COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..1080388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1151..1597) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene rplI CDS complement(1612..1848) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene rpsR CDS complement(1907..2452) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2475..2762) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rpsF CDS complement(2940..5228) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(5231..6661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 6877..7557 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 7557..8636 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(8767..8979) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(9127..10428) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(10425..11924) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12201..12578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 12580..14712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 14853..17108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 17184..18128 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene trxB CDS 18175..19884 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 19823..20917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 20907..21251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 21400..22749 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 22764..23720 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(23730..24959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(24971..25924) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(27481..28107) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene rsmG CDS complement(28140..28673) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(28722..29894) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene yidC CDS 30079..30303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(30313..30597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(30685..30822) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene rpmH CDS 31276..32814 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221955.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene dnaA CDS 33381..34514 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene dnaN CDS 34529..35767 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene recF CDS 35760..36368 product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(36379..36888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 37101..39170 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene gyrB CDS 39183..41816 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene gyrA CDS 41819..42052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 42108..42677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 tRNA 42771..42845 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 43041..43114 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(43785..44015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(44155..44556) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(44553..45029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(45069..45362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(45428..45658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(46110..47960) product arsenite efflux transporter ATPase subunit ArsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene arsA CDS complement(47951..48349) product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705613.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene arsD CDS complement(48443..48826) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 49373..49792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 50277..50492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(50933..51478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 51778..51954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 52219..53367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(53447..53812) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 54187..54981 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(54968..55327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(55360..56148) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene yidA CDS complement(56162..57505) product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(57523..59079) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 59331..60092 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 60164..61009 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 61148..61834 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 61831..62760 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(62714..64789) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(65494..66351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 66586..67107 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929825.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 67118..67816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 68142..68753 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(68750..68917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 69063..70835 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 70832..71977 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 71974..73161 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 73161..74426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(74368..75717) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(75759..76718) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(76715..77899) product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene fslC CDS complement(77896..78882) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(78879..80081) product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene fslC CDS complement(80078..81307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(81321..82016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(82121..83149) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527590.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene galE CDS complement(83171..83458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 83618..84427 product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 84437..84592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 84592..85212 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(85209..87056) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene pknB CDS complement(87090..88538) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(88535..89986) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(89983..91248) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(91245..91733) product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene fhaB CDS complement(91730..92425) product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 92906..93496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 tRNA 93782..93868 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(93891..94952) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(95047..96372) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803932.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 96764..98122 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene dnaB CDS complement(98167..99000) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(99103..99951) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 99999..101360 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(101357..101782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(101856..102338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(102535..103788) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene ilvA CDS 103846..104538 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 104685..106229 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 106474..107295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 107456..108154 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 108154..109404 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene tgt CDS complement(109477..111081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(111089..111892) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878204.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(111916..113661) product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(113645..114466) product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(114463..115149) product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 115302..116291 product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 116288..117391 product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(117569..118648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(118766..120400) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(120522..121706) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(122006..122770) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 122928..123917 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729991.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene iolC CDS 123924..124787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 124784..125659 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene iolB CDS 125725..127635 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene iolD CDS 128055..129548 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 129780..130712 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 130760..131767 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 131959..132825 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 132922..133920 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(133917..134882) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(134882..135913) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 136286..137872 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886516.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(138043..138969) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 139343..140344 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 140481..141674 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(141693..142682) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990606.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene ccpA CDS 143005..143202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 143215..144204 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193713.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene iolG CDS 144231..145121 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 145158..146045 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene iolE CDS complement(146172..146804) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095879.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(146838..147635) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(147645..148634) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene iolG CDS complement(148645..149169) product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 149470..150636 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980130.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(150805..151053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(151207..152697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 152805..153833 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502024.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 153843..155282 product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 155475..156845 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067958.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 156886..158361 product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(158366..159004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(159011..160378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 160548..161678 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 161768..162667 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 162990..163187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 163081..166863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 167080..167733 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 167790..168617 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223846944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 168723..171908 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803933.