COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..1094549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(651..1067) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400759.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1180..1983) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268115.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 2134..3018 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3229..5157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(5161..5919) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 6158..6430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 6417..7031 product DUF6436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(7178..8083) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208653.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene cyoE CDS complement(8103..8435) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176899.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(8438..9079) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(9085..11058) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449110.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene cyoB CDS complement(11065..11928) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene cyoA CDS complement(12406..13266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 13428..13664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 tRNA complement(13688..13763) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(13895..14377) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(14374..15441) product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255173.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(15471..16466) product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082912591.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(16560..17846) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383447.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(17843..18460) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(18463..19515) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(19786..20706) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(20719..21333) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927521.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene ampD CDS complement(21353..21649) product PP0621 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(21670..22533) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene ccsA CDS 22563..23981 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene ffh CDS 24008..25015 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 25187..27460 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931191.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(27585..28031) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene lysM CDS complement(28097..28834) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene trmB CDS complement(28838..29038) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene thiS CDS 29125..29799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 29796..31442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 31435..32703 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene nuoF CDS 32725..34380 product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(34340..35809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 tRNA 35988..36061 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 36090..36428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(36450..37130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(37127..37678) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene ogt CDS complement(37683..38333) product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815451.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene alkB CDS 38463..38753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 38806..39393 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 39398..40534 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 40663..42054 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 42218..43264 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(43328..44557) product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene glcF CDS complement(44567..45679) product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene glcE CDS complement(45679..47178) product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene glcD CDS 47363..48148 product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene glcC CDS complement(48217..48696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 48993..50195 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 50208..53366 product multidrug efflux RND transporter permease subunit MexB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene mexB CDS 53363..54823 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037811.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 54831..55586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(55614..56510) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 56618..57784 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 57845..58474 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 58471..59115 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315385.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 59108..60766 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 60763..61389 product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(61394..61876) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072708.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 61986..63389 product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 63703..65445 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063734.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(65538..65981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(65978..66283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 66744..67958 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 68222..69925 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180189928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 69941..81916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 81913..82383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(82680..85067) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275222.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(85242..86231) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(86221..86748) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(86867..87835) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(87963..88223) product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(88220..89335) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 tRNA complement(89504..89594) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(89729..90529) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(90526..91263) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(91260..91652) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(91687..92913) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 92970..93884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 93965..96256 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126621993.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 96261..97448 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 97445..98023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(98075..98863) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 98950..99900 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(99866..100621) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 100508..100753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 100830..102884 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene tkt CDS 102896..103909 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene gap CDS 103926..105125 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 105221..105622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(105595..105945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(105942..107660) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene poxB CDS 107809..108492 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(108437..109243) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193030647.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 109426..110328 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135175407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(110403..110786) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526549.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(110789..111244) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 111438..112394 product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(112479..113957) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 114392..116011 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 116030..117010 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 117014..117844 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 117841..119478 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 119521..120369 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 120374..121672 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(121733..124156) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(124328..125335) product anti-sigma factor FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene foxR CDS complement(125332..125835) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524116.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 125950..126804 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012000798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 126862..128088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 128199..128342 product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 128506..129570 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809510.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene fba CDS 129724..130569 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 130584..131105 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene purE CDS 131117..132298 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 132298..133374 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(133380..133862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 134181..135428 product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 135425..138541 product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 138541..141627 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267714.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 141624..143057 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 143099..143707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 143755..144303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 144440..144967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(144986..145516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(145513..145821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(145994..146398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(146418..147296) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene purU CDS complement(147327..147848) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(147856..148491) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene pdxH CDS complement(148524..149171) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 149325..150146 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 150143..150874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 150868..151803 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 151921..152955 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene dctP CDS 152976..153470 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 153472..154749 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 154746..155516 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 155540..155824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 155821..156192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 156183..156581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(156586..156981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(156985..158166) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene prpF CDS complement(158163..160775) product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene acnD CDS complement(160796..162046) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene prpC CDS complement(162104..162997) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene prpB CDS complement(163152..164141) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 164505..165227 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 165353..165766 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813654.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene sdhC CDS 165770..166153 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813653.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene sdhD CDS 166157..167935 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene sdhA CDS 167950..168666 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 168680..168943 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813647.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 169041..170351 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 170629..173496 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 173588..174799 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930204.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene odhB CDS 174834..176264 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene lpdA CDS 176513..176818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(176900..178828) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(178825..179940) product enterotoxin production-related protein TieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024130080.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene senB CDS complement(180148..181497) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(181466..182152) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(182152..182946) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 183118..184212 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447983.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene zapE CDS complement(184182..184562) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 184617..185990 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 186111..186644 product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 186641..186832 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(186826..187464) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene grxB CDS complement(187473..189875) product RNA-binding transcriptional accessory protein Tex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene tex CDS 189975..191951 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(192031..192822) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040179.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 192932..193918 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 193967..194776 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene pgeF CDS 194913..196502 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene phaC CDS 196596..197333 product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene phbB CDS 197351..197914 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene phaR CDS complement(197967..198131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 198320..200296 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene betT CDS 200454..201653 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(201806..203257) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene hemN CDS complement(203357..205537) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 205660..206556 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 206606..207172 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(207182..208585) product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729183.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene cycA CDS 208826..209782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(209855..213427) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 213691..215094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 215109..215618 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene tssB CDS 215615..217102 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene tssC CDS 217232..217720 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 217734..218153 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene tssE CDS 218184..219899 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene tssF CDS 219896..220885 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene tssG CDS 220906..223551 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene tssH CDS 223555..226458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 226466..229237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 229230..230186 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 230202..230906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 230918..231322 product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 231391..232023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 232046..233443 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene tssK CDS 233437..234132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 234129..238067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(238165..239202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(239384..240796) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene ccoG CDS 241000..242394 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 242630..242947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 243072..244826 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105787.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 244789..245421 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084526.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(245447..246349) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene rarD CDS 246456..246947 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(247070..247960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(247974..249335) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 tRNA complement(249558..249642) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(249743..249827) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 250010..252478 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene rnr CDS 252553..253290 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene rlmB CDS 253317..254558 product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 254806..255078 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 tRNA 255126..255201 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 255312..255581 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene rpsO CDS 255671..257839 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene pnp CDS 258014..259231 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 259337..259852 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406891.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 259849..260859 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269199.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 260975..261367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 261312..263441 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 note possible pseudo, frameshifted CDS complement(263486..264931) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929685.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(265057..265662) product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(265803..265994) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(266010..266435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 266548..267447 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 tRNA complement(267516..267592) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 267967..268167 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 268226..268390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(268432..268734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 tRNA complement(268756..268842) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(268848..268937) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 269089..270066 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 270215..270922 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene tpiA CDS 270947..271417 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene secG tRNA 271469..271553 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 271852..272100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 272100..272486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 272668..272904 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene hfq CDS 273050..274156 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447752.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene hflX CDS 274122..275459 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene hflK CDS 275473..276357 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene hflC CDS 276580..277743 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 277825..279120 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 279129..279680 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 279791..280003 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene rpsU CDS 280059..282179 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene dnaG CDS 282312..284567 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930783.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene rpoD tRNA 284628..284706 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(284822..285106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 284996..286585 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(286749..287612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 287689..288210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 288258..288644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 288658..289239 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479516.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(289255..289548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 289651..290214 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 290297..291739 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 291850..294132 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 294235..297606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(297664..298437) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene yaaA CDS complement(298508..299773) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037087835.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(299775..300317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(300342..301337) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037087840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(301422..302426) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(302423..303295) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098399.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(303314..304069) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 304194..305084 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084956.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(305093..306154) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814231.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene ruvB CDS 306332..307315 product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040093.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 307316..307711 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(307708..308628) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206473.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 308714..309361 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 309486..310619 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(310655..311206) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 311365..312213 product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 312220..312723 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 312720..314297 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 314373..315413 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200942.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(315433..315795) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 315879..316886 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113732.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(316973..317512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 317604..318260 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(318257..318949) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(319033..319767) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(319768..320577) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 320878..321588 product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 321599..322396 product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 322562..324466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 324603..325442 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207863.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 325538..326053 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 326161..327096 product anti-sigma factor FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene foxR CDS 327234..329591 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104677.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 329611..330759 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550626.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(330778..331278) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976217.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(331275..331745) product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976218.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(331828..332250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(332368..334635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(334632..335186) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene speG CDS complement(335209..335886) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 336026..337078 product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 337104..338399 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(338484..339491) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(339496..341361) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040580.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 341678..345463 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene metH tRNA 345655..345730 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 345760..345835 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 345872..345948 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 346079..348139 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(348175..348948) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene fabI CDS 349126..349488 product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 349578..350039 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 350120..351502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(351549..353216) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105432.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(353383..353643) product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(353672..354511) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809308.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene fdhD CDS complement(354522..357398) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene fdhF CDS complement(357414..359051) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(359048..359614) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 359802..360881 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 360878..362011 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene moaA CDS complement(361996..362754) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975807.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 363059..363814 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(363953..364177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(364337..364699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(364724..365530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(365549..366355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 366486..366803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 366902..367732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 367760..368248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 368248..368643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 368640..368957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 368950..369207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 369270..372035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 372058..372822 product DUF2262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 372825..373496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(373466..375265) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 375399..375986 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene mobA CDS 375989..376453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(376477..377682) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809319.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(377777..378271) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(378276..378533) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(378514..379008) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809338.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene moaC CDS 379146..380492 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446871.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(380442..381344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(381326..382348) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene bioB CDS 382703..383128 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 383301..383969 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene modB CDS 384003..384767 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene modA CDS 384764..385552 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(385543..385929) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(385952..386641) product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814287.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(386593..387783) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(387780..393467) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene uvrA CDS 393734..395293 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(395543..396409) product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(396507..397331) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(397353..398303) product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(398306..399739) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(399993..400865) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 400923..401864 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 401861..402847 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(402903..403910) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(403907..406678) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene pepN CDS 406916..407536 product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(407549..407929) product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039538.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 408190..409644 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene tldD CDS complement(409861..411387) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039707.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene lysS CDS complement(411445..412254) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926447.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(412256..413155) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene prfB note possible pseudo, frameshifted CDS 413502..414446 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926455.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(414434..414958) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809396.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene ybeY CDS complement(414951..416027) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(416024..417553) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene miaB CDS complement(417642..418583) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064325.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene secF CDS complement(418623..420488) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene secD CDS complement(420501..420845) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene yajC CDS complement(420893..422026) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene tgt CDS complement(422079..423194) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene queA CDS 423222..424676 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene dacB CDS complement(424686..425567) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(425509..426942) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene cysG CDS 427125..427448 product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809432.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 427450..427857 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091263.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 427850..428179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(428227..429771) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809435.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 429878..430675 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 430785..431849 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene argC CDS 431864..432685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 432811..433179 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene erpA CDS complement(433228..434343) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(434413..435849) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 436020..437246 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene tyrS CDS 437328..437969 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 438014..439258 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 439264..439737 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene nrdR CDS 439755..440936 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931219.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene ribD CDS 440939..441661 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(441723..442160) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(442227..443126) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 443398..443604 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 443713..443883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(444065..445606) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810219.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 445740..446642 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 446685..447167 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 tmRNA 447208..447593 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 447786..450116 product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 450326..450508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 450577..452184 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 452188..453321 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383172.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene cydB CDS 453334..453567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 453602..454105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(454240..454914) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 455018..455404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(455438..456625) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104410.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 456838..457377 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(457407..457817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(457821..458768) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 458967..459710 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 459742..460623 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(460743..462179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 462464..463390 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089195.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 463377..464408 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089194.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 464402..465178 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 465178..466503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 466545..467081 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 467078..468430 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(468440..469153) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 469450..471528 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(471522..472691) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(472801..473526) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene tenA tRNA 473720..473796 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(473952..475175) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095747.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(475147..475446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 475496..475756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(475767..475952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(475955..476212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(476205..476810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(476807..477292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(477282..477596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(477593..480055) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(480052..480534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(480602..480868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 481052..481369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(481439..482056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(482053..482964) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(482954..484060) product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164996215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(484222..484683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(484722..485126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(485172..485918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(485932..487722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(487719..488483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(488672..488992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(488989..489321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(489318..489497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(489494..489703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(489700..490047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 tRNA complement(490230..490305) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(490488..490561) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(490759..491232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(491892..492245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 492374..492550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 492639..493157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(493706..494026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(494010..495077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(495084..495404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(495591..495953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(495991..497154) product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(497280..497930) product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(498320..498499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 498800..499126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 499188..499661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 499658..500290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 500315..500557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 500673..503294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 503291..503638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 503635..504564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 504632..505264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 505264..505713 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 505710..506096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 506425..506943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 507105..507731 product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267983.