 gene locus_tag LOCUS_70970 21567 21172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70970 23338 21650 gene locus_tag LOCUS_70980 23338 21650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 23505 24374 gene locus_tag LOCUS_70990 23505 24374 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868402.1 protein_id gnl|my_center|LOCUS_70990 24827 27136 gene locus_tag LOCUS_71000 24827 27136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71000 28370 27180 gene locus_tag LOCUS_71010 gene megL 28370 27180 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_71010 28392 29792 gene locus_tag LOCUS_71020 28392 29792 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 protein_id gnl|my_center|LOCUS_71020 31049 29814 gene locus_tag LOCUS_71030 31049 29814 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_71030 32491 31235 gene locus_tag LOCUS_71040 32491 31235 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 protein_id gnl|my_center|LOCUS_71040 33093 32503 gene locus_tag LOCUS_71050 gene nodB 33093 32503 CDS product chitooligosaccharide deacetylase NodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533534.1 protein_id gnl|my_center|LOCUS_71050 32999 33202 gene locus_tag LOCUS_71060 32999 33202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71060 33615 34709 gene locus_tag LOCUS_71070 33615 34709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71070 34949 35176 gene locus_tag LOCUS_71080 34949 35176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71080 35189 35689 gene locus_tag LOCUS_71090 35189 35689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71090 35937 36830 gene locus_tag LOCUS_71100 35937 36830 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564337.1 protein_id gnl|my_center|LOCUS_71100 36902 37810 gene locus_tag LOCUS_71110 gene kdgD 36902 37810 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038348.1 protein_id gnl|my_center|LOCUS_71110 37826 38956 gene locus_tag LOCUS_71120 37826 38956 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_71120 38953 39882 gene locus_tag LOCUS_71130 38953 39882 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_71130 41349 39886 gene locus_tag LOCUS_71140 41349 39886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71140 42192 41848 gene locus_tag LOCUS_71150 42192 41848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71150 43693 42203 gene locus_tag LOCUS_71160 43693 42203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71160 43849 44568 gene locus_tag LOCUS_71170 43849 44568 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225119.1 protein_id gnl|my_center|LOCUS_71170 46374 44779 gene locus_tag LOCUS_71180 46374 44779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 47612 46755 gene locus_tag LOCUS_71190 47612 46755 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225909.1 protein_id gnl|my_center|LOCUS_71190 48747 47839 gene locus_tag LOCUS_71200 48747 47839 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932401.1 protein_id gnl|my_center|LOCUS_71200 50333 48897 gene locus_tag LOCUS_71210 50333 48897 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469007.1 protein_id gnl|my_center|LOCUS_71210 50420 51547 gene locus_tag LOCUS_71220 50420 51547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71220 51431 51527 gene locus_tag LOCUS_t00720 51431 51527 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51537 52196 gene locus_tag LOCUS_71230 51537 52196 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222860.1 protein_id gnl|my_center|LOCUS_71230 53488 52229 gene locus_tag LOCUS_71240 53488 52229 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226163.1 protein_id gnl|my_center|LOCUS_71240 53678 54793 gene locus_tag LOCUS_71250 53678 54793 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226162.1 protein_id gnl|my_center|LOCUS_71250 54931 55596 gene locus_tag LOCUS_71260 54931 55596 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690918.1 protein_id gnl|my_center|LOCUS_71260 55692 56261 gene locus_tag LOCUS_71270 55692 56261 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224856.1 protein_id gnl|my_center|LOCUS_71270 56268 57467 gene locus_tag LOCUS_71280 56268 57467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878633.1 protein_id gnl|my_center|LOCUS_71280 58371 57469 gene locus_tag LOCUS_71290 58371 57469 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226948.1 protein_id gnl|my_center|LOCUS_71290 59258 58371 gene locus_tag LOCUS_71300 59258 58371 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226949.1 protein_id gnl|my_center|LOCUS_71300 59342 60274 gene locus_tag LOCUS_71310 gene blaC 59342 60274 CDS product class A beta-lactamase BlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410677.1 protein_id gnl|my_center|LOCUS_71310 60730 60353 gene locus_tag LOCUS_71320 60730 60353 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225939.1 protein_id gnl|my_center|LOCUS_71320 61042 63186 gene locus_tag LOCUS_71330 61042 63186 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_71330 63192 64295 gene locus_tag LOCUS_71340 63192 64295 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_71340 64386 64637 gene locus_tag LOCUS_71350 64386 64637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71350 65687 64641 gene locus_tag LOCUS_71360 65687 64641 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878413.1 protein_id gnl|my_center|LOCUS_71360 65763 66656 gene locus_tag LOCUS_71370 65763 66656 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_71370 68088 66694 gene locus_tag LOCUS_71380 68088 66694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71380 68212 68871 gene locus_tag LOCUS_71390 68212 68871 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230194.1 protein_id gnl|my_center|LOCUS_71390 68871 70025 gene locus_tag LOCUS_71400 68871 70025 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_71400 70489 70070 gene locus_tag LOCUS_71410 70489 70070 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_71410 70829 70644 gene locus_tag LOCUS_71420 70829 70644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71420 70875 72425 gene locus_tag LOCUS_71430 gene dacB 70875 72425 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_71430 73480 72434 gene locus_tag LOCUS_71440 73480 72434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71440 74298 73558 gene locus_tag LOCUS_71450 74298 73558 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223069.1 protein_id gnl|my_center|LOCUS_71450 74410 74949 gene locus_tag LOCUS_71460 74410 74949 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_71460 74987 76363 gene locus_tag LOCUS_71470 74987 76363 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015481.1 protein_id gnl|my_center|LOCUS_71470 76419 77180 gene locus_tag LOCUS_71480 76419 77180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229704.1 protein_id gnl|my_center|LOCUS_71480 77256 78953 gene locus_tag LOCUS_71490 gene ilvD 77256 78953 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079804.1 protein_id gnl|my_center|LOCUS_71490 80957 79089 gene locus_tag LOCUS_71500 80957 79089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71500 83228 81213 gene locus_tag LOCUS_71510 83228 81213 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_71510 83303 83773 gene locus_tag LOCUS_71520 83303 83773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71520 83900 84991 gene locus_tag LOCUS_71530 83900 84991 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222819.1 protein_id gnl|my_center|LOCUS_71530 85131 86405 gene locus_tag LOCUS_71540 85131 86405 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_71540 86509 87417 gene locus_tag LOCUS_71550 86509 87417 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230294.1 protein_id gnl|my_center|LOCUS_71550 87969 87340 gene locus_tag LOCUS_71560 87969 87340 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350628.1 protein_id gnl|my_center|LOCUS_71560 88086 88580 gene locus_tag LOCUS_71570 88086 88580 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_71570 88577 89533 gene locus_tag LOCUS_71580 88577 89533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71580 90138 89551 gene locus_tag LOCUS_71590 90138 89551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71590 90245 90841 gene locus_tag LOCUS_71600 90245 90841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71600 92798 90846 gene locus_tag LOCUS_71610 92798 90846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71610 92982 93293 gene locus_tag LOCUS_71620 92982 93293 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225922.1 protein_id gnl|my_center|LOCUS_71620 93286 93612 gene locus_tag LOCUS_71630 93286 93612 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742202.1 protein_id gnl|my_center|LOCUS_71630 93590 94306 gene locus_tag LOCUS_71640 93590 94306 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225920.1 protein_id gnl|my_center|LOCUS_71640 94303 95832 gene locus_tag LOCUS_71650 94303 95832 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_71650 96665 95829 gene locus_tag LOCUS_71660 96665 95829 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978674.1 protein_id gnl|my_center|LOCUS_71660 96993 96709 gene locus_tag LOCUS_71670 96993 96709 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222241.1 protein_id gnl|my_center|LOCUS_71670 98035 97073 gene locus_tag LOCUS_71680 98035 97073 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742233.1 protein_id gnl|my_center|LOCUS_71680 98977 98051 gene locus_tag LOCUS_71690 98977 98051 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225923.1 protein_id gnl|my_center|LOCUS_71690 99128 100234 gene locus_tag LOCUS_71700 99128 100234 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_71700 100248 101714 gene locus_tag LOCUS_71710 gene crtI 100248 101714 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728283.1 protein_id gnl|my_center|LOCUS_71710 102031 102435 gene locus_tag LOCUS_71720 102031 102435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 102883 102500 gene locus_tag LOCUS_71730 102883 102500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71730 105278 102930 gene locus_tag LOCUS_71740 105278 102930 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031588.1 protein_id gnl|my_center|LOCUS_71740 106018 109548 gene locus_tag LOCUS_71750 106018 109548 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728047.1 protein_id gnl|my_center|LOCUS_71750 110733 109594 gene locus_tag LOCUS_71760 110733 109594 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878081.1 protein_id gnl|my_center|LOCUS_71760 111296 110739 gene locus_tag LOCUS_71770 111296 110739 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027654.1 protein_id gnl|my_center|LOCUS_71770 112417 111284 gene locus_tag LOCUS_71780 112417 111284 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 protein_id gnl|my_center|LOCUS_71780 112891 114477 gene locus_tag LOCUS_71790 112891 114477 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112961.1 protein_id gnl|my_center|LOCUS_71790 114531 115601 gene locus_tag LOCUS_71800 114531 115601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71800 116676 115678 gene locus_tag LOCUS_71810 116676 115678 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_71810 117585 116977 gene locus_tag LOCUS_71820 gene wrbA 117585 116977 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228078.1 protein_id gnl|my_center|LOCUS_71820 117786 118742 gene locus_tag LOCUS_71830 gene sigJ 117786 118742 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_71830 118945 120015 gene locus_tag LOCUS_71840 118945 120015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71840 120096 120575 gene locus_tag LOCUS_71850 120096 120575 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028645.1 protein_id gnl|my_center|LOCUS_71850 120586 121479 gene locus_tag LOCUS_71860 120586 121479 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_71860 121652 122308 gene locus_tag LOCUS_71870 121652 122308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030751.1 protein_id gnl|my_center|LOCUS_71870 123510 122332 gene locus_tag LOCUS_71880 123510 122332 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973190.1 protein_id gnl|my_center|LOCUS_71880 123604 124779 gene locus_tag LOCUS_71890 123604 124779 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973189.1 protein_id gnl|my_center|LOCUS_71890 125704 124790 gene locus_tag LOCUS_71900 125704 124790 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227665.1 protein_id gnl|my_center|LOCUS_71900 125778 126683 gene locus_tag LOCUS_71910 125778 126683 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227664.1 protein_id gnl|my_center|LOCUS_71910 127553 126690 gene locus_tag LOCUS_71920 127553 126690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71920 128983 127688 gene locus_tag LOCUS_71930 128983 127688 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_71930 129529 129170 gene locus_tag LOCUS_71940 129529 129170 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729797.1 protein_id gnl|my_center|LOCUS_71940 129582 130412 gene locus_tag LOCUS_71950 129582 130412 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 protein_id gnl|my_center|LOCUS_71950 >Feature sequence20 294 1529 gene locus_tag LOCUS_71960 294 1529 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079030578.1 protein_id gnl|my_center|LOCUS_71960 2178 3374 gene locus_tag LOCUS_71970 2178 3374 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_71970 4641 4369 gene locus_tag LOCUS_71980 4641 4369 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_71980 5069 5665 gene locus_tag LOCUS_71990 5069 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71990 5948 6232 gene locus_tag LOCUS_72000 5948 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72000 6407 6796 gene locus_tag LOCUS_72010 6407 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72010 6793 7401 gene locus_tag LOCUS_72020 6793 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72020 7398 7787 gene locus_tag LOCUS_72030 7398 7787 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973653.1 protein_id gnl|my_center|LOCUS_72030 7784 9040 gene locus_tag LOCUS_72040 7784 9040 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973654.1 protein_id gnl|my_center|LOCUS_72040 9037 10272 gene locus_tag LOCUS_72050 9037 10272 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030171.1 protein_id gnl|my_center|LOCUS_72050 10274 10516 gene locus_tag LOCUS_72060 10274 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72060 10518 10976 gene locus_tag LOCUS_72070 10518 10976 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973657.1 protein_id gnl|my_center|LOCUS_72070 10961 11290 gene locus_tag LOCUS_72080 10961 11290 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227257.1 protein_id gnl|my_center|LOCUS_72080 11283 12869 gene locus_tag LOCUS_72090 11283 12869 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227261.1 protein_id gnl|my_center|LOCUS_72090 13778 13140 gene locus_tag LOCUS_72100 13778 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72100 14909 14463 gene locus_tag LOCUS_72110 14909 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72110 15142 14903 gene locus_tag LOCUS_72120 15142 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72120 15819 15337 gene locus_tag LOCUS_72130 15819 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72130 