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(507733..508320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 508453..508926 product DUF2280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 508877..510373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 510376..511851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 511784..512650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 512647..513948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 513945..514430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 514446..515528 product DUF2184 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 515594..515938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 515940..516371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 516368..516844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 516841..517209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 517206..517733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 517743..519251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 519315..519761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 519771..520226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 520317..521993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 521990..522535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 522550..522840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 522833..523657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 523654..524349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 524346..524690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 524683..525873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 525870..526520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 526521..527468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 528311..528976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 530098..530319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 530303..530761 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 530740..531240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(531251..531496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(531594..531782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(532055..532369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(532370..532783) product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene hicB CDS complement(532886..533062) product type II toxin-antitoxin system mRNA interferase toxin HicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene hicA CDS 533476..533817 product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112983.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(533814..534422) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 534773..535117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 535171..537795 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene alaS CDS 537792..538028 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810665.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(538212..541037) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(541075..541350) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene minE CDS complement(541355..542170) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene minD CDS complement(542284..543123) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene minC CDS complement(543120..544898) product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 544975..546465 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 546462..547520 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 547570..549399 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene recQ CDS complement(549415..549846) product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(549861..550877) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 551304..551714 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene fur CDS complement(551851..552774) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965523.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(552794..553495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(553659..555125) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(555132..555878) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931409.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(555878..556933) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 557078..559384 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 559385..560854 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 560851..561672 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene rsmA CDS 561656..562771 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(562756..563244) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(563264..564058) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene thyA CDS complement(564082..564519) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808444.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 565068..566198 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 566271..567545 product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene tviB CDS 567562..568590 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 568593..569945 product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 569929..571092 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 571092..574565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(574653..576044) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 576225..577637 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(577703..578803) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(578814..579029) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 579251..579919 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 579916..580260 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 580378..581805 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(581823..582290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 582371..583171 product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 583188..584018 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814179.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 584160..584993 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814178.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 585191..585784 product TIGR01841 family phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene phaP CDS complement(585888..586847) product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(586934..587488) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 587684..588589 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(588630..590135) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 590246..591466 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 591541..592254 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(592293..593336) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(593362..594081) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(594078..594818) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene aat CDS complement(594832..595407) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(595435..597378) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 597575..598090 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(598208..598756) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 598901..599695 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene map CDS complement(599751..600701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(600937..602343) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene gltX CDS 602409..604919 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(604926..605597) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(605594..606190) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene yjgA CDS 606264..607679 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567741.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene pmbA CDS 607760..608863 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814893.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 609057..609485 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927106.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene rplM CDS 609498..609890 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene rpsI CDS 609990..610838 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 610980..611381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(611510..612208) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252592.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 612446..613702 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814059.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene icd CDS complement(613847..614185) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 614287..615252 product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810823.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(615235..616461) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085426.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 616654..617403 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(617370..620387) product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene torS CDS 620457..621617 product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene torT CDS 621632..622792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(622802..623104) product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 623160..623378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 623677..626343 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(626463..626753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(626848..627351) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552138.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(627366..628736) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 628907..630085 product amonabactin biosynthesis isochorismate synthase AmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene amoC CDS 630082..630720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 630808..631332 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406891.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 631335..632312 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205506.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 632406..634853 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 634853..636232 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(636290..636697) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 636839..637762 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 637784..639664 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene ilvD CDS complement(639747..640706) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 640989..642272 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113702.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 642335..643522 product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene rhmD CDS 643542..644345 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene hpaI CDS 644389..645822 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066669.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene aldA CDS complement(645875..646174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(646197..647780) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene norR CDS 648025..648711 product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene ytfE CDS 648704..651034 product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 651166..651579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 651713..652336 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 652358..653536 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 653896..654279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(654450..655232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(655219..656175) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene trxB CDS 656378..658678 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 658675..659430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 659437..660777 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 660814..662154 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene serS CDS 662176..662958 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene pssA CDS complement(662998..663540) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814003.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 663605..664375 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(664361..666778) product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(666859..667068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 667219..668442 product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(668566..669672) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(669730..670398) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 670452..671000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(671066..671635) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene mntP CDS complement(672001..672864) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813898.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene serB CDS complement(672880..676359) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene mfd CDS 676417..677142 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040254.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene ispD CDS 677130..677627 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene ispF CDS 677787..678278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 678300..679925 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 679937..681361 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(681460..682809) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(682868..683602) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene ompR CDS 683704..684504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 note possible pseudo, internal stop codon CDS 684544..684987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 note possible pseudo, internal stop codon CDS 685032..685970 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(685982..687163) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 687260..688054 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(688085..689365) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene lplT CDS 689580..693104 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813877.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene smc CDS 693200..694264 product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 694283..696418 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene ligA CDS complement(696435..697664) product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(697667..697984) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(698183..698893) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(699106..699882) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(699902..700192) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(700194..700793) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(700790..701185) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene msrB CDS 701246..701944 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 701938..702528 product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 702601..703164 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 703265..704392 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 704525..705565 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813866.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 705572..707395 product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813865.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 707392..708174 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(708177..709244) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(709363..710397) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(710455..711669) product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene zigA CDS complement(711855..712490) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene nth CDS complement(712487..713095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(713135..713941) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(713984..714307) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 714461..715642 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995174.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene pncB CDS 715716..717986 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065079.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 718125..719324 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene trpB CDS 719370..720206 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813844.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene trpA CDS 720232..721104 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813843.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene accD CDS complement(721177..722049) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994149.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(722163..725219) product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 725786..726706 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 726703..727398 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 727379..727672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(727951..729567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(729773..730375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(730398..731147) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(731144..731785) product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065087.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 732170..732880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(732901..733203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 733381..734559 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 734556..735167 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 735298..737493 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 737490..738467 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 738487..739971 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 739968..741770 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568003.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 741803..742288 product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(742344..742961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(743117..743674) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene efp CDS complement(743764..744924) product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039402.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene earP CDS complement(744924..745805) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene pdxY CDS complement(745807..747087) product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810196.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(747084..748067) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(748129..749292) product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(749405..752107) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820240.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene acnA CDS 752359..752763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071960.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 752760..753302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(753958..754545) product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(754602..754949) product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(755104..757695) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene acnB CDS 757895..758206 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370089.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 758206..759165 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 759199..759945 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene rph CDS 760023..760325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 tRNA complement(760405..760481) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 760625..761290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 761322..763049 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041937173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 763259..763753 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene rimP CDS 763750..765231 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene nusA CDS 765365..768340 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene infB CDS 768347..768748 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810550.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene rbfA CDS 768782..769516 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene truB CDS 769536..771356 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818637.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene typA CDS 771406..772020 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811006.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 772017..773147 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene tsaD CDS complement(773457..774149) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene plsY CDS 774271..775035 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene surE CDS 775020..775850 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 775868..776785 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 776782..777564 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(777696..780005) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811115.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(780025..780228) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811126.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene rpoZ CDS complement(780281..780892) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930442.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene gmk CDS complement(780982..781674) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 781807..782871 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(782921..784153) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene coaBC CDS complement(784166..784741) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812559.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene lspA CDS complement(784760..787660) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene ileS CDS complement(787617..788594) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064039.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 788788..789408 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene purN CDS 789405..791150 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(791077..792042) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 792171..793364 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113087.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 793361..794530 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541054.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(794656..795885) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene serA CDS 796080..797282 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812548.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 797279..799582 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(800093..802039) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812542.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(802052..802942) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926401.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene prmB CDS complement(802945..803766) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812536.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene dapD CDS complement(803791..804996) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene dapC tRNA 805078..805164 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 805351..805986 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene queE CDS 805994..806452 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene queD CDS 806506..806970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 807146..807664 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 807792..808193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 808208..808627 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(808754..808948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(809052..809225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 809396..810454 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 810527..811837 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905723.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene tig CDS 811840..812496 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene clpP CDS 812530..813855 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926436.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene clpX CDS 814028..816484 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene lon CDS 816490..817011 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene def CDS 817024..818298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 818313..819650 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene rlmD CDS 820196..820438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 note possible pseudo, internal stop codon CDS complement(820638..821171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(821498..821782) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 822196..822738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(823107..824528) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene argH CDS 824594..825919 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 825916..827712 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 827779..828117 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 828125..828520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 828666..829043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 829049..829726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 829783..830337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(830356..831054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 831981..832712 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930119.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(832744..833484) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene ugpQ CDS 833484..835517 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(835539..836180) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 836152..836898 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 836981..838309 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene folC CDS 838370..839290 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 839287..839808 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 839821..841335 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene purF CDS complement(841387..841872) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(841884..844499) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811808.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(844527..845336) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811806.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene map CDS 845559..846314 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene rpsB CDS 846470..847348 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene tsf CDS 847484..848200 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene pyrH CDS 848221..848781 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene frr CDS 848804..849562 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene uppS CDS 849570..850247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 850253..851440 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811788.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 851453..852784 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene rseP CDS 852856..855162 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene bamA CDS 855230..855811 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 855816..856940 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene lpxD CDS 857028..857480 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811776.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene fabZ CDS 857495..858295 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene lpxA CDS 858325..859479 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811772.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene lpxB CDS 859518..860141 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811770.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene rnhB CDS 860138..860920 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063752.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 860961..861200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(861194..862225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(862294..863139) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063753.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 863307..865670 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene ppsA CDS 865695..866111 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811761.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 866211..867137 product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(867234..867551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(867576..868436) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene rlmJ CDS complement(868440..868898) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063759.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene smpB CDS 868996..869379 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 869384..869704 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063760.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 869742..870905 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(871024..872091) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 872169..873179 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene mltG CDS 873176..873835 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene tmk CDS 873832..874896 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene holB CDS 874900..875676 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 875694..876398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 876536..877825 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 877856..878158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(878207..879073) product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(879097..879237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(879201..879740) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112525.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 note possible pseudo, frameshifted CDS complement(879791..880285) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219440.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene bsaA CDS 880377..881042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(881046..881423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(881431..881826) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(881913..883196) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 883409..883969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 884074..884625 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(884857..887154) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(887283..888242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(888251..890266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(890270..891124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(891239..891940) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(891941..892708) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene livG CDS complement(892705..893931) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(893931..894857) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene livH CDS complement(894950..896062) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(896315..897163) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811267.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene proC CDS complement(897176..898048) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene ubiA CDS 898243..899568 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene ugpB CDS 899704..900585 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene ugpA CDS 900585..901436 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene ugpE CDS 901452..902702 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(902873..903997) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 904180..905193 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 905227..906105 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458420.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene cysT CDS 906102..906926 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene cysW CDS complement(906899..907420) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(907471..907989) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(908069..909040) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(909046..911175) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446218.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene recG CDS complement(911175..911561) product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(911644..912420) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 912683..913714 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 913722..915365 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 915382..916218 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(916258..917790) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene ntrC CDS complement(917787..918839) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene glnL CDS complement(918874..920286) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene glnA CDS complement(920559..921788) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene hemW CDS complement(921785..922405) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene rdgB CDS 922540..923223 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(923217..925532) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 925624..926049 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene cadR CDS complement(926036..926326) product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(926347..927291) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064892.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 927432..929357 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086964.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(929360..930364) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(930455..932890) product ferripyoverdine/pyocin S3 receptor FpvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene fpvA CDS complement(932955..933956) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(933949..934473) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(934549..935418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(935533..936294) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 936366..937217 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 937238..937687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 937764..938219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 938303..938905 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 938932..939462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 939440..939799 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 939796..940374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 940371..941009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 941006..941575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(941551..943698) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(943922..944446) product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 944776..946347 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 tRNA complement(946540..946615) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(946649..946724) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(946781..947584) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853444.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene phoU CDS complement(947657..948361) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene rpiA CDS complement(948415..949611) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene rmuC CDS complement(949601..949963) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(949960..950763) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(950766..951674) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(951671..952816) product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene potA CDS complement(952855..953955) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(954044..954784) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(954781..955224) product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(955217..957724) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 957830..958816 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 958844..959356 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 959362..960642 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(960740..963232) product ferripyoverdine/pyocin S3 receptor FpvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349900.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene fpvA CDS complement(963306..964313) product anti-sigma factor FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene foxR CDS complement(964310..964819) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(964951..966222) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene radA CDS 966455..967294 product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene hpnC CDS 967291..968154 product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene hpnD CDS 968183..969562 product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene hpnE CDS complement(969684..971096) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene thrC CDS complement(971093..972397) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 972625..973065 product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813077.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 973085..973555 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 973559..975385 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(975539..976921) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(976881..977732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813091.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(977827..978282) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene rplI CDS complement(978298..978570) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene rpsR CDS complement(978633..978905) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813095.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene priB CDS complement(978970..979368) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene rpsF CDS complement(979547..980356) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene folE2 CDS complement(980586..982469) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene dxs CDS complement(982469..983392) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(983389..983622) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813109.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 983817..984959 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 984959..985282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 985362..985802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 985792..986214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(986211..987095) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene htpX CDS 987234..988079 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 988096..988962 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(988987..991695) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930273.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene polA CDS 991755..992384 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(992391..993989) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(994026..995057) product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(995057..996682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 996802..997800 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(997921..998151) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 998439..1001015 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1001099..1002043) product aromatic alcohol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1002200..1003105 product putative multidrug efflux transcriptional regulator CeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene ceoR CDS complement(1003210..1005000) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene lpdA CDS complement(1005012..1006352) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene aceF CDS complement(1006368..1009073) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene aceE CDS 1009413..1011167 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811943.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1011164..1011784 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1011826..1012689 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene folD CDS 1012699..1014765 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 1014762..1015274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(1015305..1016726) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1016742..1016942) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1017058..1019385 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 1019382..1019798 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene cueR CDS complement(1019880..1020983) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208458.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1020980..1021567) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931084.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 tRNA 1021708..1021783 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 1021978..1023126 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 1023201..1024031 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1024061..1024666) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene gstA CDS complement(1024676..1025434) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(1025553..1026854) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1026851..1027675) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1027672..1028457) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1028454..1029497) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1029873..1033295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1033354..1034262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1034284..1035876 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1035881..1038193) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987096.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1038190..1038657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1038862..1040109 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(1040115..1040309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1040837..1042225) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1042573..1043181 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479655.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1043193..1043960 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531771.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1044007..1044771 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705575.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1044789..1045478 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085934.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1045475..1046164 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314733.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1046161..1047183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1047180..1048076) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 1048207..1049403 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1049436..1050719 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1050709..1051218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(1051211..1052155) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1052269..1053432 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1053445..1054821 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 1054881..1055726 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064993.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1055730..1056965 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1057078..1057932 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039147.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1057973..1058815 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114410.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1058822..1059208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1059205..1059858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1059860..1060243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1060264..1060749 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964949.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1060753..1061280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1061277..1061561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1061562..1061924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1061908..1063110) product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368753.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene tyrB CDS 1063345..1064988 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1065006..1065296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1065274..1065846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1066014..1066451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1066448..1067614) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684076.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1067809..1068624 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1068621..1069646 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 1069763..1070848 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1070993..1072558 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1072542..1073447) product LysR family transcriptional regulator NmoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114724.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene nmoR CDS 1073556..1074641 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064355.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1074636..1078460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1078464..1078844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1078841..1080814) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1080921..1081538) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1081635..1081856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1081764..1082543 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1082660..1083292 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1083339..1084190) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 1084296..1084748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1084767..1085183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(1085180..1085491) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1085631..1086407 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1086418..1087101 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1087162..1088646) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene mqo CDS complement(1088654..1089058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1089090..1089686) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1089685..1089894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1089937..1090923 product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1090949..1091977 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1091974..1092876) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene ylqF CDS 1092953..1093534 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1093531..1094400 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 sequence02 source 1..30644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1171..3189 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(3166..5589) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104677.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(5659..6573) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(6675..7208) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 7378..9180 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818202.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene aceK CDS 9240..10421 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818204.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(10446..11141) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene radC CDS 11193..11669 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 11669..12610 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene ispH CDS complement(12684..13400) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 13789..14403 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 14372..15487 product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806895.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 15444..17816 product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 17865..18209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(18300..22559) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene rpoC CDS complement(22559..26671) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929573.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene rpoB CDS complement(26834..27214) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene rplL CDS complement(27310..27834) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene rplJ CDS complement(28071..28772) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene rplA CDS complement(28775..29206) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene rplK CDS complement(29272..29805) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene nusG CDS complement(29815..30042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 tRNA complement(30238..30313) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence03 source 1..21299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 533..727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 699..1469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1456..2802) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222757.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(3120..4712) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene guaA CDS complement(4739..6199) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene guaB CDS complement(6278..6655) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene mnhG CDS complement(6652..6927) product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313274.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(6924..7424) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(7421..9085) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054241.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(9082..9426) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(9426..12332) product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(12527..16621) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene purL CDS complement(16639..17190) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene greB CDS complement(17201..17740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 17636..18085 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 18249..18692 product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(18787..19191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 19396..20655 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 sequence04 source 1..12806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 520..852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1138..1542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1684..2334) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385044.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(2327..3478) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537514.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(3493..4299) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 4571..6007 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808467.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(6008..7237) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537819.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(7234..8337) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(8417..9019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(9101..10192) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931158.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(10297..10923) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114003.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(11013..12179) product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104943.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene yiaY misc_feature complement(12277..>12806) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926498.1:aldehyde dehydrogenase locus_tag LOCUS_10850 sequence05 source 1..5963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(78..184) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(343..3221) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(3512..3587) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(3604..3680) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 rRNA complement(3801..5331) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence06 source 1..2902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(8..>2902) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112791.1:xanthine dehydrogenase family protein molybdopterin-binding subunit locus_tag LOCUS_10860 sequence07 source 1..2052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence08 source 1..1165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1164 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003806883.1:elongation factor Tu locus_tag LOCUS_10870 sequence09 source 1..1032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 note possible pseudo, frameshifted sequence10 source 1..555334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 461..1489 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816034.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1546..1989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 2091..3896 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(3906..5426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(5592..6467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(6647..9523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(9688..10638) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(10658..11179) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(11268..12437) product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(12520..13965) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(13966..14700) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 14929..17211 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035415.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(17314..18423) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(18508..19293) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294614.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(19382..20197) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100501.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene dhbA CDS complement(20256..20609) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(20720..21397) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(21438..22124) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(22152..22838) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339330.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(22835..23665) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339329.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(23695..24531) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(24578..25513) product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(25542..27011) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086117.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene hydA CDS complement(27284..28243) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527033.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(28341..28976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(29011..29769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(29806..30564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 repeat_region 30647..31394 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctatacggcagtgaag CDS complement(31523..32086) product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene cas6f CDS complement(32088..33113) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene csy3 CDS complement(33140..34165) product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene csy2 CDS complement(34162..35514) product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene csy1 CDS 35915..36526 product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 36519..37541 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(37526..40927) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene cas3f CDS complement(40924..41958) product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene cas1f CDS 42078..42380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 42377..43678 product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970614.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 repeat_region 43788..44415 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctatacggcagtgaac CDS complement(44614..45597) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene nrdF CDS complement(45646..47862) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene nrdE CDS complement(47859..48263) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene nrdI CDS complement(48292..48516) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene nrdH CDS complement(48744..49262) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369894.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 49325..50197 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703345.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(50261..50806) product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925795.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(50878..52644) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 52719..53516 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(53500..54132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(54168..54617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(54687..55358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(55368..56984) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(57097..58059) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090294.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 58158..58859 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(58894..59400) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(59397..60926) product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(60978..61604) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(61748..63196) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(63546..64940) product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(64937..66448) product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064776.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 66500..67453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(67528..67788) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 67783..68214 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 68461..69213 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(69215..70189) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene ttcA CDS complement(70200..70622) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(70713..71513) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 71443..71655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 71680..72216 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175137776.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 72203..73219 product pyoverdine signaling pathway anti-sigma factor FpvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene fpvR CDS 73468..75882 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 75896..76207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 76282..77772 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065178.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 77769..78098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(78060..79004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 79277..81175 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(81154..82461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(82463..83158) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(83155..84642) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(84629..85651) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(85648..86040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(86110..87891) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 87929..88705 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 88745..89566 product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 89773..90828 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821320.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 90944..91543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 91543..92493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 92581..94941 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(95039..96499) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene gabD CDS complement(96537..97379) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(97404..98669) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196172.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(98765..99808) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525160.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(99943..101052) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(101124..102383) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 102602..104110 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555084.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 104158..104670 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene def CDS 104755..105690 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene fmt CDS complement(105754..106668) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(106669..107022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 107120..108466 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene rsmB CDS 108513..109094 product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 109091..111445 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 111457..112161 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 112158..113537 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038750.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene trkA CDS 113572..115038 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(115078..115884) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247635.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 115774..115986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 116056..116751 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 116787..117260 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(117253..118320) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(118333..118851) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807422.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene secB CDS complement(118901..119167) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene grxC CDS complement(119188..119598) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 119759..120511 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene gpmA CDS 120514..122073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 122122..123570 product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446625.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene cptA CDS 123567..124319 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene moeB CDS complement(124310..125803) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(125996..126721) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(126821..127744) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815193.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene argB CDS 127988..129001 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 128998..129672 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 129702..130490 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(130586..131077) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(131102..131785) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815190.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(131782..132375) product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(132434..133417) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 133430..134122 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 134262..137198 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 137195..137740 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 137751..139082 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(139188..139493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 note possible pseudo, frameshifted CDS 139846..140820 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929780.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene rsmI CDS complement(140826..141848) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(141853..142746) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rapZ CDS complement(142794..143744) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene hprK CDS complement(143751..144206) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(144299..144625) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene raiA CDS complement(144752..145534) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815177.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene lptB CDS complement(145563..146165) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815175.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene lptA CDS complement(146178..146792) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene lptC CDS complement(146797..147417) product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(147419..148405) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815171.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 148462..149598 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 149591..150454 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064124.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 150554..151771 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809839.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 151776..152645 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 152642..153598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 note possible pseudo, frameshifted CDS 153595..154359 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973920.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 154359..155078 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene livF CDS 155175..156818 product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 156811..157047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 note possible pseudo, frameshifted CDS 157044..161027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 note possible pseudo, frameshifted CDS 161052..162452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(162551..163000) product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene azu CDS complement(163187..163678) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(163736..164872) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene dprA CDS 165078..165509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 165552..166433 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene atpB CDS 166520..166762 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene atpE CDS 166896..167366 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931385.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 167379..167918 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064896.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 167954..169495 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040647.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene atpA CDS 169551..170447 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene atpG CDS 170501..171922 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene atpD CDS 171953..172384 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(172478..172855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 173315..173965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 174018..175097 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815337.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene hemE CDS 175467..177644 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247688.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 177644..179734 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815333.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(179793..180092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(180313..181224) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815316.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(181281..181793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 note possible pseudo, internal stop codon, frameshifted CDS 182006..183223 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929968.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene purT CDS 183377..183934 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 184017..184415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(184474..185982) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene ilvA CDS 186155..187843 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 187866..188828 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 188848..189741 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388736.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 189738..191369 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 191384..191956 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 191974..192351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(192413..193084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 193114..193473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033414.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(193455..194771) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene phoR CDS complement(194793..195491) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene phoB CDS 195621..196397 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene ubiE CDS 196548..197585 product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040585.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 197769..198374 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 198371..199930 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815105.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene ubiB CDS complement(199955..200716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 200928..203084 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 203255..204229 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091913.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 204246..205115 product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene ssuC CDS 205135..206010 product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102311.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene ssuB CDS complement(206052..206834) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 207070..207834 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 207852..208514 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085013.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 208511..209266 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 209263..210573 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063785.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(210660..211373) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(211345..211752) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014843191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 211860..212744 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 212744..213799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 213796..214269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(214342..214758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(214852..215793) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228449.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(215796..217277) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(217540..218883) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(218880..220697) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(220716..222002) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene hemL CDS complement(222088..222750) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040557.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene thiE CDS complement(222813..223667) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 223713..223865 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814980.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 223930..224544 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927118.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 224537..224986 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene ruvX CDS 224993..225853 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927117.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(225801..226643) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(226640..227824) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene lptG CDS 227931..228431 product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene rfaE2 CDS complement(228355..229728) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(229735..230415) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(230523..231335) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene thiD CDS complement(231395..232186) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 232365..232988 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 233509..237234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963924.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(237447..238082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(238966..239631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(239764..240633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(241259..242791) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(242813..243181) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(243292..244032) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(244058..244810) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(244841..245614) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(245632..247062) product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 247245..253094 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 253199..255478 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene pbpC CDS 255726..256823 product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(256893..259283) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626173.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(259389..260408) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815596.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(260422..260991) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(261209..263122) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene thiC CDS complement(263408..263812) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 264096..264890 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808364.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(264906..266039) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene proB CDS complement(266149..267246) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene obgE CDS complement(267378..267641) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene rpmA CDS complement(267681..267992) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene rplU CDS complement(268099..268905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(268949..269860) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767818.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 270061..271401 product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268487.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 271576..272445 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 272530..274029 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 274047..275222 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(275295..276689) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111339.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 276798..277733 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 278110..278631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 278753..279352 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113348.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 279455..279736 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 279754..280191 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 280405..281322 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene ispB tRNA 281374..281450 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 281545..282456 product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(282466..283308) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(283305..284219) product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene sitC CDS complement(284216..285121) product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(285118..286113) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 286299..286781 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037316.