16228 17016 gene locus_tag LOCUS_72140 16228 17016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72140 17309 17064 gene locus_tag LOCUS_72150 17309 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72150 17352 17612 gene locus_tag LOCUS_72160 17352 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72160 18526 17933 gene locus_tag LOCUS_72170 18526 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72170 18444 18713 gene locus_tag LOCUS_72180 18444 18713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72180 18760 22206 gene locus_tag LOCUS_72190 18760 22206 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227339.1 protein_id gnl|my_center|LOCUS_72190 22248 29108 gene locus_tag LOCUS_72200 22248 29108 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157376789.1 protein_id gnl|my_center|LOCUS_72200 29604 29182 gene locus_tag LOCUS_72210 29604 29182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72210 29707 29901 gene locus_tag LOCUS_72220 29707 29901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72220 30186 29848 gene locus_tag LOCUS_72230 30186 29848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72230 30166 30744 gene locus_tag LOCUS_72240 30166 30744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72240 30675 31130 gene locus_tag LOCUS_72250 30675 31130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72250 31458 31778 gene locus_tag LOCUS_72260 31458 31778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72260 35087 32319 gene locus_tag LOCUS_72270 35087 32319 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225948.1 protein_id gnl|my_center|LOCUS_72270 35865 36812 gene locus_tag LOCUS_72280 35865 36812 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227516.1 protein_id gnl|my_center|LOCUS_72280 37405 37040 gene locus_tag LOCUS_72290 37405 37040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72290 37689 37519 gene locus_tag LOCUS_72300 37689 37519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72300 38890 37952 gene locus_tag LOCUS_72310 38890 37952 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225369.1 protein_id gnl|my_center|LOCUS_72310 39249 38887 gene locus_tag LOCUS_72320 39249 38887 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_72320 39513 40991 gene locus_tag LOCUS_72330 39513 40991 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527615.1 protein_id gnl|my_center|LOCUS_72330 41154 41507 gene locus_tag LOCUS_72340 41154 41507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004993226.1 protein_id gnl|my_center|LOCUS_72340 42056 41523 gene locus_tag LOCUS_72350 42056 41523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605869.1 protein_id gnl|my_center|LOCUS_72350 42310 42053 gene locus_tag LOCUS_72360 42310 42053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72360 42405 42989 gene locus_tag LOCUS_72370 42405 42989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72370 43814 43113 gene locus_tag LOCUS_72380 43814 43113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72380 44229 43825 gene locus_tag LOCUS_72390 44229 43825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 44781 44948 gene locus_tag LOCUS_72400 44781 44948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72400 45064 45273 gene locus_tag LOCUS_72410 45064 45273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72410 45920 45687 gene locus_tag LOCUS_72420 45920 45687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72420 49548 46471 gene locus_tag LOCUS_72430 49548 46471 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_72430 50745 49552 gene locus_tag LOCUS_72440 50745 49552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72440 52312 50738 gene locus_tag LOCUS_72450 52312 50738 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038026.1 protein_id gnl|my_center|LOCUS_72450 53484 53711 gene locus_tag LOCUS_72460 53484 53711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72460 56829 54220 gene locus_tag LOCUS_72470 56829 54220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72470 57129 57755 gene locus_tag LOCUS_72480 57129 57755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_72480 57765 57968 gene locus_tag LOCUS_72490 57765 57968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_72490 58428 58874 gene locus_tag LOCUS_72500 58428 58874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72500 58865 59554 gene locus_tag LOCUS_72510 58865 59554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72510 60540 63218 gene locus_tag LOCUS_72520 60540 63218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 63517 64050 gene locus_tag LOCUS_72530 63517 64050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227620.1 protein_id gnl|my_center|LOCUS_72530 66115 65882 gene locus_tag LOCUS_72540 66115 65882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72540 66621 66842 gene locus_tag LOCUS_72550 66621 66842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72550 67041 68204 gene locus_tag LOCUS_72560 67041 68204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72560 68872 68366 gene locus_tag LOCUS_72570 68872 68366 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_72570 68859 69236 gene locus_tag LOCUS_72580 68859 69236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72580 69767 69381 gene locus_tag LOCUS_72590 69767 69381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72590 69960 71057 gene locus_tag LOCUS_72600 69960 71057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72600 71382 71308 gene locus_tag LOCUS_t00730 71382 71308 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 71455 71383 gene locus_tag LOCUS_t00740 71455 71383 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 71586 71513 gene locus_tag LOCUS_t00750 71586 71513 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 72156 71731 gene locus_tag LOCUS_72610 72156 71731 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227152.1 protein_id gnl|my_center|LOCUS_72610 72375 72734 gene locus_tag LOCUS_72620 72375 72734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72620 72665 72934 gene locus_tag LOCUS_72630 72665 72934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72630 73041 73823 gene locus_tag LOCUS_72640 73041 73823 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977104.1 protein_id gnl|my_center|LOCUS_72640 73843 74277 gene locus_tag LOCUS_72650 73843 74277 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728698.1 protein_id gnl|my_center|LOCUS_72650 74327 74399 gene locus_tag LOCUS_t00760 74327 74399 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 75631 74516 gene locus_tag LOCUS_72660 75631 74516 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223366.1 protein_id gnl|my_center|LOCUS_72660 76089 75730 gene locus_tag LOCUS_72670 76089 75730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72670 77438 76356 gene locus_tag LOCUS_72680 77438 76356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72680 78118 81393 gene locus_tag LOCUS_72690 78118 81393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72690 81408 83036 gene locus_tag LOCUS_72700 81408 83036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72700 83232 83411 gene locus_tag LOCUS_72710 83232 83411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72710 84468 84770 gene locus_tag LOCUS_72720 84468 84770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72720 87085 85145 gene locus_tag LOCUS_72730 87085 85145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72730 87651 87082 gene locus_tag LOCUS_72740 87651 87082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72740 89063 87648 gene locus_tag LOCUS_72750 89063 87648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72750 90423 90175 gene locus_tag LOCUS_72760 90423 90175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72760 90659 90847 gene locus_tag LOCUS_72770 90659 90847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72770 91818 91111 gene locus_tag LOCUS_72780 91818 91111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72780 92378 92731 gene locus_tag LOCUS_72790 92378 92731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72790 92793 93536 gene locus_tag LOCUS_72800 92793 93536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72800 93555 94100 gene locus_tag LOCUS_72810 93555 94100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72810 95352 94105 gene locus_tag LOCUS_72820 95352 94105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72820 95789 95388 gene locus_tag LOCUS_72830 95789 95388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_72830 96280 95816 gene locus_tag LOCUS_72840 96280 95816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72840 97078 98631 gene locus_tag LOCUS_72850 97078 98631 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_72850 98699 99997 gene locus_tag LOCUS_72860 98699 99997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72860 99994 101346 gene locus_tag LOCUS_72870 99994 101346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72870 101358 101675 gene locus_tag LOCUS_72880 101358 101675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72880 101714 102262 gene locus_tag LOCUS_72890 101714 102262 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_72890 102622 102248 gene locus_tag LOCUS_72900 102622 102248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72900 102784 103104 gene locus_tag LOCUS_72910 102784 103104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72910 104132 103353 gene locus_tag LOCUS_72920 104132 103353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72920 104341 104766 gene locus_tag LOCUS_72930 104341 104766 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229580.1 protein_id gnl|my_center|LOCUS_72930 105136 104774 gene locus_tag LOCUS_72940 105136 104774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72940 105849 105466 gene locus_tag LOCUS_72950 105849 105466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72950 106298 106933 gene locus_tag LOCUS_72960 106298 106933 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975219.1 protein_id gnl|my_center|LOCUS_72960 108023 107043 gene locus_tag LOCUS_72970 108023 107043 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_72970 109466 108447 gene locus_tag LOCUS_72980 gene corA 109466 108447 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_72980 110019 110648 gene locus_tag LOCUS_72990 110019 110648 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230204.1 protein_id gnl|my_center|LOCUS_72990 112053 110824 gene locus_tag LOCUS_73000 112053 110824 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_73000 112897 112136 gene locus_tag LOCUS_73010 gene lieB 112897 112136 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_73010 113677 112907 gene locus_tag LOCUS_73020 113677 112907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017474.1 protein_id gnl|my_center|LOCUS_73020 114042 113674 gene locus_tag LOCUS_73030 114042 113674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73030 114374 114039 gene locus_tag LOCUS_73040 114374 114039 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_73040 115161 117143 gene locus_tag LOCUS_73050 115161 117143 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_73050 117419 117201 gene locus_tag LOCUS_73060 117419 117201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73060 117625 117416 gene locus_tag LOCUS_73070 117625 117416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73070 >Feature sequence21 2515 3051 gene locus_tag LOCUS_73080 2515 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73080 3101 3664 gene locus_tag LOCUS_73090 3101 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73090 4080 3844 gene locus_tag LOCUS_73100 4080 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73100 4237 4785 gene locus_tag LOCUS_73110 4237 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73110 5720 5421 gene locus_tag LOCUS_73120 5720 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73120 6136 5762 gene locus_tag LOCUS_73130 6136 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73130 6555 6133 gene locus_tag LOCUS_73140 6555 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73140 7393 6758 gene locus_tag LOCUS_73150 7393 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73150 7374 7595 gene locus_tag LOCUS_73160 7374 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73160 7791 7555 gene locus_tag LOCUS_73170 7791 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73170 8249 7992 gene locus_tag LOCUS_73180 8249 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73180 10081 8327 gene locus_tag LOCUS_73190 10081 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031249.1 protein_id gnl|my_center|LOCUS_73190 11340 10132 gene locus_tag LOCUS_73200 11340 10132 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468189.1 protein_id gnl|my_center|LOCUS_73200 11535 11377 gene locus_tag LOCUS_73210 11535 11377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73210 12380 12724 gene locus_tag LOCUS_73220 12380 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73220 15961 12842 gene locus_tag LOCUS_73230 15961 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73230 16583 16164 gene locus_tag LOCUS_73240 16583 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73240 17024 16635 gene locus_tag LOCUS_73250 17024 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73250 17518 17111 gene locus_tag LOCUS_73260 17518 17111 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749557.1 protein_id gnl|my_center|LOCUS_73260 18091 17642 gene locus_tag LOCUS_73270 18091 17642 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867405.1 protein_id gnl|my_center|LOCUS_73270 18288 18097 gene locus_tag LOCUS_73280 18288 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73280 19241 18348 gene locus_tag LOCUS_73290 19241 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73290 20173 19247 gene locus_tag LOCUS_73300 20173 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73300 21642 20161 gene locus_tag LOCUS_73310 21642 20161 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_73310 22541 21639 gene locus_tag LOCUS_73320 22541 21639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_73320 23251 22541 gene locus_tag LOCUS_73330 23251 22541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73330 24225 23377 gene locus_tag LOCUS_73340 24225 23377 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749566.1 protein_id gnl|my_center|LOCUS_73340 24788 24219 gene locus_tag LOCUS_73350 24788 24219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73350 25329 24850 gene locus_tag LOCUS_73360 25329 24850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73360 25753 28068 gene locus_tag LOCUS_73370 25753 28068 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033262674.1 protein_id gnl|my_center|LOCUS_73370 28610 28017 gene locus_tag LOCUS_73380 28610 28017 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_73380 28672 29634 gene locus_tag LOCUS_73390 28672 29634 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_73390 30235 29777 gene locus_tag LOCUS_73400 30235 29777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73400 31234 30245 gene locus_tag LOCUS_73410 31234 30245 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_73410 32800 31343 gene locus_tag LOCUS_73420 32800 31343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 32938 34116 gene locus_tag LOCUS_73430 32938 34116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73430 34113 34742 gene locus_tag LOCUS_73440 34113 34742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73440 34736 35356 gene locus_tag LOCUS_73450 34736 35356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73450 35727 36581 gene locus_tag LOCUS_73460 35727 36581 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_73460 36581 36859 gene locus_tag LOCUS_73470 36581 36859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73470 36981 37232 gene locus_tag LOCUS_73480 36981 37232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73480 37229 38032 gene locus_tag LOCUS_73490 37229 38032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 38244 38068 gene locus_tag LOCUS_73500 38244 38068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73500 41999 38628 gene locus_tag LOCUS_73510 41999 38628 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_73510 44737 41999 gene locus_tag LOCUS_73520 44737 41999 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_73520 48240 44734 gene locus_tag LOCUS_73530 48240 44734 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968627.1 protein_id gnl|my_center|LOCUS_73530 49260 49502 gene locus_tag LOCUS_73540 49260 49502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73540 49608 50792 gene locus_tag LOCUS_73550 49608 50792 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223366.1 protein_id gnl|my_center|LOCUS_73550 50796 51284 gene locus_tag LOCUS_73560 50796 51284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73560 51826 51485 gene locus_tag LOCUS_73570 51826 51485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73570 52346 51813 gene locus_tag LOCUS_73580 52346 51813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73580 53136 52315 gene locus_tag LOCUS_73590 53136 52315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73590 53382 53945 gene locus_tag LOCUS_73600 53382 53945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73600 55160 54411 gene locus_tag LOCUS_73610 55160 54411 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091945.1 protein_id gnl|my_center|LOCUS_73610 55671 55598 gene locus_tag LOCUS_t00770 55671 55598 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 56560 55802 gene locus_tag LOCUS_73620 56560 55802 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223189.1 protein_id gnl|my_center|LOCUS_73620 57944 56628 gene locus_tag LOCUS_73630 57944 56628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081138.1 protein_id gnl|my_center|LOCUS_73630 58818 58006 gene locus_tag LOCUS_73640 58818 58006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73640 59923 58823 gene locus_tag LOCUS_73650 59923 58823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73650 59922 62273 gene locus_tag LOCUS_73660 gene hrpB 59922 62273 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_73660 62329 62754 gene locus_tag LOCUS_73670 62329 62754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73670 62751 63362 gene locus_tag LOCUS_73680 62751 63362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73680 63914 63544 gene locus_tag LOCUS_tm00010 63914 63544 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 64080 65327 gene locus_tag LOCUS_73690 64080 65327 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223162.1 protein_id gnl|my_center|LOCUS_73690 65315 65959 gene locus_tag LOCUS_73700 65315 65959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 protein_id gnl|my_center|LOCUS_73700 66773 65946 gene locus_tag LOCUS_73710 66773 65946 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223157.1 protein_id gnl|my_center|LOCUS_73710 67276 66800 gene locus_tag LOCUS_73720 gene smpB 67276 66800 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_73720 68219 67317 gene locus_tag LOCUS_73730 gene ftsX 68219 67317 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223155.1 protein_id gnl|my_center|LOCUS_73730 68944 68273 gene locus_tag LOCUS_73740 gene ftsE 68944 68273 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_73740 70130 69030 gene locus_tag LOCUS_73750 gene prfB 70130 69030 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748464.1 protein_id gnl|my_center|LOCUS_73750 70682 70182 gene locus_tag LOCUS_73760 70682 70182 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223153.1 protein_id gnl|my_center|LOCUS_73760 71077 71274 gene locus_tag LOCUS_73770 71077 71274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73770 71401 71327 gene locus_tag LOCUS_t00780 71401 71327 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 71832 71758 gene locus_tag LOCUS_t00790 71832 71758 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 74908 71927 gene locus_tag LOCUS_73780 74908 71927 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630643.1 protein_id gnl|my_center|LOCUS_73780 75014 75556 gene locus_tag LOCUS_73790 75014 75556 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223149.1 protein_id gnl|my_center|LOCUS_73790 76669 75584 gene locus_tag LOCUS_73800 76669 75584 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324693.1 protein_id gnl|my_center|LOCUS_73800 76751 78070 gene locus_tag LOCUS_73810 76751 78070 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466645.1 protein_id gnl|my_center|LOCUS_73810 78655 78128 gene locus_tag LOCUS_73820 78655 78128 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223146.1 protein_id gnl|my_center|LOCUS_73820 78859 79014 gene locus_tag LOCUS_73830 78859 79014 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_73830 79145 80155 gene locus_tag LOCUS_73840 79145 80155 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223145.1 protein_id gnl|my_center|LOCUS_73840 80197 81552 gene locus_tag LOCUS_73850 80197 81552 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223144.1 protein_id gnl|my_center|LOCUS_73850 81634 82188 gene locus_tag LOCUS_73860 81634 82188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73860 83399 82614 gene locus_tag LOCUS_73870 83399 82614 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466643.1 protein_id gnl|my_center|LOCUS_73870 84213 83989 gene locus_tag LOCUS_73880 84213 83989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73880 84608 84210 gene locus_tag LOCUS_73890 84608 84210 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223139.1 protein_id gnl|my_center|LOCUS_73890 84967 84746 gene locus_tag LOCUS_73900 84967 84746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73900 87398 85344 gene locus_tag LOCUS_73910 87398 85344 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_73910 85776 85693 gene locus_tag LOCUS_t00800 85776 85693 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 87471 88211 gene locus_tag LOCUS_73920 87471 88211 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223136.1 protein_id gnl|my_center|LOCUS_73920 88757 88284 gene locus_tag LOCUS_73930 88757 88284 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_73930 88952 90376 gene locus_tag LOCUS_73940 gene glnA 88952 90376 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223133.1 protein_id gnl|my_center|LOCUS_73940 90868 90479 gene locus_tag LOCUS_73950 90868 90479 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225078.1 protein_id gnl|my_center|LOCUS_73950 91519 90869 gene locus_tag LOCUS_73960 91519 90869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73960 91709 91924 gene locus_tag LOCUS_73970 91709 91924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 92852 91971 gene locus_tag LOCUS_73980 92852 91971 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 protein_id gnl|my_center|LOCUS_73980 95879 92913 gene locus_tag LOCUS_73990 95879 92913 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466641.1 protein_id gnl|my_center|LOCUS_73990 96144 95920 gene locus_tag LOCUS_74000 96144 95920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74000 97274 96141 gene locus_tag LOCUS_74010 97274 96141 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315406.1 protein_id gnl|my_center|LOCUS_74010 98138 97401 gene locus_tag LOCUS_74020 98138 97401 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_74020 98638 98153 gene locus_tag LOCUS_74030 98638 98153 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223127.1 protein_id gnl|my_center|LOCUS_74030 98601 99146 gene locus_tag LOCUS_74040 98601 99146 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223126.1 protein_id gnl|my_center|LOCUS_74040 99177 99779 gene locus_tag LOCUS_74050 99177 99779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74050 99776 99982 gene locus_tag LOCUS_74060 99776 99982 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_74060 100844 99963 gene locus_tag LOCUS_74070 100844 99963 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114349.1 protein_id gnl|my_center|LOCUS_74070 >Feature sequence22 <1 1410 gene locus_tag LOCUS_74080 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224620.1:carbamoyl-phosphate synthase large subunit 1425 2225 gene locus_tag LOCUS_74090 gene pyrF 1425 2225 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224621.1 protein_id gnl|my_center|LOCUS_74090 2527 2844 gene locus_tag LOCUS_74100 gene mihF 2527 2844 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_74100 2841 3440 gene locus_tag LOCUS_74110 gene gmk 2841 3440 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466863.1 protein_id gnl|my_center|LOCUS_74110 3506 3784 gene locus_tag LOCUS_74120 gene rpoZ 3506 3784 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224624.1 protein_id gnl|my_center|LOCUS_74120 3829 5025 gene locus_tag LOCUS_74130 gene coaBC 3829 5025 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831608.1 protein_id gnl|my_center|LOCUS_74130 5083 6285 gene locus_tag LOCUS_74140 gene metK 5083 6285 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284357.1 protein_id gnl|my_center|LOCUS_74140 6547 7806 gene locus_tag LOCUS_74150 6547 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74150 7921 9906 gene locus_tag LOCUS_74160 7921 9906 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_74160 10063 11751 gene locus_tag LOCUS_74170 gene ggt 10063 11751 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 protein_id gnl|my_center|LOCUS_74170 13007 11805 gene locus_tag LOCUS_74180 13007 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74180 13540 13004 gene locus_tag LOCUS_74190 13540 13004 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225515.1 protein_id gnl|my_center|LOCUS_74190 13727 13936 gene locus_tag LOCUS_74200 13727 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74200 13983 14525 gene locus_tag LOCUS_74210 gene def 13983 14525 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_74210 14682 15617 gene locus_tag LOCUS_74220 gene fmt 14682 15617 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224632.1 protein_id gnl|my_center|LOCUS_74220 15695 17041 gene locus_tag LOCUS_74230 15695 17041 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224633.1 protein_id gnl|my_center|LOCUS_74230 17197 17730 gene locus_tag LOCUS_74240 17197 17730 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224634.1 protein_id gnl|my_center|LOCUS_74240 17762 20335 gene locus_tag LOCUS_74250 17762 20335 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 protein_id gnl|my_center|LOCUS_74250 21159 20518 gene locus_tag LOCUS_74260 gene dhbA 21159 20518 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048437.1 protein_id gnl|my_center|LOCUS_74260 21328 21978 gene locus_tag LOCUS_74270 gene rpe 21328 21978 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224639.1 protein_id gnl|my_center|LOCUS_74270 21975 22988 gene locus_tag LOCUS_74280 gene ribD 21975 22988 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082329.1 protein_id gnl|my_center|LOCUS_74280 22998 23609 gene locus_tag LOCUS_74290 22998 23609 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_74290 23606 24874 gene locus_tag LOCUS_74300 23606 24874 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_74300 24871 25350 gene locus_tag LOCUS_74310 gene ribH 24871 25350 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224642.1 protein_id gnl|my_center|LOCUS_74310 25359 25796 gene locus_tag LOCUS_74320 25359 25796 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224643.1 protein_id gnl|my_center|LOCUS_74320 26020 25829 gene locus_tag LOCUS_74330 26020 25829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74330 25994 27358 gene locus_tag LOCUS_74340 25994 27358 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749132.1 protein_id gnl|my_center|LOCUS_74340 27372 28019 gene locus_tag LOCUS_74350 27372 28019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74350 28978 28016 gene locus_tag LOCUS_74360 28978 28016 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043788179.1 protein_id gnl|my_center|LOCUS_74360 29503 29018 gene locus_tag LOCUS_74370 29503 29018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_74370 30999 29503 gene locus_tag LOCUS_74380 30999 29503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229067.1 protein_id gnl|my_center|LOCUS_74380 31334 31825 gene locus_tag LOCUS_74390 31334 31825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74390 32005 32415 gene locus_tag LOCUS_74400 32005 32415 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226054.1 protein_id gnl|my_center|LOCUS_74400 32558 32986 gene locus_tag LOCUS_74410 32558 32986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74410 33135 35066 gene locus_tag LOCUS_74420 gene uvrC 33135 35066 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_74420 35079 35966 gene locus_tag LOCUS_74430 gene rapZ 35079 35966 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 protein_id gnl|my_center|LOCUS_74430 35963 36994 gene locus_tag LOCUS_74440 gene yvcK 35963 36994 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224648.1 protein_id gnl|my_center|LOCUS_74440 36985 37971 gene locus_tag LOCUS_74450 gene whiA 36985 37971 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 protein_id gnl|my_center|LOCUS_74450 40029 37975 gene locus_tag LOCUS_74460 40029 37975 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228230.1 protein_id gnl|my_center|LOCUS_74460 40572 41576 gene locus_tag LOCUS_74470 gene gap 40572 41576 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_74470 41597 42760 gene locus_tag LOCUS_74480 41597 42760 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_74480 42760 43548 gene locus_tag LOCUS_74490 gene tpiA 42760 43548 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224668.1 protein_id gnl|my_center|LOCUS_74490 43639 43872 gene locus_tag LOCUS_74500 43639 43872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74500 43954 44298 gene locus_tag LOCUS_74510 43954 44298 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_74510 44724 44380 gene locus_tag LOCUS_74520 44724 44380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74520 44974 44738 gene locus_tag LOCUS_74530 44974 44738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74530 44855 45112 gene locus_tag LOCUS_74540 44855 45112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74540 45339 46136 gene locus_tag LOCUS_74550 45339 46136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229340.1 protein_id gnl|my_center|LOCUS_74550 46205 47839 gene locus_tag LOCUS_74560 46205 47839 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229339.1 