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene mntR CDS 286815..287435 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 287540..288844 product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene ndh CDS complement(288845..289459) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(289480..292350) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene ppc CDS complement(292354..293481) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(293566..294927) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 295076..296029 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene ppk2 CDS complement(296078..296698) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(296799..297935) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(297970..298974) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815327.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(298971..299963) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815325.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(299963..300916) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815324.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(300916..301893) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817805.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(301940..303568) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 303709..304620 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762877.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(304654..306408) product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(306483..307169) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(307226..308581) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463563.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene clcA CDS complement(308665..309039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118152.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(309166..311067) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064608.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene htpG CDS complement(311180..311596) product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene mazF CDS complement(311590..311841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(311985..314447) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275222.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(314559..315569) product anti-sigma factor FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene foxR CDS complement(315620..316150) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 tRNA 316356..316440 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 316574..317659 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(318153..318854) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 319282..319533 product Plasmid-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 319530..320537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 320534..321076 product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene mobC CDS 321073..322068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 322094..322351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066612727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 322610..323335 product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene virB5 CDS 323350..323829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040068.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 323826..324086 product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040067.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 324086..325162 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040066.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 326507..327361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 327358..329439 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(329877..331589) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113542.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(331896..332798) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 332900..333448 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836250.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 333767..334348 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 334355..334987 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 334996..335880 product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene yddG CDS 336051..337403 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene nhaA CDS 337661..338596 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 338702..339328 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064299.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene mog CDS 339325..340053 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(340057..341775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(341931..342722) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene dapB CDS complement(342739..343167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(343791..345440) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene recN CDS complement(345447..346382) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930961.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 346489..347493 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814090.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene hrcA CDS 347510..348526 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene hemH CDS 348585..349115 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene grpE CDS 349217..351145 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814079.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene dnaK CDS 351265..352398 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene dnaJ tRNA 352873..352955 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(352938..353579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(353634..354176) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 354402..355604 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 355612..358782 product multidrug efflux RND transporter permease subunit OqxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096740.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene oqxB CDS 358793..360253 product multidrug efflux RND transporter outer membrane subunit OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene oprN tRNA 359854..359928 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(360260..360598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(360732..361763) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262467.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 361840..362487 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034858994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(362579..363082) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384987.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 363155..364342 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384988.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 364506..365573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229181.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(365620..366705) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 367064..369808 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808566.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 369828..370235 product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808567.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(370186..370488) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808570.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(370479..370979) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene coaD CDS complement(370976..371647) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene rsmD CDS 371646..372926 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene ftsY CDS complement(372993..374627) product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(374704..376326) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene glpD CDS 376355..377536 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene ribBA CDS 377559..378080 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene ribH CDS 378058..378561 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039075.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene nusB CDS 378567..379535 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039076.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene thiL CDS 379576..380112 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247451.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 380122..380643 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(380627..381445) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene pyrF CDS complement(381506..381820) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 382021..382788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 382793..383620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 note possible pseudo, frameshifted CDS 383711..384298 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198478.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 384305..385306 product anti-sigma factor FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene foxR CDS 385420..387756 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(387697..388005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(388081..388326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 388413..388697 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 389024..389557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 389602..390606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(390751..390879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(390958..391101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 391545..393683 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470932.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 393686..395485 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 395580..397595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(397721..399034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(399031..399765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(399762..400253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(400465..400692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(400744..401049) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(401030..401467) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388677.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(401464..402675) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(402943..404583) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808619.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene groL CDS complement(404660..404947) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene groES CDS 405180..405542 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(405646..406431) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene fabI CDS complement(406499..407899) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(407910..408707) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927090.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene gloB CDS 408722..409492 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 409489..409980 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene rnhA CDS 410028..411119 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 411116..414166 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 414166..414885 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene dnaQ CDS complement(414927..415943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 tRNA 416108..416182 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(416262..417578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(417718..419652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 419790..420290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 420488..422353 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 422402..422902 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246884.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 423059..425167 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930422.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 425223..425549 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 425559..426179 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809574.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene recR CDS 426210..426542 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 426766..427797 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 427790..428599 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 428606..429400 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809582.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(429426..430238) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388870.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 430334..431533 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(431549..432553) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930364.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene tal CDS 432758..434014 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 434202..435344 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076879800.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene carA CDS 435361..438606 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene carB CDS 438964..439443 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene greA CDS complement(439568..440203) product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064277.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 440221..440853 product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 440948..442876 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene ftsH CDS 442929..443762 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930173.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene folP CDS 443786..445135 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809628.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene glmM CDS 445213..446001 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(446084..447577) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809631.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene ppx CDS 447767..449818 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809633.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene ppk1 CDS 449959..451002 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene pstS CDS 451132..452070 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene pstC CDS 452091..452954 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene pstA CDS 452964..453743 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene pstB CDS complement(453838..454743) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172900.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(454799..455437) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 455522..456451 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504141.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 456807..456992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 457014..457502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 457574..458491 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene cpaB CDS 458510..459871 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 459875..460303 product CpaD family pilus assembly lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 460322..461530 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 461734..463035 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011854072.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 463032..464015 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526913.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 464020..464967 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191346.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 464984..466015 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173426820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 466012..466512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 466526..467182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 467305..469212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 469274..470566 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 470634..470930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(470935..471249) product DUF4148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819749.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 471467..472381 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815158.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(472372..472944) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(472911..473618) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 tRNA complement(473676..473751) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(473785..473861) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(473878..473954) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 474077..474703 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809950.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 474755..475405 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 475497..476402 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene dapA CDS 476417..477559 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene bamC CDS 477655..478122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(478186..478563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(478817..480016) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064174.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(480046..482658) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446228.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene mutS CDS 482946..484130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(484552..484920) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 485080..485691 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 485904..487061 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 487116..487955 product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 488134..489789 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817182.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(489850..490176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(490173..491306) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene nrdB CDS complement(491325..493667) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene nrdA CDS complement(493962..494843) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene queF CDS 495098..496411 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene aceA CDS 496595..497608 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818557.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 497731..497919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 497997..499493 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene ccoN CDS 499506..500171 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene ccoO CDS 500184..500363 product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 500356..501282 product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene ccoP CDS 501415..501666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 502087..503226 product oxalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene oxdC CDS 503296..504222 product transporter YfdV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955028.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene yfdV CDS complement(504380..505054) product oxygen-responsive transcriptional regulator Btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene btr CDS 505335..507935 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene clpB CDS 508121..509347 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 509381..509974 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 510047..510229 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene rpmF CDS 510328..511389 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065089.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene plsX CDS 511389..512375 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 512434..513366 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065091.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene fabD CDS 513369..514124 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene fabG CDS 514325..514564 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene acpP CDS 514797..516026 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene fabF CDS 516103..516540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 516537..517136 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene rpoE CDS 517149..517655 product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 517655..518701 product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 518757..520238 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 520330..522123 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene lepA CDS 522120..523004 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene lepB CDS 523031..523813 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene rnc CDS 523810..524700 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene era CDS 524693..525355 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene recO CDS complement(525417..526382) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930665.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(526546..528135) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene lnt CDS complement(528158..529051) product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 529267..530385 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437089.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(530464..532953) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112989.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(533034..534044) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(534063..534593) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 534790..536250 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(536366..537505) product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967660.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene nirK CDS 537768..538496 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970955.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(538444..539307) product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 539479..540702 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(540704..541144) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 541329..542000 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 542034..544373 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 544370..545701 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810114.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 545701..547686 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 547771..549045 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 549061..551457 product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039378.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 551471..552673 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 552678..553214 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 553286..554938 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 sequence11 source 1..460561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(231..1310) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1734..2237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(2234..2515) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(2623..3543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 3868..4548 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810854.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(4843..5094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(5261..6508) product bacteriophage-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205301.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(6509..7561) product zonular occludens toxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(7565..7876) product DUF2523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467041.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(7860..9212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(9369..9605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(9661..9903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(9907..10113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(10116..10427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(10454..11557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(11554..11814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(11811..12002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(11999..12220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 12382..12738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 12735..13730 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(14063..15463) product SEC-C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123350.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 tRNA complement(16056..16132) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(16255..16770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 16852..17322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 17410..18132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 18129..18515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(18508..19239) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 19298..19516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 19513..20364 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(20417..21850) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene aspA CDS complement(21950..23083) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(23215..27063) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064076.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene putA CDS complement(27166..29469) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447476.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene clpA CDS complement(29557..29865) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene clpS CDS 30068..30310 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 30478..30822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(30852..32051) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene xseA CDS 32399..33007 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 33004..33417 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 33414..34448 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene lpxK CDS 34503..34676 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812895.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 34673..35443 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064093.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene kdsB CDS 35543..36199 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene adk CDS 36271..37029 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931126.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 37048..38613 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931127.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene murJ CDS 38722..38985 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene rpsT CDS 39095..40054 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(40099..40389) product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812933.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 40544..41719 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 41784..42728 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene argF CDS 42885..44219 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene argG CDS 44226..45107 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 45104..45745 product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268574.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(45853..46965) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(46946..47632) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820363.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(47804..48259) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(48259..49323) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(49328..50173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 50431..51048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 51045..52355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(52415..52834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(52895..53197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(53301..54338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 tRNA complement(54637..54713) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 55035..55292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 55253..56551 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(56673..57047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 57000..57632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(57676..58902) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812028.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(58982..59521) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(59543..61195) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene ettA CDS 61321..61806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039167.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 61803..62990 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(63118..63246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018026767.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 63502..63768 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818624.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 63862..65592 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930261.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 65608..66993 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 67657..67959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 67963..68829 product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 68819..69703 product replication protein C, IncQ-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152924771.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene repC CDS complement(70045..71238) product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(71509..71781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 72387..72644 product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 72641..73063 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 73229..73999 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene trbJ CDS 74013..74240 product entry exclusion lipoprotein TrbK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718002.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene trbK CDS 74250..75881 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001405816.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene trbL CDS 76195..76425 product type I toxin-antitoxin system ptaRNA1 family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039740.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(76520..76915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(76912..77208) product type II toxin-antitoxin system antitoxin YacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene yacA CDS 77384..77638 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(77710..78297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(78588..79001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(79063..80157) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(80271..80813) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene orn CDS 80900..82168 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 82165..83058 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813309.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene rsgA CDS complement(83192..83950) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(83952..84506) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(84638..85015) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene rplS CDS complement(85133..85597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 85630..86082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(86118..87416) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(87416..88324) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene cysD CDS complement(88382..89125) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(89316..90392) product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926819.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(90389..91249) product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene cysW CDS complement(91318..92136) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926820.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene cysT CDS complement(92158..93183) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821528.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(93399..94040) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813333.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(94579..96393) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(96484..97413) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(97416..98165) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(98240..99163) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821521.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 99435..100382 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene mltB CDS 100494..101027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(101109..101714) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(101885..102793) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813345.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene cysM CDS complement(102806..103792) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene rfaD CDS complement(103789..104718) product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813350.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene rfaE1 CDS complement(104715..105932) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene lapB CDS complement(106003..106320) product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(106439..106732) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(106741..108462) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930101.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene rpsA CDS complement(108638..109327) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene cmk CDS complement(109324..110643) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064019.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene aroA CDS complement(110640..111518) product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930098.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(111539..112654) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene pheA CDS complement(112647..113780) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene serC CDS complement(113777..116431) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926826.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene gyrA CDS 116831..117427 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813377.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 117561..118295 product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene ubiG CDS 118297..118974 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813381.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 119003..120457 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene baeS CDS 120454..121140 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365781.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene baeR CDS 121250..122452 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815858.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 122455..124473 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071115.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 124478..125932 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071116.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(125890..127413) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(127521..127814) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 128055..128393 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 128413..129654 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812841.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene amt CDS complement(129773..130132) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(130138..131796) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene ptsP CDS complement(131862..132131) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(132161..132586) product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812601.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(132583..133560) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene gshB CDS complement(133678..134145) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene infC CDS complement(134302..136236) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene thrS CDS 136606..137676 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(137766..139145) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene purB CDS 139340..139957 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(140084..141208) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813026.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene mnmA CDS complement(141218..142621) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(142794..143897) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813056.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene aroG CDS complement(144124..144318) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene iscX CDS complement(144331..144672) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812453.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene fdx CDS complement(144677..146545) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926439.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene hscA CDS complement(146573..147085) product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812456.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene hscB CDS complement(147089..147412) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene iscA CDS complement(147418..147798) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene iscU CDS complement(147853..149061) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812462.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(149103..149630) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene iscR CDS complement(149787..150203) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(150524..152548) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812466.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene uvrB CDS 152643..153845 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 154008..154688 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930566.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene lexA CDS 154723..155211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 155291..155752 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976073.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene dut CDS complement(155814..156602) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene xth CDS 156816..157355 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 157693..157962 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene infA CDS complement(157956..159026) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene dinB CDS 159117..159335 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(159370..160122) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063819.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(160169..160822) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063820.