protein_id gnl|my_center|LOCUS_74560 49705 48416 gene locus_tag LOCUS_74570 49705 48416 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742171.1 protein_id gnl|my_center|LOCUS_74570 49966 50547 gene locus_tag LOCUS_74580 49966 50547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74580 51322 50528 gene locus_tag LOCUS_74590 gene pgl 51322 50528 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224672.1 protein_id gnl|my_center|LOCUS_74590 52572 51319 gene locus_tag LOCUS_74600 gene opcA 52572 51319 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224673.1 protein_id gnl|my_center|LOCUS_74600 54110 52569 gene locus_tag LOCUS_74610 gene zwf 54110 52569 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224674.1 protein_id gnl|my_center|LOCUS_74610 55723 54107 gene locus_tag LOCUS_74620 55723 54107 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_74620 56898 55738 gene locus_tag LOCUS_74630 gene tal 56898 55738 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_74630 58988 56895 gene locus_tag LOCUS_74640 gene tkt 58988 56895 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224677.1 protein_id gnl|my_center|LOCUS_74640 59244 60167 gene locus_tag LOCUS_74650 59244 60167 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224678.1 protein_id gnl|my_center|LOCUS_74650 61524 60874 gene locus_tag LOCUS_74660 61524 60874 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230413.1 protein_id gnl|my_center|LOCUS_74660 62231 61584 gene locus_tag LOCUS_74670 62231 61584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230412.1 protein_id gnl|my_center|LOCUS_74670 63245 62238 gene locus_tag LOCUS_74680 63245 62238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230411.1 protein_id gnl|my_center|LOCUS_74680 63573 63376 gene locus_tag LOCUS_74690 63573 63376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74690 63467 64057 gene locus_tag LOCUS_74700 63467 64057 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224685.1 protein_id gnl|my_center|LOCUS_74700 65113 64142 gene locus_tag LOCUS_74710 65113 64142 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_74710 66823 65201 gene locus_tag LOCUS_74720 66823 65201 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_74720 66722 67051 gene locus_tag LOCUS_74730 66722 67051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74730 67048 67305 gene locus_tag LOCUS_74740 67048 67305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224687.1 protein_id gnl|my_center|LOCUS_74740 67302 68153 gene locus_tag LOCUS_74750 67302 68153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_74750 69771 68197 gene locus_tag LOCUS_74760 69771 68197 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224361.1 protein_id gnl|my_center|LOCUS_74760 70187 69771 gene locus_tag LOCUS_74770 70187 69771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74770 70515 73106 gene locus_tag LOCUS_74780 70515 73106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 73103 73546 gene locus_tag LOCUS_74790 73103 73546 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 protein_id gnl|my_center|LOCUS_74790 73554 74084 gene locus_tag LOCUS_74800 73554 74084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74800 74401 74865 gene locus_tag LOCUS_74810 74401 74865 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110393.1 protein_id gnl|my_center|LOCUS_74810 75725 74802 gene locus_tag LOCUS_74820 75725 74802 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224691.1 protein_id gnl|my_center|LOCUS_74820 76584 75802 gene locus_tag LOCUS_74830 76584 75802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224693.1 protein_id gnl|my_center|LOCUS_74830 77519 76581 gene locus_tag LOCUS_74840 77519 76581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224694.1 protein_id gnl|my_center|LOCUS_74840 77657 78283 gene locus_tag LOCUS_74850 77657 78283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74850 78319 80304 gene locus_tag LOCUS_74860 78319 80304 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227415.1 protein_id gnl|my_center|LOCUS_74860 84089 80442 gene locus_tag LOCUS_74870 84089 80442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74870 85889 84327 gene locus_tag LOCUS_74880 gene mptB 85889 84327 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_74880 86006 86707 gene locus_tag LOCUS_74890 86006 86707 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_74890 86704 88149 gene locus_tag LOCUS_74900 gene sufB 86704 88149 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224697.1 protein_id gnl|my_center|LOCUS_74900 88151 89326 gene locus_tag LOCUS_74910 gene sufD 88151 89326 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224698.1 protein_id gnl|my_center|LOCUS_74910 89428 89643 gene locus_tag LOCUS_74920 89428 89643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74920 89678 90451 gene locus_tag LOCUS_74930 gene sufC 89678 90451 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224699.1 protein_id gnl|my_center|LOCUS_74930 90498 91775 gene locus_tag LOCUS_74940 90498 91775 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_74940 91775 92218 gene locus_tag LOCUS_74950 91775 92218 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_74950 92215 92607 gene locus_tag LOCUS_74960 92215 92607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74960 93167 92754 gene locus_tag LOCUS_74970 gene hrp1 93167 92754 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_74970 94348 93233 gene locus_tag LOCUS_74980 94348 93233 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226146.1 protein_id gnl|my_center|LOCUS_74980 96065 94431 gene locus_tag LOCUS_74990 96065 94431 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224721.1 protein_id gnl|my_center|LOCUS_74990 97248 96175 gene locus_tag LOCUS_75000 97248 96175 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887447.1 protein_id gnl|my_center|LOCUS_75000 98223 97249 gene locus_tag LOCUS_75010 98223 97249 CDS product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027126.1 protein_id gnl|my_center|LOCUS_75010 >Feature sequence23 967 206 gene locus_tag LOCUS_75020 967 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75020 1187 2836 gene locus_tag LOCUS_75030 gene thiC 1187 2836 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 protein_id gnl|my_center|LOCUS_75030 2836 3639 gene locus_tag LOCUS_75040 gene thiD 2836 3639 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230296.1 protein_id gnl|my_center|LOCUS_75040 3662 4459 gene locus_tag LOCUS_75050 3662 4459 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115127.1 protein_id gnl|my_center|LOCUS_75050 4505 5062 gene locus_tag LOCUS_75060 4505 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75060 5554 5123 gene locus_tag LOCUS_75070 5554 5123 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230299.1 protein_id gnl|my_center|LOCUS_75070 6368 5613 gene locus_tag LOCUS_75080 6368 5613 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727197.1 protein_id gnl|my_center|LOCUS_75080 6570 6370 gene locus_tag LOCUS_75090 gene thiS 6570 6370 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230301.1 protein_id gnl|my_center|LOCUS_75090 7601 6567 gene locus_tag LOCUS_75100 gene thiO 7601 6567 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230302.1 protein_id gnl|my_center|LOCUS_75100 7743 8411 gene locus_tag LOCUS_75110 gene thiE 7743 8411 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230303.1 protein_id gnl|my_center|LOCUS_75110 8411 9166 gene locus_tag LOCUS_75120 8411 9166 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_75120 10426 9260 gene locus_tag LOCUS_75130 10426 9260 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_75130 10966 11901 gene locus_tag LOCUS_75140 10966 11901 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230305.1 protein_id gnl|my_center|LOCUS_75140 13383 11938 gene locus_tag LOCUS_75150 13383 11938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230306.1 protein_id gnl|my_center|LOCUS_75150 14730 13972 gene locus_tag LOCUS_75160 14730 13972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_75160 14972 16255 gene locus_tag LOCUS_75170 14972 16255 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226207.1 protein_id gnl|my_center|LOCUS_75170 16263 17252 gene locus_tag LOCUS_75180 16263 17252 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226208.1 protein_id gnl|my_center|LOCUS_75180 17249 18070 gene locus_tag LOCUS_75190 17249 18070 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_75190 18077 19525 gene locus_tag LOCUS_75200 18077 19525 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226210.1 protein_id gnl|my_center|LOCUS_75200 19546 20589 gene locus_tag LOCUS_75210 19546 20589 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230308.1 protein_id gnl|my_center|LOCUS_75210 21931 20732 gene locus_tag LOCUS_75220 gene nagA 21931 20732 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_75220 22126 22800 gene locus_tag LOCUS_75230 22126 22800 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_75230 23811 22894 gene locus_tag LOCUS_75240 23811 22894 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027041.1 protein_id gnl|my_center|LOCUS_75240 24773 23808 gene locus_tag LOCUS_75250 24773 23808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224954.1 protein_id gnl|my_center|LOCUS_75250 26227 24770 gene locus_tag LOCUS_75260 26227 24770 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223731.1 protein_id gnl|my_center|LOCUS_75260 27249 26227 gene locus_tag LOCUS_75270 27249 26227 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224952.1 protein_id gnl|my_center|LOCUS_75270 28027 27263 gene locus_tag LOCUS_75280 28027 27263 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223729.1 protein_id gnl|my_center|LOCUS_75280 29304 28024 gene locus_tag LOCUS_75290 29304 28024 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223728.1 protein_id gnl|my_center|LOCUS_75290 30239 29385 gene locus_tag LOCUS_75300 30239 29385 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_75300 30354 33545 gene locus_tag LOCUS_75310 30354 33545 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_75310 33615 34568 gene locus_tag LOCUS_75320 33615 34568 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_75320 35362 34727 gene locus_tag LOCUS_75330 35362 34727 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_75330 35495 36718 gene locus_tag LOCUS_75340 35495 36718 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223058.1 protein_id gnl|my_center|LOCUS_75340 36729 38057 gene locus_tag LOCUS_75350 36729 38057 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223059.1 protein_id gnl|my_center|LOCUS_75350 38062 39042 gene locus_tag LOCUS_75360 38062 39042 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455121.1 protein_id gnl|my_center|LOCUS_75360 39039 39899 gene locus_tag LOCUS_75370 39039 39899 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223061.1 protein_id gnl|my_center|LOCUS_75370 39896 41164 gene locus_tag LOCUS_75380 39896 41164 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223062.1 protein_id gnl|my_center|LOCUS_75380 41143 42162 gene locus_tag LOCUS_75390 41143 42162 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223063.1 protein_id gnl|my_center|LOCUS_75390 42361 43125 gene locus_tag LOCUS_75400 42361 43125 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_75400 43499 43200 gene locus_tag LOCUS_75410 43499 43200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75410 46368 43576 gene locus_tag LOCUS_75420 46368 43576 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230317.1 protein_id gnl|my_center|LOCUS_75420 46558 47598 gene locus_tag LOCUS_75430 46558 47598 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091813.1 protein_id gnl|my_center|LOCUS_75430 47884 48582 gene locus_tag LOCUS_75440 47884 48582 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223634.1 protein_id gnl|my_center|LOCUS_75440 48579 49976 gene locus_tag LOCUS_75450 48579 49976 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223635.1 protein_id gnl|my_center|LOCUS_75450 51022 49973 gene locus_tag LOCUS_75460 gene mgrA 51022 49973 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_75460 51192 52787 gene locus_tag LOCUS_75470 51192 52787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75470 53006 52931 gene locus_tag LOCUS_t00810 53006 52931 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 53289 54626 gene locus_tag LOCUS_75480 53289 54626 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230391.1 protein_id gnl|my_center|LOCUS_75480 54782 56218 gene locus_tag LOCUS_75490 54782 56218 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_75490 56274 58808 gene locus_tag LOCUS_75500 gene otsB 56274 58808 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230393.1 protein_id gnl|my_center|LOCUS_75500 60221 58857 gene locus_tag LOCUS_75510 gene radA 60221 58857 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 protein_id gnl|my_center|LOCUS_75510 61129 60368 gene locus_tag LOCUS_75520 61129 60368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092184.1 protein_id gnl|my_center|LOCUS_75520 61465 61953 gene locus_tag LOCUS_75530 61465 61953 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_75530 61986 62696 gene locus_tag LOCUS_75540 gene ispD 61986 62696 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731019.1 protein_id gnl|my_center|LOCUS_75540 62693 63166 gene locus_tag LOCUS_75550 gene ispF 62693 63166 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230402.1 protein_id gnl|my_center|LOCUS_75550 63223 63618 gene locus_tag LOCUS_75560 63223 63618 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230403.1 protein_id gnl|my_center|LOCUS_75560 63711 64331 gene locus_tag LOCUS_75570 63711 64331 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727393.1 protein_id gnl|my_center|LOCUS_75570 64413 65768 gene locus_tag LOCUS_75580 gene cysS 64413 65768 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284151.1 protein_id gnl|my_center|LOCUS_75580 65773 66741 gene locus_tag LOCUS_75590 gene rlmB 65773 66741 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_75590 66843 68264 gene locus_tag LOCUS_75600 66843 68264 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230408.1 protein_id gnl|my_center|LOCUS_75600 68627 69850 gene locus_tag LOCUS_75610 68627 69850 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229433.1 protein_id gnl|my_center|LOCUS_75610 70040 71530 gene locus_tag LOCUS_75620 70040 71530 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229434.1 protein_id gnl|my_center|LOCUS_75620 72425 71595 gene locus_tag LOCUS_75630 72425 71595 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230418.1 protein_id gnl|my_center|LOCUS_75630 73246 72425 gene locus_tag LOCUS_75640 73246 72425 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_75640 74226 73243 gene locus_tag LOCUS_75650 74226 73243 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230420.1 protein_id gnl|my_center|LOCUS_75650 75485 74385 gene locus_tag LOCUS_75660 gene msiK 75485 74385 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_75660 75689 76018 gene locus_tag LOCUS_75670 75689 76018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75670 76011 76415 gene locus_tag LOCUS_75680 76011 76415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75680 77348 76455 gene locus_tag