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(160996..161799) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 tRNA 162022..162111 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 162240..163307 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816841.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 tRNA 163350..163426 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 164038..165033 product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929006.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(165109..165405) product acid-activated periplasmic chaperone HdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene hdeA CDS 165865..167448 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063733.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 note possible pseudo, frameshifted CDS complement(167510..167917) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812822.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(167917..168255) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931006.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(168269..170704) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene pheT CDS complement(170728..171750) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene pheS CDS complement(171849..172208) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812832.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene rplT CDS complement(172224..172421) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene rpmI CDS complement(172566..174593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 174847..175134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 175206..175418 product DUF3079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184524.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 175468..176085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 176180..177211 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 tRNA complement(177274..177350) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(177387..177462) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 177678..177754 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 177823..178344 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520197.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene ybjG CDS complement(178526..179602) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337703.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(179604..180539) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(180667..181203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 181337..181729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 181858..182592 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 182633..183919 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene purD CDS 183923..184882 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930863.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene hemF CDS 184879..185472 product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930864.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene nadD CDS 185472..185879 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene rsfS CDS 185894..186364 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813199.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene rlmH CDS 186380..187006 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813200.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 186999..188462 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene rng CDS complement(188536..190314) product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene msbA CDS 190429..191370 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 191363..192136 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(192133..193005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(193434..194282) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926808.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(194269..195417) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(195417..198905) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene dnaE CDS 199008..199907 product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995005.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene lpxO CDS complement(200159..203998) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene hrpA CDS 204112..205176 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 205173..205988 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(206009..206851) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926808.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(206862..207809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 208017..208955 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene glyQ CDS 208957..211098 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene glyS CDS 211095..211718 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene gmhB CDS 211721..212446 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 212436..213287 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064980.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 213292..213687 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064979.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene gloA CDS 213700..214929 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 214946..216130 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 216138..217520 product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 217540..218727 product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 218761..219774 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene dusB CDS 219814..220059 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814221.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 220103..221695 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814223.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene purH CDS 221697..222266 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene ruvC CDS 222363..222938 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene ruvA CDS complement(223012..224301) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368593.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 224544..225347 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975631.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 225395..226171 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(226304..227320) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814005.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene ilvC CDS complement(227420..227911) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene ilvN CDS complement(227921..229633) product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(230048..231214) product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene ubiM CDS 231342..232754 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene argA CDS 232821..233093 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813239.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 233332..235095 product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene sulP CDS complement(235190..235594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(235646..236719) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114351.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene alr CDS 236847..237314 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 237370..237810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(237863..239188) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(239236..240492) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930578.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(240531..241559) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(241704..242597) product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene thpD CDS complement(242594..242995) product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810601.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(242992..244299) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene ectB CDS complement(244336..244821) product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930801.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene ectA CDS complement(244818..245366) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(245410..245985) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(245982..248330) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene parC CDS complement(248360..250327) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033451799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 250623..250949 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene trxA CDS 251036..252295 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene rho CDS complement(252394..253317) product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385284.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 253379..254029 product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene lysE CDS complement(254096..257695) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 257823..258200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 258207..259385 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 259454..262207 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene glnE CDS 262268..262945 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(262961..265639) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152615065.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(265743..266480) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene hutC CDS complement(266619..268133) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101754.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(268133..269704) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(269809..271473) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895695.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene hutU CDS complement(271614..272537) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704354.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene hutG CDS complement(272548..273687) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene hutI CDS 274142..274516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(274548..275375) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(275446..276180) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812422.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene lolD CDS complement(276173..277453) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 277544..278515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 278497..280206 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene recJ CDS 280332..281087 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099722191.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(281112..282080) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 tRNA 282274..282348 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 282473..284401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(284380..284871) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene ybaK CDS complement(284880..285770) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene xerD CDS 286029..286940 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(287001..288389) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene fumC CDS 288596..289144 product bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814329.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 289126..290502 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 290529..292499 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039151.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene mutL CDS 292546..293517 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065014.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene miaA CDS 293566..293952 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104772.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(294062..295111) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene purM CDS 295207..295908 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065012.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene hda CDS 295905..296624 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 296621..297997 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene pcnB CDS 297997..298494 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(298570..298908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(299081..300610) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064992.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(300646..302784) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 302920..303294 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 303372..304775 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene leuC CDS 304784..305452 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926388.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene leuD CDS 305508..306584 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812648.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene leuB CDS 306690..307820 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene asd CDS 307834..309288 product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(309402..309599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 309513..310103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 310241..311335 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812637.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 311442..312083 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 312105..313784 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930387.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 313868..314497 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(314571..315377) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(315388..316461) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene aroC CDS complement(316538..318088) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(318085..318489) product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 318560..319786 product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 319832..320287 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812703.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(320245..321279) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene dusA CDS 321530..322498 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 322528..323310 product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064051.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 323498..324097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 324240..324485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 324505..324840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 324975..325223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 325355..326260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 326257..326934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(327314..327586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 329105..331078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 331203..331781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(331806..332396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(332618..333484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(333496..333732) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812728.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(333934..335100) product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(335120..337552) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207286.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(337799..338791) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(338814..339254) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175137776.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(339523..340062) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene ppa CDS complement(340091..341614) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(341619..342797) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(342794..343624) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(343626..344588) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812742.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene hemC CDS complement(344585..344707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(344730..345437) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930986.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(345643..346536) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812748.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene sucD CDS complement(346559..347719) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene sucC CDS complement(347738..348340) product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(348443..350740) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930989.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene metE CDS 350873..351796 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812755.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(351756..352229) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930990.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene recX CDS complement(352213..353295) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene recA CDS complement(353458..355083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 tRNA complement(355140..355215) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(355252..355500) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(355630..355950) product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813915.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(355947..357437) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene nuoN CDS complement(357447..358946) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(358946..361015) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene nuoL CDS complement(361015..361323) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813920.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene nuoK CDS complement(361320..361967) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(361994..362482) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene nuoI CDS complement(362511..363584) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene nuoH CDS complement(363584..365914) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813928.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene nuoG CDS complement(365929..367263) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene nuoF CDS complement(367260..367802) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene nuoE CDS complement(367899..369155) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(369158..369751) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(369773..370249) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813941.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(370270..370629) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(370970..372103) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(372335..373411) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930790.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene hisC CDS complement(373412..374848) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063931.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene der CDS complement(374852..376021) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene bamB CDS complement(376056..376697) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(376748..378052) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063933.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene hisS CDS complement(378049..379413) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063934.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene ispG CDS complement(379428..379913) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(379910..381061) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040078.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene rlmN CDS complement(381082..381507) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene ndk CDS complement(381687..382169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 382398..385295 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063937.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 385300..385986 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 386038..387420 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930796.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(387462..388229) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene trmD CDS complement(388251..388820) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063944.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene rimM CDS complement(388807..389064) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926757.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene rpsP CDS 389376..390155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(390266..390556) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene ftsB CDS complement(390581..391867) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene eno CDS complement(391918..392769) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene kdsA CDS complement(392789..394465) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 394655..396301 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 396433..397065 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809425.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene upp CDS complement(397150..397650) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111906.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 397734..399077 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551357.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(399154..399525) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene gcvH CDS complement(399539..400156) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037422.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(400370..401650) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(401657..403918) product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 404320..405372 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389542.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(405572..406138) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene dcd CDS complement(406245..409745) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(409742..411499) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(411601..412689) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448044.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene apbC CDS 412878..413144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808374.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 413247..415349 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene metG CDS complement(415430..415999) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267916.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 416141..416929 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 416945..418063 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 418352..420172 product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192163.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 420223..420438 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196981.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene nrdD CDS 420435..421217 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196980.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(421233..421967) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064495.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(422042..423562) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694565.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(423559..425415) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050273.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(425425..426474) product multidrug transporter subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210376.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene mdtN CDS complement(426481..426750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(426848..428089) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene trpB CDS 428482..428817 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(428705..431566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(431663..432229) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(432412..433173) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(433167..434243) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(434227..435444) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050577584.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(435460..436629) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(436691..439045) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063676826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(439314..440330) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114934.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(440334..440846) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 441082..444561 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 444558..444887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167514967.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(445055..445711) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(445719..447671) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene acs CDS complement(447740..449404) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(449401..449712) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 449940..450701 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(450726..451229) product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 451409..451684 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 451762..452871 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038487.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 453135..454160 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(454253..454951) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930986.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 455194..457407 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816437.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 457435..458637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 458723..459382 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807659.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(459527..460246) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931199.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 sequence12 source 1..380657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 285..665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(813..1088) product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 1289..2353 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814588.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene pyrC CDS complement(2394..4277) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 5101..5502 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931263.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene mraZ CDS 5515..6555 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814582.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene rsmH CDS 6558..6857 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931262.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene ftsL CDS 6854..8587 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 8584..11439 product bifunctional UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase MurE/UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase MurF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039092.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene murF CDS 11429..12601 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene mraY CDS 12598..14142 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene murD CDS 14139..15338 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814574.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene ftsW CDS 15335..16411 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene murG CDS 16408..17814 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene murC CDS 17811..18764 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 18776..19582 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814570.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 19587..20813 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814569.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene ftsA CDS 20985..22154 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene ftsZ CDS 22368..23213 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene lpxC CDS complement(23279..23770) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931255.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 23822..24844 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 24969..27710 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene secA CDS 28003..29766 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201704.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 29837..30928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(30944..32407) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814555.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene mgtE CDS complement(32404..32820) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(33049..34044) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(34343..35668) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(35665..36294) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721136.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(36365..37360) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 37456..39480 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 39483..40112 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(40163..41371) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(41433..42305) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 42469..44367 product FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064963.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene mnmC CDS 44476..46755 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 46943..48001 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 47982..48635 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247918.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 48928..49734 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814540.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 tRNA 49798..49873 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(50069..51595) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene dbpA CDS complement(51603..52385) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(52398..53171) product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966163.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(53195..54367) product DUF3734 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089764.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 54565..56094 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene proP CDS 56203..57000 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 57025..57588 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 57813..58544 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 58541..59299 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 59301..60062 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393480.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 60078..61079 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 61113..62141 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 62155..62577 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815599.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 62580..63371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 63368..64882 product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064659.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 64945..66009 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809021.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 66006..67328 product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812390.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 67325..68083 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818996.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 68076..68867 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 68869..70491 product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189272.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 70647..71681 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 71792..72232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 72292..72633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(72587..73810) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(73858..74862) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104032.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 75151..76020 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266332.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 76017..76886 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 76971..78089 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 78089..80770 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(80742..82271) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814298.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(82423..83475) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930965.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene murB tRNA 83586..83661 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 83729..83804 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(83911..84828) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 84941..85573 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 85669..86724 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 86788..87405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(87434..88510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(88531..91203) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161788737.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(91307..92059) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465919.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(92118..92645) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(92928..96236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(96376..97089) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808473.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 97272..97448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 97503..99752 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551717.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 99787..100467 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112849.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 100467..101561 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(101575..102096) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(102093..102845) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972971.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(102870..103646) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762766.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(103643..104380) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(104380..105771) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926974.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(105768..106598) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104115.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(106648..108048) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679739.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(108041..108952) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930973.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(109299..110780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(110851..112245) product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384989.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 112403..113440 product low conductance mechanosensitive channel YnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559908.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene ynaI CDS 113618..114916 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 114933..115838 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085968.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 115838..116782 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 116796..117539 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085970.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 117539..118201 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 118227..119663 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448980.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 119668..120423 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(120471..121595) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(121687..123123) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531252.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 123256..124173 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene pdxS CDS 124176..124814 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene pdxT CDS complement(124863..126077) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810872.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 126291..127178 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(127242..127730) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384214.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 127865..128845 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 128965..129318 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388133.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 129399..130151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 130416..131744 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526889.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 131823..133631 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 133616..134947 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082756.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(134954..136249) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 136414..137670 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(137730..139109) product beta-alanine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083801.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene bauA CDS 139218..140120 product HTH-type transcriptional activator BauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083805.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene bauR CDS 140356..143415 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086527976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene fdnG CDS 143430..144335 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209611.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene fdxH CDS 144332..145003 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705520.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene fdnI CDS 145000..145935 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027703.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene fdhE CDS 145946..146563 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530121.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(146568..147395) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(147419..148252) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339510.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(148257..149258) product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561204.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(149303..150583) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723068.