LOCUS_75690 77348 76455 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_75690 78256 77348 gene locus_tag LOCUS_75700 78256 77348 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_75700 79590 78334 gene locus_tag LOCUS_75710 79590 78334 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_75710 79849 80898 gene locus_tag LOCUS_75720 79849 80898 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_75720 81006 82109 gene locus_tag LOCUS_75730 81006 82109 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284156.1 protein_id gnl|my_center|LOCUS_75730 82257 83249 gene locus_tag LOCUS_75740 82257 83249 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284494.1 protein_id gnl|my_center|LOCUS_75740 83934 83254 gene locus_tag LOCUS_75750 83934 83254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75750 84059 84550 gene locus_tag LOCUS_75760 84059 84550 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230422.1 protein_id gnl|my_center|LOCUS_75760 84589 85458 gene locus_tag LOCUS_75770 84589 85458 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230424.1 protein_id gnl|my_center|LOCUS_75770 85460 85957 gene locus_tag LOCUS_75780 85460 85957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75780 86652 85906 gene locus_tag LOCUS_75790 86652 85906 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230426.1 protein_id gnl|my_center|LOCUS_75790 86670 88145 gene locus_tag LOCUS_75800 86670 88145 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315510.1 protein_id gnl|my_center|LOCUS_75800 88185 88796 gene locus_tag LOCUS_75810 88185 88796 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029748.1 protein_id gnl|my_center|LOCUS_75810 88807 89115 gene locus_tag LOCUS_75820 gene mhuD 88807 89115 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065009.1 protein_id gnl|my_center|LOCUS_75820 89140 89937 gene locus_tag LOCUS_75830 89140 89937 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230430.1 protein_id gnl|my_center|LOCUS_75830 90883 89909 gene locus_tag LOCUS_75840 90883 89909 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_75840 90911 91534 gene locus_tag LOCUS_75850 gene pcp 90911 91534 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230445.1 protein_id gnl|my_center|LOCUS_75850 <92335 91600 gene locus_tag LOCUS_75860 <92335 91600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034284160.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence24 6644 294 gene locus_tag LOCUS_75870 6644 294 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030785.1 protein_id gnl|my_center|LOCUS_75870 15445 6647 gene locus_tag LOCUS_75880 15445 6647 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030786.1 protein_id gnl|my_center|LOCUS_75880 16209 16367 gene locus_tag LOCUS_75890 16209 16367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75890 16637 16942 gene locus_tag LOCUS_75900 16637 16942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75900 30365 16974 gene locus_tag LOCUS_75910 30365 16974 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030787.1 protein_id gnl|my_center|LOCUS_75910 30658 31053 gene locus_tag LOCUS_75920 30658 31053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75920 31079 32251 gene locus_tag LOCUS_75930 31079 32251 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_75930 32280 32687 gene locus_tag LOCUS_75940 32280 32687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75940 32983 34209 gene locus_tag LOCUS_75950 32983 34209 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_75950 34306 35916 gene locus_tag LOCUS_75960 34306 35916 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406598.1 protein_id gnl|my_center|LOCUS_75960 35913 37223 gene locus_tag LOCUS_75970 35913 37223 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111195.1 protein_id gnl|my_center|LOCUS_75970 38053 37316 gene locus_tag LOCUS_75980 38053 37316 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_75980 38915 38136 gene locus_tag LOCUS_75990 38915 38136 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532931.1 protein_id gnl|my_center|LOCUS_75990 40183 38948 gene locus_tag LOCUS_76000 40183 38948 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_76000 42050 40479 gene locus_tag LOCUS_76010 42050 40479 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030791.1 protein_id gnl|my_center|LOCUS_76010 44550 42289 gene locus_tag LOCUS_76020 44550 42289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76020 45492 46646 gene locus_tag LOCUS_76030 45492 46646 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014331.1 protein_id gnl|my_center|LOCUS_76030 48337 46718 gene locus_tag LOCUS_76040 48337 46718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_76040 48586 51894 gene locus_tag LOCUS_76050 48586 51894 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_76050 52108 53505 gene locus_tag LOCUS_76060 52108 53505 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111195.1 protein_id gnl|my_center|LOCUS_76060 53545 54159 gene locus_tag LOCUS_76070 53545 54159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76070 54156 55835 gene locus_tag LOCUS_76080 54156 55835 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463528.1 protein_id gnl|my_center|LOCUS_76080 55849 56706 gene locus_tag LOCUS_76090 55849 56706 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892028.1 protein_id gnl|my_center|LOCUS_76090 56703 58124 gene locus_tag LOCUS_76100 56703 58124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76100 58121 59257 gene locus_tag LOCUS_76110 58121 59257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76110 59254 59958 gene locus_tag LOCUS_76120 59254 59958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76120 59959 60582 gene locus_tag LOCUS_76130 59959 60582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76130 60579 61349 gene locus_tag LOCUS_76140 60579 61349 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229478.1 protein_id gnl|my_center|LOCUS_76140 61346 62173 gene locus_tag LOCUS_76150 61346 62173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76150 62309 63865 gene locus_tag LOCUS_76160 62309 63865 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030791.1 protein_id gnl|my_center|LOCUS_76160 64553 63894 gene locus_tag LOCUS_76170 64553 63894 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_76170 64680 65333 gene locus_tag LOCUS_76180 64680 65333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 protein_id gnl|my_center|LOCUS_76180 65556 65341 gene locus_tag LOCUS_76190 65556 65341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76190 66611 66033 gene locus_tag LOCUS_76200 66611 66033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76200 66556 66975 gene locus_tag LOCUS_76210 66556 66975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76210 67209 68510 gene locus_tag LOCUS_76220 67209 68510 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228763.1 protein_id gnl|my_center|LOCUS_76220 68517 69752 gene locus_tag LOCUS_76230 68517 69752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228761.1 protein_id gnl|my_center|LOCUS_76230 69836 71260 gene locus_tag LOCUS_76240 69836 71260 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978299.1 protein_id gnl|my_center|LOCUS_76240 71998 71324 gene locus_tag LOCUS_76250 71998 71324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76250 72161 72631 gene locus_tag LOCUS_76260 72161 72631 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222856.1 protein_id gnl|my_center|LOCUS_76260 72711 73823 gene locus_tag LOCUS_76270 72711 73823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76270 73888 74796 gene locus_tag LOCUS_76280 73888 74796 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222855.1 protein_id gnl|my_center|LOCUS_76280 74958 74797 gene locus_tag LOCUS_76290 74958 74797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76290 75302 76516 gene locus_tag LOCUS_76300 75302 76516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76300 77231 76665 gene locus_tag LOCUS_76310 77231 76665 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 protein_id gnl|my_center|LOCUS_76310 77440 77267 gene locus_tag LOCUS_76320 77440 77267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76320 78003 77629 gene locus_tag LOCUS_76330 78003 77629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76330 79051 78206 gene locus_tag LOCUS_76340 79051 78206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76340 79153 80565 gene locus_tag LOCUS_76350 79153 80565 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485197.1 protein_id gnl|my_center|LOCUS_76350 81160 80717 gene locus_tag LOCUS_76360 81160 80717 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_76360 81735 81157 gene locus_tag LOCUS_76370 81735 81157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76370 82806 81796 gene locus_tag LOCUS_76380 82806 81796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76380 83205 82861 gene locus_tag LOCUS_76390 83205 82861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76390 84738 83233 gene locus_tag LOCUS_76400 84738 83233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76400 85067 84762 gene locus_tag LOCUS_76410 85067 84762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76410 85474 85064 gene locus_tag LOCUS_76420 85474 85064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76420 86625 86537 gene locus_tag LOCUS_t00820 86625 86537 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 87552 86827 gene locus_tag LOCUS_76430 87552 86827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76430 87945 87598 gene locus_tag LOCUS_76440 87945 87598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76440 87914 88444 gene locus_tag LOCUS_76450 87914 88444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76450 >Feature sequence25 336 1343 gene locus_tag LOCUS_76460 336 1343 CDS product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 protein_id gnl|my_center|LOCUS_76460 2020 1436 gene locus_tag LOCUS_76470 2020 1436 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_76470 3584 2367 gene locus_tag LOCUS_76480 3584 2367 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484476.1 protein_id gnl|my_center|LOCUS_76480 3721 5001 gene locus_tag LOCUS_76490 3721 5001 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 protein_id gnl|my_center|LOCUS_76490 5029 5991 gene locus_tag LOCUS_76500 5029 5991 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 protein_id gnl|my_center|LOCUS_76500 5978 6880 gene locus_tag LOCUS_76510 5978 6880 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 protein_id gnl|my_center|LOCUS_76510 6900 8627 gene locus_tag LOCUS_76520 6900 8627 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 protein_id gnl|my_center|LOCUS_76520 8680 10977 gene locus_tag LOCUS_76530 8680 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76530 11189 11896 gene locus_tag LOCUS_76540 11189 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76540 11964 12377 gene locus_tag LOCUS_76550 11964 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76550 12374 12796 gene locus_tag LOCUS_76560 12374 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76560 13055 13273 gene locus_tag LOCUS_76570 13055 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76570 13486 14478 gene locus_tag LOCUS_76580 13486 14478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_76580 15240 14881 gene locus_tag LOCUS_76590 gene bldG 15240 14881 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_76590 16643 15237 gene locus_tag LOCUS_76600 16643 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76600 16982 17197 gene locus_tag LOCUS_76610 16982 17197 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 protein_id gnl|my_center|LOCUS_76610 17194 17502 gene locus_tag LOCUS_76620 17194 17502 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978015.1 protein_id gnl|my_center|LOCUS_76620 18930 17644 gene locus_tag LOCUS_76630 18930 17644 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_76630 19240 20037 gene locus_tag LOCUS_76640 19240 20037 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_76640 21039 20176 gene locus_tag LOCUS_76650 21039 20176 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848494.1 protein_id gnl|my_center|LOCUS_76650 21098 21496 gene locus_tag LOCUS_76660 21098 21496 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729797.1 protein_id gnl|my_center|LOCUS_76660 22735 21761 gene locus_tag LOCUS_76670 22735 21761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76670 24292 22766 gene locus_tag LOCUS_76680 24292 22766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76680 28282 24359 gene locus_tag LOCUS_76690 28282 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76690 29439 28369 gene locus_tag LOCUS_76700 29439 28369 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972284.1 protein_id gnl|my_center|LOCUS_76700 30203 30457 gene locus_tag LOCUS_76710 30203 30457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76710 31219 30599 gene locus_tag LOCUS_76720 31219 30599 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166534399.1 protein_id gnl|my_center|LOCUS_76720 31539 31216 gene locus_tag LOCUS_76730 31539 31216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76730 31981 33726 gene locus_tag LOCUS_76740 31981 33726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76740 33726 34832 gene locus_tag LOCUS_76750 33726 34832 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776255.1 protein_id gnl|my_center|LOCUS_76750 38958 35194 gene locus_tag LOCUS_76760 38958 35194 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030935.1 protein_id gnl|my_center|LOCUS_76760 40511 39057 gene locus_tag LOCUS_76770 40511 39057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76770 40900 41967 gene locus_tag LOCUS_76780 40900 41967 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639907.1 protein_id gnl|my_center|LOCUS_76780 42767 42072 gene locus_tag LOCUS_76790 42767 42072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76790 43232 44680 gene locus_tag LOCUS_76800 43232 44680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76800 46208 44802 gene locus_tag LOCUS_76810 46208 44802 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468327.1 protein_id gnl|my_center|LOCUS_76810 46629 49445 gene locus_tag LOCUS_76820 46629 49445 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467010.1 protein_id gnl|my_center|LOCUS_76820 49555 50961 gene locus_tag LOCUS_76830 49555 50961 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468327.1 protein_id gnl|my_center|LOCUS_76830 53962 51125 gene locus_tag LOCUS_76840 53962 51125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76840 54129 54473 gene locus_tag LOCUS_76850 54129 54473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76850 54498 54659 gene locus_tag LOCUS_76860 54498 54659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76860 54602 54805 gene locus_tag LOCUS_76870 54602 54805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76870 54882 57338 gene locus_tag LOCUS_76880 54882 57338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76880 57335 58411 gene locus_tag LOCUS_76890 57335 58411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76890 58408 60120 gene locus_tag LOCUS_76900 58408 60120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76900 60117 61826 gene locus_tag LOCUS_76910 60117 61826 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075677560.1 protein_id gnl|my_center|LOCUS_76910 61823 62911 gene locus_tag LOCUS_76920 61823 62911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76920 62913 64562 gene locus_tag LOCUS_76930 62913 64562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76930 64606 65739 gene locus_tag LOCUS_76940 64606 65739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76940 65954 66772 gene locus_tag LOCUS_76950 65954 66772 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_76950 66785 67447 gene locus_tag LOCUS_76960 66785 67447 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228368.1 protein_id gnl|my_center|LOCUS_76960 68507 67602 gene locus_tag LOCUS_76970 68507 67602 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 protein_id gnl|my_center|LOCUS_76970 68578 69333 gene locus_tag LOCUS_76980 68578 69333 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226435.1 protein_id gnl|my_center|LOCUS_76980 69509 72217 gene locus_tag LOCUS_76990 69509 72217 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 protein_id gnl|my_center|LOCUS_76990 75690 72271 gene locus_tag LOCUS_77000 75690 72271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77000 75895 76287 gene locus_tag LOCUS_77010 75895 76287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77010 79286 76449 gene locus_tag LOCUS_77020 79286 76449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77020 80345 79443 gene locus_tag LOCUS_77030 80345 79443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_77030 80460 81425 gene locus_tag LOCUS_77040 80460 81425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77040 81951 81679 gene locus_tag LOCUS_77050 81951 81679 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_77050 83222 82167 gene locus_tag LOCUS_77060 83222 82167 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230685.1 protein_id gnl|my_center|LOCUS_77060 84494 83553 gene locus_tag LOCUS_77070 84494 83553 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228266.1 protein_id gnl|my_center|LOCUS_77070 85258 84491 gene locus_tag LOCUS_77080 85258 84491 CDS product MEDS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229164.1 protein_id gnl|my_center|LOCUS_77080 >Feature sequence26 1040 222 gene locus_tag LOCUS_77090 1040 222 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975849.1 protein_id gnl|my_center|LOCUS_77090 1144 3111 gene locus_tag LOCUS_77100 1144 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77100 7324 3116 gene locus_tag LOCUS_77110 7324 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77110 7451 7837 gene locus_tag LOCUS_77120 7451 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77120 7843 8550 gene locus_tag LOCUS_77130 7843 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77130 8547 9665 gene locus_tag LOCUS_77140 8547 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77140 9662 13405 gene locus_tag LOCUS_77150 9662 13405 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_77150 14660 13413 gene locus_tag LOCUS_77160 14660 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77160 17047 14657 gene locus_tag LOCUS_77170 17047 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77170 18165 17044 gene locus_tag LOCUS_77180 18165 17044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77180 20543 18162 gene locus_tag LOCUS_77190 20543 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77190 20717 21088 gene locus_tag LOCUS_77200 20717 21088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77200 22596 21058 gene locus_tag LOCUS_77210 22596 21058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77210 23687 22593 gene locus_tag LOCUS_77220 23687 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77220 25354 23684 gene locus_tag LOCUS_77230 25354 23684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77230 26898 25351 gene locus_tag LOCUS_77240 26898 25351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77240 27968 26895 gene locus_tag LOCUS_77250 27968 26895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77250 30367 27965 gene locus_tag LOCUS_77260 30367 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77260 30601 30431 gene locus_tag LOCUS_77270 30601 30431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77270 30801 30592 gene locus_tag LOCUS_77280 30801 30592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77280 30937 31722 gene locus_tag LOCUS_77290 30937 31722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77290 32933 31719 gene locus_tag LOCUS_77300 32933 31719 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639907.1 protein_id gnl|my_center|LOCUS_77300 33146 34462 gene locus_tag LOCUS_77310 33146 34462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77310 35363 34530 gene locus_tag LOCUS_77320 35363 34530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77320 35412 35579 gene locus_tag LOCUS_77330 35412 35579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77330 38341 35576 gene locus_tag LOCUS_77340 38341 35576 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003078144.1 protein_id gnl|my_center|LOCUS_77340 39370 38519 gene locus_tag LOCUS_77350 39370 38519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77350 39487 40371 gene locus_tag LOCUS_77360 39487 40371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77360 40505 42742 gene locus_tag LOCUS_77370 40505 42742 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_77370 42764 43990 gene locus_tag LOCUS_77380 42764 43990 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939838.1 protein_id gnl|my_center|LOCUS_77380 44164 47049 gene locus_tag LOCUS_77390 44164 47049 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223918.1 protein_id gnl|my_center|LOCUS_77390 47338 47523 gene locus_tag LOCUS_77400 47338 47523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77400 47935 49056 gene locus_tag LOCUS_77410 47935 49056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77410 49281 50552 gene locus_tag LOCUS_77420 49281 50552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77420 50820 51314 gene locus_tag LOCUS_77430 50820 51314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77430 51381 51815 gene locus_tag LOCUS_77440 51381 51815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77440 51908 53647 gene locus_tag LOCUS_77450 51908 53647 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_77450 53674 55125 gene locus_tag LOCUS_77460 53674 55125 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189229593.1 protein_id gnl|my_center|LOCUS_77460 55142 55468 gene locus_tag LOCUS_77470 55142 55468 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030169.1 protein_id gnl|my_center|LOCUS_77470 55465 56736 gene locus_tag LOCUS_77480 55465 56736 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973891.1 protein_id gnl|my_center|LOCUS_77480 56733 57947 gene locus_tag LOCUS_77490 56733 57947 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030048.1 protein_id gnl|my_center|LOCUS_77490 57969 58232 gene locus_tag LOCUS_77500 57969 58232 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 protein_id gnl|my_center|LOCUS_77500 58259 59041 gene locus_tag LOCUS_77510 58259 59041 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973892.1 protein_id gnl|my_center|LOCUS_77510 59067 60011 gene locus_tag LOCUS_77520 59067 60011 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030049.1 protein_id gnl|my_center|LOCUS_77520 60016 61959 gene locus_tag LOCUS_77530 60016 61959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77530 61973 63544 gene locus_tag LOCUS_77540 61973 63544 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_77540 63541 63807 gene locus_tag LOCUS_77550 63541 63807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77550 63823 64806 gene locus_tag LOCUS_77560 63823 64806 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_77560 64799 65980 gene locus_tag LOCUS_77570 64799 65980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77570 65977 66561 gene locus_tag LOCUS_77580 65977 66561 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_77580 66573 67421 gene locus_tag LOCUS_77590 66573 67421 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831427.1 protein_id gnl|my_center|LOCUS_77590 67488 68300 gene locus_tag LOCUS_77600 67488 68300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77600 68381 69181 gene locus_tag LOCUS_77610 68381 69181 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_77610 69237 70304 gene locus_tag LOCUS_77620 69237 70304 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_77620 70578 72035 gene locus_tag LOCUS_77630 70578 72035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77630 >Feature sequence27 1807 533 gene locus_tag LOCUS_77640 gene tyrS 1807 533 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227826.1 protein_id gnl|my_center|LOCUS_77640 1901 2359 gene locus_tag LOCUS_77650 1901 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77650 2495 2980 gene locus_tag LOCUS_77660 2495 2980 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227926.1 protein_id gnl|my_center|LOCUS_77660 3626 2997 gene locus_tag LOCUS_77670 3626 2997 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227827.1 protein_id gnl|my_center|LOCUS_77670 5001 3610 gene locus_tag LOCUS_77680 gene argH 5001 3610 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227831.1 protein_id gnl|my_center|LOCUS_77680 5931 5014 gene locus_tag LOCUS_77690 5931 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77690 6340 5924 gene locus_tag LOCUS_77700 6340 5924 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227833.1 protein_id gnl|my_center|LOCUS_77700 7353 6427 gene locus_tag LOCUS_77710 gene argF 7353 6427 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227834.1 protein_id gnl|my_center|LOCUS_77710 8540 7353 gene locus_tag LOCUS_77720 8540 7353 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227835.1 protein_id gnl|my_center|LOCUS_77720 9424 8537 gene locus_tag LOCUS_77730 gene argB 9424 8537 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_77730 10662 9421 gene locus_tag LOCUS_77740 gene argJ 10662 9421 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227837.1 protein_id gnl|my_center|LOCUS_77740 11675 10659 gene locus_tag LOCUS_77750 gene argC 11675 10659 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227838.1 protein_id gnl|my_center|LOCUS_77750 12350 12676 gene locus_tag LOCUS_77760 12350 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77760 13836 12643 gene locus_tag LOCUS_77770 13836 12643 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_77770 13952 14575 gene locus_tag LOCUS_77780 13952 14575 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230405.1 protein_id gnl|my_center|LOCUS_77780 15988 14576 gene locus_tag LOCUS_77790 gene sthA 15988 14576 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_77790 16030 16701 gene locus_tag LOCUS_77800 16030 16701 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_77800 17199 16708 gene locus_tag LOCUS_77810 17199 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226299.1 protein_id gnl|my_center|LOCUS_77810 19984 17507 gene locus_tag LOCUS_77820 gene pheT 19984 17507 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093159782.1 protein_id gnl|my_center|LOCUS_77820 21055 19988 gene locus_tag LOCUS_77830 gene pheS 21055 19988 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_77830 21399 23153 gene locus_tag LOCUS_77840 21399 23153 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027769.1 protein_id gnl|my_center|LOCUS_77840 23150 25954 gene locus_tag LOCUS_77850 23150 25954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77850 27207 26542 gene locus_tag LOCUS_77860 27207 26542 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084642168.1 protein_id gnl|my_center|LOCUS_77860 27776 27387 gene locus_tag LOCUS_77870 gene rplT 27776 27387 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058700.1 protein_id gnl|my_center|LOCUS_77870 28142 27903 gene locus_tag LOCUS_77880 gene rpmI 28142 27903 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_77880 28788 28171 gene locus_tag LOCUS_77890 gene infC 28788 28171 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227848.1 protein_id gnl|my_center|LOCUS_77890 29057 29407 gene locus_tag LOCUS_77900 29057 29407 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790921.1 protein_id gnl|my_center|LOCUS_77900 30176 29580 gene locus_tag LOCUS_77910 30176 29580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226179.1 protein_id gnl|my_center|LOCUS_77910 30274 32565 gene locus_tag LOCUS_77920 30274 32565 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831565.1 protein_id gnl|my_center|LOCUS_77920 33117 32734 gene locus_tag LOCUS_77930 33117 32734 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227852.1 protein_id gnl|my_center|LOCUS_77930 33898 33149 gene locus_tag LOCUS_77940 33898 33149 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227853.1 protein_id gnl|my_center|LOCUS_77940 34863 33895 gene locus_tag LOCUS_77950 34863 33895 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227854.1 protein_id gnl|my_center|LOCUS_77950 34972 36225 gene locus_tag LOCUS_77960 34972 36225 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227855.1 protein_id gnl|my_center|LOCUS_77960 36236 37825 gene locus_tag LOCUS_77970 36236 37825 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227856.1 protein_id gnl|my_center|LOCUS_77970 37822 39216 gene locus_tag LOCUS_77980 37822 39216 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227857.1 protein_id gnl|my_center|LOCUS_77980 40086 39430 gene locus_tag LOCUS_77990 40086 39430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77990 40362 40087 gene locus_tag LOCUS_78000 40362 40087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78000 43293 40420 gene locus_tag LOCUS_78010 gene uvrA 43293 40420 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_78010 45355 44171 gene locus_tag LOCUS_78020 45355 44171 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227875.1 protein_id gnl|my_center|LOCUS_78020 45472 46149 gene locus_tag LOCUS_78030 45472 46149 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227876.1 protein_id gnl|my_center|LOCUS_78030 46855 46283 gene locus_tag LOCUS_78040 46855 46283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78040 47552 46905 gene locus_tag LOCUS_78050 47552 46905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78050 48433 47954 gene locus_tag LOCUS_78060 48433 47954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78060 49048 48449 gene locus_tag LOCUS_78070 49048 48449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78070 49870 49091 gene locus_tag LOCUS_78080 49870 49091 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043780833.1 protein_id gnl|my_center|LOCUS_78080 49918 50445 gene locus_tag LOCUS_78090 gene rnhA 49918 50445 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227882.1 protein_id gnl|my_center|LOCUS_78090 50895 50401 gene locus_tag LOCUS_78100 50895 50401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78100 51299 50910 gene locus_tag LOCUS_78110 51299 50910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78110 52012 51407 gene locus_tag LOCUS_78120 52012 51407 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_78120 53067 52009 gene locus_tag LOCUS_78130 53067 52009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78130 