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(150602..151156) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(151594..152721) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(152723..155548) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene rbbA CDS complement(155552..156631) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(156641..158092) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(158304..159212) product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533364.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(159322..160383) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 160548..160970 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 161150..162118 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808362.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene rocF CDS 162260..163774 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365702.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(163734..164219) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206578.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 164334..168104 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105271.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene putA CDS complement(168154..169587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(169674..172211) product TonB-dependent alcaligin siderophore receptor FauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene fauA CDS complement(172304..173293) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(173290..173832) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(173958..174617) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097286.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 174707..175558 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104043.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 175690..176325 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(176270..177343) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039952.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 177540..179051 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(179067..179327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(179266..180516) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 180694..180990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 180990..181325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 181390..182337 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974703.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(182414..183589) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(183666..184499) product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene efeO CDS complement(184598..185902) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene efeB CDS complement(185931..187082) product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268391.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene efeO CDS complement(187119..188012) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268390.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(188119..188769) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033468060.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(188762..189799) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269420.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(189835..190563) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706774.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(190576..191967) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene mgtE CDS complement(192302..193660) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(193654..196059) product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 196239..196673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 196744..197406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(197416..198402) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(198399..199259) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770465.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(199246..200046) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(200088..201140) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091586.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(201275..201622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 201896..202144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 202141..202401 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene infA CDS 202495..202704 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930551.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(202796..203254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(203251..204588) product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164390.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene pgaC CDS complement(204585..206609) product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212043.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene pgaB CDS complement(206638..209037) product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082816276.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene pgaA CDS 209559..210698 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494103.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 210713..211933 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 211959..212642 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452211.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene lolD tRNA complement(212695..212768) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 213033..215348 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083112.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 215527..216675 product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene yiaY CDS 216810..218363 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003668.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(218353..221397) product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene mexK CDS complement(221394..222374) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193758.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 note possible pseudo, frameshifted CDS 222610..223569 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269178.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene rarD CDS 223580..224338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 224349..224792 product DUF6386 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143346859.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 225250..226053 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 226106..227044 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 227135..227959 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 227956..228786 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038928.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 228870..229949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 229946..230641 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(230648..230950) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770289.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 231090..232181 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103986.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(232228..233115) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921297.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(233112..233753) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 233870..234442 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(234485..234709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 234599..236527 product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763703.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 236544..237278 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269182.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(237370..238572) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208741.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(238704..239033) product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173256.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 239187..239516 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807743.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(239535..241124) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114989.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(241283..242215) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 242363..242827 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093668.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene bfr CDS complement(242994..243413) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385269.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 243648..244409 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 244700..245365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 245420..246319 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975805.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 246578..248695 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817438.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 248752..249987 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809565.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 249984..250118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 250141..252867 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040291.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 252864..256337 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040290.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 256334..257887 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(257826..258638) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086914.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(258710..259540) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(259558..260454) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(260468..261730) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(261767..262933) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929634.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(262930..263718) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422126.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 264035..264598 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525522.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene ahpC CDS 264869..266431 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene ahpF CDS complement(266530..267000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(267035..268432) product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038296.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(268429..271401) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(271492..272319) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925978.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene mutM CDS 272393..274249 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931312.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 274246..274842 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818921.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene lolB CDS 274839..275762 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808500.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene ispE tRNA 275764..275839 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 275958..276908 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 277033..277635 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808505.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 277728..278318 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931308.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene pth CDS 278322..279137 product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039053.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 279251..280342 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808511.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene ychF CDS 280555..282036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 282094..282636 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406891.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 282633..283604 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103142.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 283691..286072 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065177.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(286159..287772) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895566.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 287809..287970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 288024..288506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 288641..288832 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812201.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(288919..289638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(289647..290444) product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063708.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(290437..291504) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063707.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(291548..292153) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197292.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene ribB CDS complement(292565..293458) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 293558..295018 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 295162..295977 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811298.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 296257..297660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 297712..298872 product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976508.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(298927..299823) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038233.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(299952..300881) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(300969..301769) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929592.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(301873..303156) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528489.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 303606..304847 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(304912..305364) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(305448..306152) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813772.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(306355..306780) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(306788..308290) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821370.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 308414..309574 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040214.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene lptF CDS 309725..310678 product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813758.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 310869..311219 product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065111.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(311240..311890) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447287.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 312017..312424 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 312432..313721 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 314020..315828 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525719.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(315948..316889) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930902.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene hslO CDS complement(316899..317420) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040199.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(317435..318784) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(318895..319440) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065147.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(319681..321453) product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(321459..321893) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813670.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(321936..323195) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810251.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(323312..324355) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene holA CDS complement(324369..324896) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene lptE CDS complement(324900..327593) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene leuS CDS complement(327732..329447) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098825.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(329646..331391) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(331539..332513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(332702..333490) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(333487..335388) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(335385..336605) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810076.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(336771..336941) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene rpmG CDS complement(337040..337282) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene rpmB CDS complement(337364..338161) product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene siaD CDS complement(338158..338544) product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene siaC CDS complement(338563..339117) product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene siaB CDS complement(339114..341117) product biofilm regulation protein phosphatase SiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene siaA CDS complement(341155..341568) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391524.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(341847..342197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(342309..342980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(343059..344270) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(344270..345187) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 345570..346619 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 346725..347582 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810306.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 347579..348850 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 348897..349271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 349313..350056 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930714.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 350113..351084 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039423.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 351133..352104 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039423.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 352117..353010 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810324.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 353010..353804 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092883.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 354007..355236 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 355305..358511 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 358508..360019 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 360036..360500 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810346.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene acpS CDS 360636..361646 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene nagZ CDS 361609..363429 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930726.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene uvrC CDS 363458..364027 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene pgsA CDS 364037..365335 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(365363..366154) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039343.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 366299..367090 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809990.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 367221..368795 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 368798..369592 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479178.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(369688..370479) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247344.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(370472..371128) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(371125..371811) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039348.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 371916..373430 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039349.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene cysS CDS 373452..374117 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 374164..375129 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 375164..376300 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452888.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene tilS CDS 376356..377624 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930633.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 tRNA 377652..377744 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 377848..378246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(378292..378822) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481682.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 378945..379907 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113809.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 379939..380250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 sequence13 source 1..271485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..1170) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(1167..4376) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(4376..5050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(5050..5730) product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932365.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(5787..7067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(7057..8880) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(8898..9890) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041807480.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(9917..10234) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895635.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(10396..11586) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525821.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(11770..13287) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene mnmE CDS complement(13315..14019) product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(14169..15881) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene yidC CDS complement(15966..16262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(16256..16645) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(16642..16830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 17015..18499 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816024.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene dnaA CDS 18502..19611 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929839.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene dnaN CDS 19633..22095 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816022.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene gyrB CDS 22562..23134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 23138..24076 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112389.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 24157..26610 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 26734..27312 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 27389..28546 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816013.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 28550..28834 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 28800..29339 product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(29352..31043) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063734.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(31128..31733) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067512.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 31833..32816 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064444.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 32862..34157 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(34058..34264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(34306..34887) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(34913..35491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(35493..36035) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 36244..37416 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550638.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(38187..39488) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(39522..40334) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088390.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 40508..41248 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(41245..42072) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene panB CDS complement(42125..44512) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(44602..45489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(45479..46000) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(46081..46551) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 46655..48409 product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815985.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene ilvB CDS 48478..49197 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(49285..51954) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040782.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(52101..52958) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818220.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene gluQRS CDS complement(53028..53492) product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(53547..55154) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038744.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 55384..55923 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(56005..58077) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706114.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene cirA CDS 58337..59077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(59127..59810) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040736.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(59821..60600) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931638.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(60624..61133) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene mlaD CDS complement(61143..61928) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene mlaE CDS complement(61925..62758) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931636.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 62903..64192 product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(64333..64965) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(65079..65816) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(65825..67567) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene argS CDS complement(67604..71377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 71477..71827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 tRNA 71915..71990 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(71978..72322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 72420..73721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(73722..75926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 76126..77334 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(77432..77884) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815821.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(77903..78514) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815819.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(78630..79493) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815818.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(79518..80906) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(80977..81633) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815815.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene petA CDS 81851..82312 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene mscL CDS complement(82318..83097) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927226.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 83134..84270 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446841.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(84296..85063) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene tatC CDS complement(85060..85593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(85608..85862) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene tatA CDS complement(85891..86280) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(86281..86610) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815805.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(86618..87028) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815804.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene hisI CDS complement(87033..87827) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815802.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene hisF CDS complement(87862..88614) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene hisA CDS complement(88659..89291) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene hisH CDS complement(89288..89875) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene hisB CDS complement(89892..90698) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 90832..91401 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066552.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 91446..92564 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene nspC CDS complement(92582..92872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 92762..93838 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336769.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(93898..94515) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368594.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 94750..95772 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405967.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 95766..97565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 97687..98745 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene rffG CDS complement(98776..99999) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(100001..102823) product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815975.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene rcsC CDS complement(102877..103512) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365624.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene rcsB CDS complement(103534..106848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(106895..107104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(107234..107938) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529671.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 108147..108470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 108598..109872 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 110056..110463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 110520..111053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 111276..111815 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012417445.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 111836..112591 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112554.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 112588..115083 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535295.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 115074..116234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 116315..116719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 116716..117927 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene fabF CDS 118065..118904 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814203.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene galU CDS 119523..120416 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(120547..120858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 120850..122280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 122290..122874 product UDP-2-acetamido-3-amino-2,3-dideoxy-D-glucuronate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene wbpD CDS 122889..124070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 124103..125191 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208046.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 125211..126443 product O-antigen flipase Wzx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119725.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene wzx CDS 126440..127051 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene hisH CDS 127052..127801 product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 127879..129102 product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 129145..130305 product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 130361..131476 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 132061..132813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(134281..135555) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289498.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 136460..137758 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 139038..140156 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331385.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene gmd CDS 140169..141125 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167741.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 141122..141847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 141853..142872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 142880..143989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(144038..145492) product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(145525..146535) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707765.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene galE CDS complement(146639..147703) product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene wzzB CDS complement(147846..148826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(149172..150719) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(150716..151153) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446144.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(151166..152158) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816062.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(152261..153706) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929564.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(153684..154373) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(154389..154922) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806996.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 155060..156025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 156124..157458 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086001.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene rimO CDS 157664..158230 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 158274..159494 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968609.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(159554..160876) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809610.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 161126..162877 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 162974..163300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 163290..164036 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525015.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 164057..165001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 164998..166224 product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827568.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 166328..166756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 166918..168912 product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(169024..169725) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 169779..170156 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene crcB CDS complement(170171..171862) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706826.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene cydC CDS complement(171846..173648) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043601.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene cydD CDS complement(173645..174244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(174357..175493) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene cydB CDS complement(175495..177084) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707370.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene cydA CDS complement(177163..177546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(177682..178737) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477386.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 178976..179833 product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220332954.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene ehuB CDS 179833..180504 product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220332953.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene ehuC CDS 180506..181198 product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209942630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene ehuD CDS 181195..182046 product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209942632.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene ehuA CDS complement(182082..183281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 183541..184500 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384590.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 184501..185007 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537806.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 185007..186494 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384588.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 186635..188350 product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102300.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 tRNA complement(188413..188488) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 188783..190057 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064647.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene hemA CDS 190208..191287 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807618.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene prfA CDS 191395..192153 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927443.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene prmC CDS 192297..192623 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807622.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene grxD CDS 192623..193192 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807624.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(193209..194390) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038719.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(194581..196134) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038720.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(196493..197620) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088689.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 197871..199127 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035603.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 199501..199716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(200163..201878) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815908.