53509 53090 gene locus_tag LOCUS_78140 53509 53090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78140 54700 53567 gene locus_tag LOCUS_78150 54700 53567 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 protein_id gnl|my_center|LOCUS_78150 54844 55167 gene locus_tag LOCUS_78160 54844 55167 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_78160 55167 56018 gene locus_tag LOCUS_78170 55167 56018 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222862.1 protein_id gnl|my_center|LOCUS_78170 56848 56006 gene locus_tag LOCUS_78180 56848 56006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78180 56971 57687 gene locus_tag LOCUS_78190 56971 57687 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328090.1 protein_id gnl|my_center|LOCUS_78190 57844 57719 gene locus_tag LOCUS_78200 57844 57719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78200 57866 58015 gene locus_tag LOCUS_78210 57866 58015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78210 58371 57967 gene locus_tag LOCUS_78220 58371 57967 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_78220 58420 59217 gene locus_tag LOCUS_78230 58420 59217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78230 60563 59178 gene locus_tag LOCUS_78240 60563 59178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229299.1 protein_id gnl|my_center|LOCUS_78240 60658 61344 gene locus_tag LOCUS_78250 60658 61344 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225193.1 protein_id gnl|my_center|LOCUS_78250 61904 61347 gene locus_tag LOCUS_78260 61904 61347 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220205807.1 protein_id gnl|my_center|LOCUS_78260 62938 61901 gene locus_tag LOCUS_78270 62938 61901 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227082.1 protein_id gnl|my_center|LOCUS_78270 63113 63559 gene locus_tag LOCUS_78280 63113 63559 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229804.1 protein_id gnl|my_center|LOCUS_78280 63579 63743 gene locus_tag LOCUS_78290 63579 63743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78290 63782 63964 gene locus_tag LOCUS_78300 63782 63964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78300 63983 64435 gene locus_tag LOCUS_78310 63983 64435 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225379.1 protein_id gnl|my_center|LOCUS_78310 64750 64520 gene locus_tag LOCUS_78320 64750 64520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78320 64670 64855 gene locus_tag LOCUS_78330 64670 64855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78330 64861 65613 gene locus_tag LOCUS_78340 64861 65613 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_78340 67506 65623 gene locus_tag LOCUS_78350 67506 65623 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_78350 67724 68098 gene locus_tag LOCUS_78360 67724 68098 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_78360 68230 68793 gene locus_tag LOCUS_78370 68230 68793 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467736.1 protein_id gnl|my_center|LOCUS_78370 68815 69117 gene locus_tag LOCUS_78380 68815 69117 CDS product type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229831.1 protein_id gnl|my_center|LOCUS_78380 >Feature sequence28 1168 200 gene locus_tag LOCUS_78390 1168 200 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204065824.1 protein_id gnl|my_center|LOCUS_78390 1312 1689 gene locus_tag LOCUS_78400 1312 1689 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896562.1 protein_id gnl|my_center|LOCUS_78400 2074 2943 gene locus_tag LOCUS_78410 2074 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78410 3306 2998 gene locus_tag LOCUS_78420 3306 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78420 3668 3303 gene locus_tag LOCUS_78430 3668 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78430 3958 3668 gene locus_tag LOCUS_78440 3958 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78440 3911 4252 gene locus_tag LOCUS_78450 3911 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78450 4513 5460 gene locus_tag LOCUS_78460 4513 5460 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_78460 5532 7766 gene locus_tag LOCUS_78470 5532 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78470 7801 9915 gene locus_tag LOCUS_78480 7801 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78480 9929 11233 gene locus_tag LOCUS_78490 9929 11233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78490 11301 12251 gene locus_tag LOCUS_78500 11301 12251 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_78500 12248 13093 gene locus_tag LOCUS_78510 12248 13093 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227577.1 protein_id gnl|my_center|LOCUS_78510 13283 14224 gene locus_tag LOCUS_78520 13283 14224 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968606.1 protein_id gnl|my_center|LOCUS_78520 14281 16176 gene locus_tag LOCUS_78530 14281 16176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78530 17338 16250 gene locus_tag LOCUS_78540 17338 16250 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976047.1 protein_id gnl|my_center|LOCUS_78540 17226 17549 gene locus_tag LOCUS_78550 17226 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78550 17720 20335 gene locus_tag LOCUS_78560 17720 20335 CDS product Tat pathway signal sequence domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207739.1 protein_id gnl|my_center|LOCUS_78560 22724 20427 gene locus_tag LOCUS_78570 gene rhgW 22724 20427 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_78570 23364 23080 gene locus_tag LOCUS_78580 23364 23080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78580 23621 23313 gene locus_tag LOCUS_78590 23621 23313 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_78590 23860 24399 gene locus_tag LOCUS_78600 23860 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78600 24413 24739 gene locus_tag LOCUS_78610 24413 24739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78610 24736 25875 gene locus_tag LOCUS_78620 24736 25875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78620 25872 26552 gene locus_tag LOCUS_78630 25872 26552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78630 26562 27194 gene locus_tag LOCUS_78640 26562 27194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78640 28433 27243 gene locus_tag LOCUS_78650 28433 27243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227969.1 protein_id gnl|my_center|LOCUS_78650 28763 28509 gene locus_tag LOCUS_78660 28763 28509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78660 29505 28849 gene locus_tag LOCUS_78670 29505 28849 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223649.1 protein_id gnl|my_center|LOCUS_78670 30379 29513 gene locus_tag LOCUS_78680 30379 29513 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971279.1 protein_id gnl|my_center|LOCUS_78680 31961 30519 gene locus_tag LOCUS_78690 31961 30519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78690 32622 32041 gene locus_tag LOCUS_78700 32622 32041 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895416.1 protein_id gnl|my_center|LOCUS_78700 33562 32666 gene locus_tag LOCUS_78710 33562 32666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78710 34547 33747 gene locus_tag LOCUS_78720 34547 33747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78720 34659 35093 gene locus_tag LOCUS_78730 34659 35093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_78730 35255 36658 gene locus_tag LOCUS_78740 35255 36658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78740 37437 36796 gene locus_tag LOCUS_78750 37437 36796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78750 37488 37928 gene locus_tag LOCUS_78760 37488 37928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78760 38485 37934 gene locus_tag LOCUS_78770 gene ssuE 38485 37934 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808029.1 protein_id gnl|my_center|LOCUS_78770 39435 38518 gene locus_tag LOCUS_78780 39435 38518 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729384.1 protein_id gnl|my_center|LOCUS_78780 39859 40866 gene locus_tag LOCUS_78790 39859 40866 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226154.1 protein_id gnl|my_center|LOCUS_78790 40863 41684 gene locus_tag LOCUS_78800 40863 41684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226153.1 protein_id gnl|my_center|LOCUS_78800 41681 42535 gene locus_tag LOCUS_78810 41681 42535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_78810 42561 44132 gene locus_tag LOCUS_78820 42561 44132 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730601.1 protein_id gnl|my_center|LOCUS_78820 44129 44482 gene locus_tag LOCUS_78830 44129 44482 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730602.1 protein_id gnl|my_center|LOCUS_78830 44479 45654 gene locus_tag LOCUS_78840 44479 45654 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226155.1 protein_id gnl|my_center|LOCUS_78840 45657 46988 gene locus_tag LOCUS_78850 45657 46988 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727463.1 protein_id gnl|my_center|LOCUS_78850 47390 47085 gene locus_tag LOCUS_78860 47390 47085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225373.1 protein_id gnl|my_center|LOCUS_78860 47701 47456 gene locus_tag LOCUS_78870 47701 47456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78870 48586 48089 gene locus_tag LOCUS_78880 48586 48089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78880 50839 49073 gene locus_tag LOCUS_78890 50839 49073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78890 51890 51045 gene locus_tag LOCUS_78900 51890 51045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78900 >Feature sequence29 921 163 gene locus_tag LOCUS_78910 921 163 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_78910 1508 918 gene locus_tag LOCUS_78920 gene sigK 1508 918 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466900.1 protein_id gnl|my_center|LOCUS_78920 1608 2711 gene locus_tag LOCUS_78930 1608 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78930 2802 2954 gene locus_tag LOCUS_78940 2802 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78940 3195 2929 gene locus_tag LOCUS_78950 3195 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78950 3344 4690 gene locus_tag LOCUS_78960 3344 4690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_78960 5900 4701 gene locus_tag LOCUS_78970 5900 4701 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_78970 6056 6793 gene locus_tag LOCUS_78980 6056 6793 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_78980 8018 6801 gene locus_tag LOCUS_78990 8018 6801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_78990 9128 8061 gene locus_tag LOCUS_79000 9128 8061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_79000 10243 9125 gene locus_tag LOCUS_79010 10243 9125 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_79010 10700 10356 gene locus_tag LOCUS_79020 10700 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79020 10879 11958 gene locus_tag LOCUS_79030 10879 11958 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027501.1 protein_id gnl|my_center|LOCUS_79030 11955 13160 gene locus_tag LOCUS_79040 11955 13160 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027502.1 protein_id gnl|my_center|LOCUS_79040 14004 13279 gene locus_tag LOCUS_79050 14004 13279 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144585984.1 protein_id gnl|my_center|LOCUS_79050 14067 14621 gene locus_tag LOCUS_79060 14067 14621 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224856.1 protein_id gnl|my_center|LOCUS_79060 14921 14670 gene locus_tag LOCUS_79070 14921 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79070 15860 15030 gene locus_tag LOCUS_79080 15860 15030 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_79080 16747 15923 gene locus_tag LOCUS_79090 16747 15923 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_79090 17005 17844 gene locus_tag LOCUS_79100 17005 17844 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_79100 17853 18311 gene locus_tag LOCUS_79110 17853 18311 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_79110 18461 18994 gene locus_tag LOCUS_79120 18461 18994 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026879.1 protein_id gnl|my_center|LOCUS_79120 19146 20618 gene locus_tag LOCUS_79130 19146 20618 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110223.1 protein_id gnl|my_center|LOCUS_79130 20612 21979 gene locus_tag LOCUS_79140 20612 21979 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_79140 22852 21884 gene locus_tag LOCUS_79150 gene mmuM 22852 21884 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101343.1 protein_id gnl|my_center|LOCUS_79150 24003 22849 gene locus_tag LOCUS_79160 24003 22849 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_79160 24878 24012 gene locus_tag LOCUS_79170 24878 24012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79170 26167 24905 gene locus_tag LOCUS_79180 26167 24905 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_79180 26880 26164 gene locus_tag LOCUS_79190 26880 26164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79190 26961 28415 gene locus_tag LOCUS_79200 26961 28415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_79200 28412 29134 gene locus_tag LOCUS_79210 28412 29134 CDS product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530131.1 protein_id gnl|my_center|LOCUS_79210 29187 30482 gene locus_tag LOCUS_79220 29187 30482 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478185.1 protein_id gnl|my_center|LOCUS_79220 30500 32212 gene locus_tag LOCUS_79230 30500 32212 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729909.1 protein_id gnl|my_center|LOCUS_79230 32209 32850 gene locus_tag LOCUS_79240 32209 32850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79240 34167 32857 gene locus_tag LOCUS_79250 34167 32857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79250 34789 34151 gene locus_tag LOCUS_79260 34789 34151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79260 35688 34789 gene locus_tag LOCUS_79270 35688 34789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79270 36972 35770 gene locus_tag LOCUS_79280 36972 35770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79280 37163 37450 gene locus_tag LOCUS_79290 37163 37450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79290 37798 37370 gene locus_tag LOCUS_79300 37798 37370 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_79300 43142 37791 gene locus_tag LOCUS_79310 43142 37791 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831510.1 protein_id gnl|my_center|LOCUS_79310 44086 43139 gene locus_tag LOCUS_79320 44086 43139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228636.1 protein_id gnl|my_center|LOCUS_79320 45975 44083 gene locus_tag LOCUS_79330 45975 44083 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_79330 46876 45995 gene locus_tag LOCUS_79340 46876 45995 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086861803.1 protein_id gnl|my_center|LOCUS_79340 48916 47159 gene locus_tag LOCUS_79350 48916 47159 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803733.1 protein_id gnl|my_center|LOCUS_79350 49441 48956 gene locus_tag LOCUS_79360 49441 48956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79360 50940 49546 gene locus_tag LOCUS_79370 50940 49546 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284065.1 protein_id