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene leuA CDS complement(202272..203027) product DUF2968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(203085..204503) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(204524..206707) product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810187.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(206718..207134) product DUF3613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(207159..208055) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(208056..209048) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810184.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(209051..209992) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(209992..211347) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810179.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(211370..212644) product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928513.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(212676..214022) product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930682.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(214038..215006) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810173.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene cpaB CDS complement(215003..215533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(215530..216102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(216099..216599) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820213.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(216685..216867) product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810167.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(217080..218396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(218720..220453) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930677.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(220465..221793) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927240.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene rpoN CDS 221929..222231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 222449..222922 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene bfr tRNA 222963..223037 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 223194..223454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 223562..223861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 223876..224544 product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974832.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene feuP CDS 224534..225985 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(225930..226691) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926106.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 226814..227722 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927823.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(227680..229263) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815271.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene gshA CDS complement(229297..229509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 229961..231226 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815253.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 231213..231935 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene metW CDS 231932..233167 product muropeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040617.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(233146..234024) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(234044..236818) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(236915..238258) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905419.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene gdhA CDS complement(238501..239304) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815212.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(239394..240833) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 241216..241836 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084923.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 241875..242735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(242827..244116) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063884.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(244190..245758) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808462.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene pgi CDS complement(245770..246489) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene mtgA CDS complement(246510..247394) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931247.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene aroE CDS complement(247391..248293) product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567783.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(248337..250229) product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(250260..251696) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814955.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene mpl CDS complement(251702..252142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(252154..253092) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040548.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(253105..254181) product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(254196..255110) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814950.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene prmA CDS complement(255141..256487) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene accC CDS complement(256496..256942) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene accB CDS complement(257029..257472) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814953.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene aroQ CDS complement(257542..258105) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040551.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(258102..258971) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814657.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(258989..259996) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(260059..260727) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814652.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene ybgF CDS complement(260877..261389) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814650.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene pal CDS complement(261443..262672) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene tolB CDS complement(262781..263908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(263928..264383) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene tolR CDS complement(264383..265060) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040483.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene tolQ CDS complement(265130..265570) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene ybgC CDS complement(265591..267327) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 267426..267965 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 268090..268539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814613.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 268539..268835 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814611.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 269104..269877 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814609.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(269831..270625) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene lgt CDS 270798..271340 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931268.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene msrA sequence14 source 1..250708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 334..645 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806903.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene rpsJ CDS 928..2556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 2790..4295 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 4411..4662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 4757..6820 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 6817..8226 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 8329..8955 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809051.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 9107..20149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 20237..21808 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205888.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(22129..24045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 24077..26326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 26329..27798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(27882..28118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(28121..30214) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 30346..31764 product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523251.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 31761..32429 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 32426..33103 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809046.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 33131..35149 product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809044.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(35232..35675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 36125..36811 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene rplC CDS 36815..37447 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene rplD CDS 37444..37740 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene rplW CDS 37741..38571 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene rplB CDS 38584..38859 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806908.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene rpsS CDS 38863..39192 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925688.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene rplV CDS 39202..39996 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806910.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene rpsC CDS 39999..40415 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene rplP CDS 40439..40630 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene rpmC CDS 40633..40926 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene rpsQ CDS complement(40975..42981) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625994.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(43178..45190) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973161.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(45192..46439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(46436..47200) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(47209..49131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 49366..50301 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811101.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 50375..51739 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039236.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 52093..52743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665896.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 52770..53732 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene dctP CDS 53744..54244 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811094.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 54237..55535 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811093.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 55683..56204 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103465.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 56214..57230 product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206008.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 57338..59788 product Fe(3+)-pyochelin receptor FptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111969.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene fptA CDS 60039..60407 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene rplN CDS 60418..60750 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene rplX CDS 60760..61299 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806918.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene rplE CDS 61311..61616 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806919.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene rpsN CDS 61627..62022 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene rpsH CDS 62033..62566 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064757.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene rplF CDS 62588..62953 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806922.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene rplR CDS 62969..63490 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806923.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene rpsE CDS 63494..63679 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806924.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene rpmD CDS 63691..64134 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064755.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene rplO CDS 64151..65491 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene secY CDS 65499..65717 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene infA CDS 65898..66263 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806929.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene rpsM CDS 66279..66680 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806930.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene rpsK CDS 66692..67315 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806931.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene rpsD CDS 67449..68444 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064754.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene rpoA CDS 68647..69036 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806934.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene rplQ CDS complement(69128..70741) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064231.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(70777..71964) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815941.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene metC CDS complement(71981..72598) product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104118.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(72661..73467) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104117.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(73454..74143) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762766.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(74133..74873) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104116.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(74870..75733) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104115.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(75834..76694) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104115.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(76919..77842) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762770.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 tRNA 77298..77389 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 77951..78313 product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 78407..80296 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene dsbD CDS complement(80427..81443) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806939.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene hemB CDS complement(81440..82063) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806940.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene yihA CDS 82304..82999 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806941.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 83122..85263 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806942.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 85260..86594 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806943.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene ccsB CDS complement(86654..87943) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806944.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene lysA CDS 88374..88703 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806945.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene cyaY CDS complement(88777..89439) product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(89570..92020) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806946.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 92138..93832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 93952..95106 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806949.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(95119..95787) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(95886..96734) product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392933.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(96734..98881) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(98878..99672) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995898.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(99669..100763) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261267.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(100765..101823) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 102103..102909 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 103036..103959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(103990..104805) product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040504.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 105068..105814 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724030.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(105817..108858) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806951.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene uvrA CDS 108945..110126 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 110334..110858 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene ssb CDS complement(110999..112045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(113934..114992) product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234015.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene bdhA CDS 115158..115643 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 115813..117168 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 117215..118390 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930844.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 118387..119994 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813155.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 120532..120876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 note possible pseudo, frameshifted CDS 121032..121931 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206541.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 122073..122828 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389841.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 122831..123502 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 123521..124258 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(124340..124696) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(124803..125516) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328869.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(125625..126473) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192193.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(126522..127148) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002031361.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(127329..128579) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(128751..129938) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815941.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene metC CDS complement(130047..131354) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113728.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(131358..132371) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089248.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(132375..133610) product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 133609..133842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(133830..134540) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108359.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 134672..136462 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene aspS CDS 136503..137363 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807040.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 137368..137637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 137665..138015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(138079..139419) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807049.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 139587..140558 product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905414.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene waaC CDS 140558..141934 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929616.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 142040..142978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(143004..143183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(143176..143988) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929617.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(143985..144836) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447888.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 144885..146018 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929619.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 146022..146831 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807131.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 146818..147753 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 147750..148373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 148404..149060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064728.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 149179..150360 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 150383..150679 product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807142.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 150676..151332 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064724.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene lipB CDS 151468..152499 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807146.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene lipA CDS 152502..153548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(153549..154451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(154466..155008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925948.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(155121..155828) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(155928..157289) product C4-dicarboxylate transport transcriptional regulatory protein DctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529421.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene dctD CDS complement(157286..159127) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389190.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 159353..160738 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532939.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 160897..161922 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192521.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 161934..162857 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 162864..163307 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(163389..164504) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 164659..165762 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 165783..168218 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810200.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(168267..169316) product pyoverdine signaling pathway anti-sigma factor FpvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115643.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene fpvR CDS complement(169330..169917) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 170034..170798 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404105.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 170802..171488 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085934.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 171485..172231 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 172244..173020 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404100.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 173039..174043 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813837.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene msrP CDS 174050..174724 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065084.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene msrQ CDS complement(174772..176043) product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705088.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene nasR CDS complement(176069..176869) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087845.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene cobA CDS complement(176869..181050) product bifunctional nitrate reductase/sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205569.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(181091..181906) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367094.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(181923..182711) product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705090.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene ntrB CDS complement(182732..183976) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(184050..184400) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268220.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene nirD CDS complement(184397..186952) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268219.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene nirB CDS 187454..188869 product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175593.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene hutW CDS 188866..189417 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene hutX CDS 189414..190082 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(190089..191420) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064722.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene hslU CDS complement(191426..191965) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene hslV CDS complement(192051..193478) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304032.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 193670..194917 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(194989..195450) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807164.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene dksA CDS complement(195490..196614) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038705.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(196737..197246) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807166.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 197434..197613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 197618..198367 product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene aztA CDS 198370..199266 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931287.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 199303..200478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 200439..201179 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064716.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 201239..202243 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243298.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 202325..202876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 202876..203811 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112389.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 203890..206427 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113525.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 206550..207578 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550695.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 207715..209766 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931283.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 209776..210564 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415118.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(210522..211868) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931316.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(211874..212590) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808473.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(212631..213353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 213469..214086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(214156..215124) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064714.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene xerC CDS complement(215249..215980) product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931281.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(215980..216852) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064712.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene dapF CDS complement(216869..217777) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807185.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(217770..218702) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 219006..220163 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925730.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene metK CDS complement(220238..221431) product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170056.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene lhgO CDS complement(221494..222342) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808840.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(222350..223489) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055981.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene ssuD CDS complement(223486..224712) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115339.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(224719..225933) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(225939..226544) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089470.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene msuE CDS complement(226559..227410) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385041.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(227407..228777) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266344.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(228779..229591) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385041.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(229703..230965) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089457.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(230956..232215) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106870.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(232258..232908) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385044.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(232892..234061) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537514.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(234084..234905) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188447.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(234968..235774) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188447.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(236009..237130) product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(237163..237978) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063885.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 238293..239459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 239486..240322 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808828.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 240392..241174 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 241171..241632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 241895..243628 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 sequence15 source 1..219132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(303..2294) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222257.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 2456..3358 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811054.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 3574..4428 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816500.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 4458..5522 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 5622..6290 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811059.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 6287..7570 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811061.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 7662..8345 product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 8434..9777 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930606.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(9826..12636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(12636..13289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(13282..14613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(14677..15537) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929592.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(15527..16546) product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(16543..17433) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814793.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(17430..18251) product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095795.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene tauC CDS complement(18255..19289) product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene tauA CDS complement(19452..20636) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(20769..22268) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811138.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 22379..22858 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035518.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 22891..23316 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817404.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 23652..24527 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038818.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(24613..26196) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539579.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(26220..27134) product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411794.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene kdgD CDS 27395..28522 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089439.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 28628..29635 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693870.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 29659..30177 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066705.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 30174..31454 product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153839.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene yiaN CDS 31547..32440 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(32376..32612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 32711..33076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(33098..33661) product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310799.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene mddA CDS complement(33615..34652) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268352.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 34767..35930 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114439.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(36068..36988) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811152.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 37116..37331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(37378..39588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 39703..40086 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024360564.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 40025..40378 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(40755..42158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(42169..43038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(43028..44845) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040261.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(44948..51229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(51358..52923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(52928..53575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(53572..54111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(54170..55045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(55042..56028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(56038..57036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(57038..58501) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011854072.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(58513..59742) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(59764..60414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(60429..61982) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937576.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(61979..62938) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene cpaB CDS complement(62946..63491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(63516..63761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(63845..65329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(65316..65984) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(66172..66969) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929751.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(66966..68003) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815443.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(68000..68857) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 69059..69574 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815434.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 69583..70590 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 70807..73056 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279435.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 73083..74396 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550626.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 74537..75166 product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972364.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(75248..76231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(76322..77206) product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932141.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene modD CDS complement(77268..78716) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814704.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 78798..79397 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927085.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(79339..80085) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene queC CDS 80261..80953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 81073..82257 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(82277..82999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 83002..83949 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037685.