gnl|my_center|LOCUS_79370 >Feature sequence30 665 396 gene locus_tag LOCUS_79380 665 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79380 913 2130 gene locus_tag LOCUS_79390 913 2130 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227683.1 protein_id gnl|my_center|LOCUS_79390 2676 2185 gene locus_tag LOCUS_79400 2676 2185 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229580.1 protein_id gnl|my_center|LOCUS_79400 3318 2761 gene locus_tag LOCUS_79410 3318 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79410 3439 4461 gene locus_tag LOCUS_79420 3439 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79420 4458 6137 gene locus_tag LOCUS_79430 4458 6137 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551762.1 protein_id gnl|my_center|LOCUS_79430 6130 6375 gene locus_tag LOCUS_79440 6130 6375 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080896.1 protein_id gnl|my_center|LOCUS_79440 6642 7478 gene locus_tag LOCUS_79450 6642 7478 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_79450 7471 8034 gene locus_tag LOCUS_79460 7471 8034 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222749.1 protein_id gnl|my_center|LOCUS_79460 9145 8072 gene locus_tag LOCUS_79470 gene rhaS 9145 8072 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 protein_id gnl|my_center|LOCUS_79470 10227 9193 gene locus_tag LOCUS_79480 10227 9193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 protein_id gnl|my_center|LOCUS_79480 11254 10217 gene locus_tag LOCUS_79490 11254 10217 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_79490 12750 11251 gene locus_tag LOCUS_79500 12750 11251 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_79500 15296 12903 gene locus_tag LOCUS_79510 15296 12903 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225834.1 protein_id gnl|my_center|LOCUS_79510 15624 16127 gene locus_tag LOCUS_79520 15624 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79520 16127 17113 gene locus_tag LOCUS_79530 16127 17113 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727119.1 protein_id gnl|my_center|LOCUS_79530 17110 19194 gene locus_tag LOCUS_79540 17110 19194 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_79540 19478 19200 gene locus_tag LOCUS_79550 19478 19200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79550 19699 19460 gene locus_tag LOCUS_79560 19699 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79560 19635 20285 gene locus_tag LOCUS_79570 19635 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79570 22001 20304 gene locus_tag LOCUS_79580 22001 20304 CDS product cholesterol oxidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113002.1 protein_id gnl|my_center|LOCUS_79580 22147 23250 gene locus_tag LOCUS_79590 22147 23250 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_79590 23372 25636 gene locus_tag LOCUS_79600 23372 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79600 26848 25649 gene locus_tag LOCUS_79610 26848 25649 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_79610 28019 27276 gene locus_tag LOCUS_79620 28019 27276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79620 28728 28438 gene locus_tag LOCUS_79630 28728 28438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79630 29912 28770 gene locus_tag LOCUS_79640 29912 28770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79640 31096 30482 gene locus_tag LOCUS_79650 31096 30482 CDS product DUF1062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973073.1 protein_id gnl|my_center|LOCUS_79650 35710 31448 gene locus_tag LOCUS_79660 35710 31448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79660 35994 39146 gene locus_tag LOCUS_79670 35994 39146 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_79670 41895 39184 gene locus_tag LOCUS_79680 41895 39184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79680 >Feature sequence31 1724 339 gene locus_tag LOCUS_79690 1724 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79690 2046 3392 gene locus_tag LOCUS_79700 2046 3392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224963.1 protein_id gnl|my_center|LOCUS_79700 4518 3382 gene locus_tag LOCUS_79710 4518 3382 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226073.1 protein_id gnl|my_center|LOCUS_79710 4905 4630 gene locus_tag LOCUS_79720 4905 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227717.1 protein_id gnl|my_center|LOCUS_79720 10089 4939 gene locus_tag LOCUS_79730 10089 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79730 9988 10392 gene locus_tag LOCUS_79740 9988 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79740 10403 10906 gene locus_tag LOCUS_79750 10403 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484326.1 protein_id gnl|my_center|LOCUS_79750 11170 12561 gene locus_tag LOCUS_79760 11170 12561 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_79760 12548 13432 gene locus_tag LOCUS_79770 12548 13432 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_79770 13429 14250 gene locus_tag LOCUS_79780 13429 14250 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973570.1 protein_id gnl|my_center|LOCUS_79780 14250 15305 gene locus_tag LOCUS_79790 14250 15305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_79790 16017 15418 gene locus_tag LOCUS_79800 16017 15418 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228168.1 protein_id gnl|my_center|LOCUS_79800 16850 16014 gene locus_tag LOCUS_79810 16850 16014 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228169.1 protein_id gnl|my_center|LOCUS_79810 19831 17312 gene locus_tag LOCUS_79820 19831 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79820 20017 20799 gene locus_tag LOCUS_79830 20017 20799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79830 20958 21293 gene locus_tag LOCUS_79840 20958 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79840 21888 21298 gene locus_tag LOCUS_79850 21888 21298 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_79850 22511 21885 gene locus_tag LOCUS_79860 22511 21885 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878099.1 protein_id gnl|my_center|LOCUS_79860 23426 22596 gene locus_tag LOCUS_79870 23426 22596 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530928.1 protein_id gnl|my_center|LOCUS_79870 23537 24136 gene locus_tag LOCUS_79880 23537 24136 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_79880 24328 26007 gene locus_tag LOCUS_79890 24328 26007 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014351.1 protein_id gnl|my_center|LOCUS_79890 26187 29369 gene locus_tag LOCUS_79900 26187 29369 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_79900 30170 29382 gene locus_tag LOCUS_79910 30170 29382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_79910 31162 30167 gene locus_tag LOCUS_79920 31162 30167 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_79920 31471 31196 gene locus_tag LOCUS_79930 31471 31196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79930 32043 31474 gene locus_tag LOCUS_79940 32043 31474 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226048.1 protein_id gnl|my_center|LOCUS_79940 32122 33129 gene locus_tag LOCUS_79950 32122 33129 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043789805.1 protein_id gnl|my_center|LOCUS_79950 >Feature sequence32 283 675 gene locus_tag LOCUS_79960 283 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225978.1 protein_id gnl|my_center|LOCUS_79960 1098 1343 gene locus_tag LOCUS_79970 1098 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79970 1747 1346 gene locus_tag LOCUS_79980 1747 1346 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229580.1 protein_id gnl|my_center|LOCUS_79980 1695 1880 gene locus_tag LOCUS_79990 1695 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79990 1888 2244 gene locus_tag LOCUS_80000 1888 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80000 3387 2245 gene locus_tag LOCUS_80010 3387 2245 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115262.1 protein_id gnl|my_center|LOCUS_80010 5842 3641 gene locus_tag LOCUS_80020 5842 3641 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027019.1 protein_id gnl|my_center|LOCUS_80020 6218 5946 gene locus_tag LOCUS_80030 6218 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80030 7329 6277 gene locus_tag LOCUS_80040 gene corA 7329 6277 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_80040 7489 7707 gene locus_tag LOCUS_80050 7489 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80050 7707 8747 gene locus_tag LOCUS_80060 7707 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_80060 8738 9328 gene locus_tag LOCUS_80070 8738 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_80070 9325 11316 gene locus_tag LOCUS_80080 gene kdpB 9325 11316 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223786.1 protein_id gnl|my_center|LOCUS_80080 11321 11857 gene locus_tag LOCUS_80090 11321 11857 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223787.1 protein_id gnl|my_center|LOCUS_80090 11978 12808 gene locus_tag LOCUS_80100 11978 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80100 14816 12969 gene locus_tag LOCUS_80110 14816 12969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030802.1 protein_id gnl|my_center|LOCUS_80110 15824 14967 gene locus_tag LOCUS_80120 15824 14967 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726969.1 protein_id gnl|my_center|LOCUS_80120 15898 16503 gene locus_tag LOCUS_80130 15898 16503 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704839.1 protein_id gnl|my_center|LOCUS_80130 17273 16509 gene locus_tag LOCUS_80140 17273 16509 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818730.1 protein_id gnl|my_center|LOCUS_80140 18627 17275 gene locus_tag LOCUS_80150 18627 17275 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969872.1 protein_id gnl|my_center|LOCUS_80150 19976 18624 gene locus_tag LOCUS_80160 19976 18624 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083711.1 protein_id gnl|my_center|LOCUS_80160 20992 19973 gene locus_tag LOCUS_80170 20992 19973 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_80170 21831 21085 gene locus_tag LOCUS_80180 21831 21085 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031747.1 protein_id gnl|my_center|LOCUS_80180 22384 22515 gene locus_tag LOCUS_80190 22384 22515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80190 23099 22512 gene locus_tag LOCUS_80200 23099 22512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80200 24100 23207 gene locus_tag LOCUS_80210 24100 23207 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_80210 24426 26225 gene locus_tag LOCUS_80220 24426 26225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80220 27522 26209 gene locus_tag LOCUS_80230 27522 26209 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228198.1 protein_id gnl|my_center|LOCUS_80230 27914 27495 gene locus_tag LOCUS_80240 27914 27495 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727409.1 protein_id gnl|my_center|LOCUS_80240 >Feature sequence33 2578 344 gene locus_tag LOCUS_80250 2578 344 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 protein_id gnl|my_center|LOCUS_80250 3137 4825 gene locus_tag LOCUS_80260 3137 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80260 5006 5863 gene locus_tag LOCUS_80270 5006 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80270 5957 9748 gene locus_tag LOCUS_80280 5957 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80280 10095 9769 gene locus_tag LOCUS_80290 10095 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80290 11065 10163 gene locus_tag LOCUS_80300 11065 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80300 11421 11062 gene locus_tag LOCUS_80310 11421 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80310 11487 14459 gene locus_tag LOCUS_80320 11487 14459 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_80320 14472 15500 gene locus_tag LOCUS_80330 14472 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80330 17184 15583 gene locus_tag LOCUS_80340 17184 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80340 18524 17181 gene locus_tag LOCUS_80350 18524 17181 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_80350 >Feature sequence34 583 128 gene locus_tag LOCUS_80360 583 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80360 1085 585 gene locus_tag LOCUS_80370 1085 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_80370 1686 1126 gene locus_tag LOCUS_80380 1686 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80380 1833 2009 gene locus_tag LOCUS_80390 1833 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80390 2074 2556 gene locus_tag LOCUS_80400 2074 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_80400 2826 2641 gene locus_tag LOCUS_80410 2826 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80410 3409 4449 gene locus_tag LOCUS_80420 3409 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80420 4658 4945 gene locus_tag LOCUS_80430 4658 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80430 6092 5178 gene locus_tag LOCUS_80440 6092 5178 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225800.1 protein_id gnl|my_center|LOCUS_80440 6194 6859 gene locus_tag LOCUS_80450 6194 6859 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225799.1 protein_id gnl|my_center|LOCUS_80450 7213 7389 gene locus_tag LOCUS_80460 7213 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80460 8755 8186 gene locus_tag LOCUS_80470 8755 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230696.1 protein_id gnl|my_center|LOCUS_80470 9211 8936 gene locus_tag LOCUS_80480 9211 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80480 11335 9734 gene locus_tag LOCUS_80490 11335 9734 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229143.1 protein_id gnl|my_center|LOCUS_80490 >Feature sequence35 1150 98 gene locus_tag LOCUS_80500 1150 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80500 1338 2684 gene locus_tag LOCUS_80510 1338 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80510 5077 2726 gene locus_tag LOCUS_80520 5077 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80520 7977 5116 gene locus_tag LOCUS_80530 7977 5116 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052995.1 protein_id gnl|my_center|LOCUS_80530 8592 9623 gene locus_tag LOCUS_80540 8592 9623 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_80540 >Feature sequence36 2098 218 gene locus_tag LOCUS_80550 2098 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80550 2775 4067 gene locus_tag LOCUS_80560 2775 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80560 4170 5609 gene locus_tag LOCUS_80570 4170 5609 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223307.1 protein_id gnl|my_center|LOCUS_80570 6948 5713 gene locus_tag LOCUS_80580 6948 5713 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_80580 >Feature sequence37 141 1656 gene locus_tag LOCUS_r00010 141 1656 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2011 5085 gene locus_tag LOCUS_r00020 2011 5085 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence38 922 1239 gene locus_tag LOCUS_80590 922 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80590 1932 1513 gene locus_tag LOCUS_80600 1932 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80600 >Feature sequence39 >Feature sequence40 <1029 1 gene locus_tag LOCUS_80610 <1029 1 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975979.1:polysaccharide lyase family 1 protein