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene asd CDS complement(83955..84746) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033454723.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 85069..86742 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173726.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 86851..87804 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090644.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 87807..88697 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090643.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 88694..89755 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966121.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 89752..90777 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090640.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 90801..91988 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 92036..93289 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930854.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(93302..94255) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930233.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(94271..94999) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040140.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(95022..95717) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810420.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(95710..96393) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810422.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(96415..97236) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040138.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(97285..98487) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810425.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(98489..99163) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 99372..101171 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene ggt CDS 101339..101782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(101801..102178) product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087586.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(102311..102586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(102859..104676) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975023.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(104833..106785) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109062841.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(106911..107369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(107408..108613) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235369.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene sstT CDS 108888..109289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(109391..110272) product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene tauC CDS complement(110269..111093) product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767098.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene tauB CDS complement(111112..112098) product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105422.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene tauA CDS 112337..113293 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene phnD CDS 113325..114161 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene phnC CDS 114235..115068 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene phnE CDS 115065..115862 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene phnE CDS complement(115943..116656) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 116759..117160 product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 117206..117532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 117597..118394 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 118391..119170 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815783.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 119180..119437 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 119430..120698 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927222.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene murA CDS 120695..121384 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931640.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene hisG CDS 121413..122708 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene hisD CDS complement(123334..124161) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene murI CDS complement(124261..124821) product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083151.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(124866..125924) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(125924..126538) product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083151.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(126535..127365) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(127362..128267) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689241.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(128264..129574) product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(129574..131478) product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083147.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene nosZ CDS complement(131515..133713) product NosR/NirI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204371611.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 134061..134798 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815414.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 134795..135274 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200499.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene dtd CDS 135612..137330 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297977.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene lldP CDS 137306..138127 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686511.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene lldR CDS 138124..139254 product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369183.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene lldD CDS 139327..141072 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064842.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene dld CDS 141714..143258 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064890.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene trpE CDS 143284..143847 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815390.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 143871..144896 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817833.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene trpD CDS 144903..145697 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene trpC CDS complement(145795..146172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(146343..146786) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098273.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(146845..148032) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089925.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(148034..149452) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926009.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(149442..149792) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040456.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(149782..150921) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808671.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(150944..151738) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(151776..152654) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(152647..153753) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104057.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(153778..154806) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965491.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 154960..155886 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741798.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(155915..156580) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(156629..157477) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225835.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 157787..158584 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203116.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 158596..159783 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064401.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 159794..160582 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808963.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(160601..161437) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390023.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(161434..162276) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(162273..163112) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401131.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(163112..164065) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970012.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(164081..165634) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537499.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(165687..166964) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838638.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 167132..168061 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089943.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(168282..168833) product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310516.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(169041..169964) product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 170029..171552 product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448382.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene pap CDS 171610..172068 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(172082..172633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(172665..174497) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815700.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene glmS CDS 174779..175285 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815701.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(175257..176591) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064822.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(176588..177961) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818080.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene glmU CDS complement(178032..178730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815722.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 179004..179843 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040726.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(179918..180241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 180322..180705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(180718..181437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(181513..182403) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040728.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene rpoH CDS 182568..183575 product SdiA-regulated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105587.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 183556..184407 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931631.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene fghA CDS 184437..185144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931632.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(185146..186339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(186336..188258) product Vi polysaccharide transport protein VexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052242.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene vexE CDS complement(188251..189423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(189407..190117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(190127..191473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(191475..192629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(192662..194719) product Vi polysaccharide biosynthesis glycosyltransferase TviE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632616.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene tviE CDS complement(194716..197196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 197950..202713 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040732.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 202754..204226 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931634.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 204419..205153 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 205150..205470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 205580..206641 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 206638..207645 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815914.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 207645..208460 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815917.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 208457..209317 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815918.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 209323..210321 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815920.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 210375..211199 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(211215..212282) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(212360..212797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(212794..213189) product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(213289..215760) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112989.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(215841..216857) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(216854..217378) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(217552..218580) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene adhP misc_feature complement(218603..>219132) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926498.1:aldehyde dehydrogenase locus_tag LOCUS_30430 sequence16 source 1..157642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(221..2326) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806902.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene fusA CDS complement(2404..2874) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806901.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene rpsG CDS complement(3017..3394) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene rpsL CDS complement(3617..3928) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811835.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene fliE CDS 4250..5923 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063741.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene fliF CDS 5901..6923 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817203.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene fliG CDS 6982..7668 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063740.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene fliH CDS 7665..9131 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene fliI CDS 9106..9561 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926566.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene fliJ CDS 9576..10841 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039847.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 11006..11566 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039846.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene fliL CDS 11572..12579 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811852.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene fliM CDS 12576..13169 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063737.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene fliN CDS 13185..13532 product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978276.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene fliO CDS 13529..14293 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811856.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene fliP CDS 14309..14578 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene fliQ CDS 14601..15395 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene fliR CDS complement(15453..17048) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811863.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(17229..18824) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063733.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(19153..20748) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063733.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(20926..22617) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452234.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(22689..24560) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063733.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(24670..25941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(25995..27659) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811875.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene flgK CDS complement(27718..28761) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811877.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene flgJ CDS complement(28780..29904) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817185.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(29908..30639) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(30649..31434) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811883.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene flgG CDS complement(31481..32242) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817181.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(32245..33453) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097136.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene flgE CDS complement(33552..34253) product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811889.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(34283..34702) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817176.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene flgC CDS complement(34721..35140) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811894.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene flgB CDS 35275..36015 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811896.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene flgA CDS 36154..36477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 36483..36962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(37017..39644) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063732.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene flhF CDS complement(39650..41752) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811905.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene flhA CDS complement(41749..42906) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063731.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene flhB CDS complement(42918..43562) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817162.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene cheZ CDS complement(43584..43970) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811911.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene cheY CDS complement(44007..45074) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(45071..45820) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931672.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene cheD CDS complement(45817..46671) product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(46675..48414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(48445..48951) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811919.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene cheW CDS complement(48993..51014) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063729.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene cheA CDS complement(51017..51418) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811922.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(51429..52517) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811924.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene motB CDS complement(52534..53406) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811927.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene motA CDS complement(53483..54118) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926555.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene flhC CDS complement(54167..54493) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811931.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene flhD CDS 54893..55306 product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811821.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 55386..56855 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146755.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene fliD CDS 56862..57299 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811824.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene fliS CDS 57315..57656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 57653..58864 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063742.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 58861..59160 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811829.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 59281..60165 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene rfbA CDS 60170..61333 product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198210.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene vioA CDS complement(61334..63217) product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088712.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(63256..64620) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088711.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(64617..65312) product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene hddC CDS complement(65372..66544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(66545..67270) product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(67297..68172) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082140.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(68182..70134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(70178..70819) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(70819..71559) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(71556..72314) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198214.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(72314..73366) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(73373..73597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(73761..77321) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(77502..78341) product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(78513..79781) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772650.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(80025..80378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 80298..81122 product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211152.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 81244..82038 product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(82072..82434) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084357.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 82599..83216 product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391330.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(83828..85072) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771463.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(85075..85776) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267837.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(85778..87739) product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267838.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 87916..88458 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185665.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene rfbC CDS complement(88508..89176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(89188..89772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(89769..90368) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(90370..92313) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811412.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(92310..92759) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene ccmE CDS complement(92756..92947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(92944..93807) product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene ccmC CDS complement(93810..94529) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928682.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene ccmB CDS complement(94526..95152) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895571.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene ccmA CDS 95425..95658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(95745..95912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 95907..96920 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422246.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene torC CDS 96978..99488 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018812.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene torA CDS 99490..100194 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983166.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene torD CDS complement(100210..100854) product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene napC CDS complement(100886..101341) product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262390.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(101341..102360) product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene napH CDS complement(102357..103367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(103379..105919) product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778064.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene napA CDS complement(105921..106220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 106456..106812 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809646.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 106880..107425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 107507..107767 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097216.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 107771..109168 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188815.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(109122..109616) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(109688..110590) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815222.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 110688..111761 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815224.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 111864..112448 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808172.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 112485..113759 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096861.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 114014..114292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 114543..115154 product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871170.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(115191..116213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(116319..117647) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877136.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(117697..118548) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266233.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(118575..120284) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103050.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(120281..121147) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970444.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(121144..122103) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401718.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(122123..123697) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401719.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(123734..125014) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103048.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(125030..125698) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243598.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(125732..127222) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973008.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(127239..129233) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064681.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(129236..131296) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926970.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(131604..132065) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 132340..133821 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038773.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 133931..135217 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266223.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene gabT CDS 135411..136319 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene rfbD CDS complement(136379..138382) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537232.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 138672..140669 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537232.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 140778..141206 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(141284..142018) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064071.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(142015..142809) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(142806..143903) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(143900..144835) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064074.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(144943..146091) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812857.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 146455..147204 product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507623.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 147306..149105 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039964.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(149156..149905) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811933.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 150303..151469 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906142.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(151807..152562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 153397..154605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 note possible pseudo, frameshifted CDS 154602..155285 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818284.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene rsmG CDS 155282..156079 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 156115..157017 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806881.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 tRNA 157127..157213 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 157264..157337 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 157342..157416 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 sequence17 source 1..84712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 545..769 product antitoxin VbhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038834.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 964..4728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221109609.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 5059..5493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 5533..5799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 note possible pseudo, frameshifted CDS 5820..6620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 note possible pseudo, frameshifted CDS 6674..8560 product family 2A encapsulin nanocompartment cargo protein cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536863.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 8680..9906 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931662.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene argJ CDS 9887..10849 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 10892..11869 product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064924.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(11931..12707) product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811306.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(12704..12979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039933.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(13016..13768) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815038.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene zapD CDS complement(13784..14422) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927124.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene coaE CDS complement(14442..15119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 15188..15883 product copper resistance protein NlpE N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815047.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(15890..16738) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064922.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene panC CDS complement(16759..18468) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527892.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(18496..20649) product Fe(3+)-pyochelin receptor FptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111969.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene fptA CDS complement(20646..20861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(21094..21495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(21541..22422) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040572.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(22430..22618) product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815055.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(22684..23424) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815064.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(23421..24479) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(24481..25668) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 25810..27723 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107020.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 27800..28489 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815073.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 28486..29394 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815075.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 29399..30499 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927127.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene mutY CDS complement(30521..31429) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928785.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 31647..33137 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(33165..35222) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275293.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(35312..35734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 35820..36236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(36238..37374) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815198.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene rodA CDS complement(37371..39347) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815201.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene mrdA CDS complement(39360..39920) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040607.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene mreD CDS complement(39917..40834) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815203.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene mreC CDS complement(40863..41906) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815204.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 42115..42417 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929772.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene gatC CDS 42420..43955 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929771.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene gatA CDS 43952..45400 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929770.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene gatB CDS complement(45544..46833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(46833..47870) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065518.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(47899..49821) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044346855.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 50034..50981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(51014..52651) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189772.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(52692..53378) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459018.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene pyrE CDS complement(53434..53757) product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807161.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 53892..55382 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815059.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene glpK CDS 55398..56165 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071993.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 56245..57129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 57158..58102 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 58099..59004 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 59001..60656 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 60808..61431 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243931.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 61561..63102 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(63216..64364) product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 64473..65012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(65025..65828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(65866..67059) product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815378.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(67072..68418) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(68431..68805) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene apaG CDS 68888..69610 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815384.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene rpe CDS 69701..70450 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(70465..71676) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807209.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(71688..73670) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 73752..74375 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807206.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(74382..74948) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002005730.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(75046..77199) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446448.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(77424..79208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(79349..80188) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807199.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene metF CDS complement(80202..80540) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(80694..82112) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038714.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene ahcY CDS 82471..83397 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660