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 172040..173209 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 173213..173884 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 174084..174272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 174460..175077 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 175077..176054 product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 176216..176941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 176938..178317 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 178427..178927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 179050..179970 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 179970..180782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 180795..181898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 181895..182491 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 182723..182983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 183087..183377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 183374..183685 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(183915..186341) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(186344..187054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 187169..188068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 188049..188711 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 188712..191120 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129699620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene hrpB CDS 191286..192917 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(192918..193280) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863712.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(193314..193742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(193742..194107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(194118..195527) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(195593..196201) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 196274..196819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 tRNA complement(196868..196941) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 197078..197893 product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227879.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(197872..199467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 tRNA complement(199600..199693) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(199783..199870) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 200327..201868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(201905..204397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(204411..205295) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(205295..206662) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene serS CDS 206582..207643 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(207640..208590) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene pheA CDS 208620..210716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804311.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(210603..211412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(211496..212311) product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 212429..214012 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(213981..214940) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(214944..215582) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene upp CDS 215606..216058 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene tadA CDS 216247..216729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 note possible pseudo, internal stop codon tRNA 216792..216881 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 217083..217472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 218196..218639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(218791..219969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(220039..220803) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 220971..222071 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene moaA CDS 222112..222366 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(222367..222849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 note possible pseudo, internal stop codon, frameshifted CDS complement(222846..223331) product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 223448..224677 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230283.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 224712..225221 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene moaC CDS complement(225196..226101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(226094..226729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(226726..227367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(227488..228483) product dimethyl sulfoxide reductase anchor subunit DmsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene dmsC CDS complement(228483..229121) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene dmsB CDS complement(229183..231522) product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850287.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene dmsA CDS 231470..231685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(231620..234070) product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene dmsA CDS complement(234240..236702) product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850287.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene dmsA CDS 236987..237685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 237715..237981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(237978..239618) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776457.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 239727..240251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 240248..240661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 240697..242118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(242119..244536) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730674.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 244624..245043 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(245040..245831) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 245990..247132 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene aroB CDS complement(247125..248603) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 248675..249049 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776223.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 tRNA complement(249292..249367) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(249460..250440) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(250444..252615) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 252924..253253 product WhiB family transcriptional regulator WhcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene whcA CDS 253267..253422 product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 253424..253882 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(253945..254622) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 254703..255440 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene nth CDS complement(255487..256404) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(256444..257322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(257525..257713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 257666..258523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 258523..259665 product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 259662..260360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 260357..260881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 261016..261195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 261258..261611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 261608..261982 product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(261930..264380) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776588.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 264621..266501 product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 266494..267225 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 267395..269716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 269819..272494 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene topA CDS 272495..273100 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776596.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene tmk CDS complement(273129..273332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 273331..274263 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 274555..275964 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 tRNA 276025..276099 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 276493..276792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 276932..278002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 277999..278745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 278815..279537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 279540..279737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 279740..280135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 280068..282458 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 282451..283422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 283415..285178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 285178..286008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(286064..287881) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(288153..288449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(288446..289429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(289426..290808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(290765..291151) product MobC family plasmid mobilization relaxosome protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431642.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 291142..291330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 291535..291903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(291945..296804) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(296915..297838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(298560..298874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 298875..299045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 299804..300247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 300746..302866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 302863..305415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 305665..306591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(306954..307172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(308160..308549) product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(308603..309580) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(309639..310061) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(310063..310515) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(310661..310873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 310940..311101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 note possible pseudo, internal stop codon, frameshifted CDS 311244..311486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 note possible pseudo, internal stop codon, frameshifted CDS 311667..312275 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 312311..312733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 313082..313324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(313328..313936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(313933..315135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(315157..315519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(315519..316301) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(316317..316568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(316565..317356) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 317993..320815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 320803..321426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 321742..323301 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 323426..323677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(323772..325109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(325106..325891) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 325987..327228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(327229..327915) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 328115..329161 product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 329272..330321 product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 330366..331325 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894480.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 331363..332907 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 333024..333929 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389952.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene rbsK CDS complement(334049..335497) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 335648..336673 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene nadR CDS 336882..337853 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 337924..338871 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856992.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 338871..339662 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 339792..340529 product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804515.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(340847..341530) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene phoU CDS 341694..342881 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 342892..343587 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804556.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 343716..344231 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 344241..344948 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene ispD CDS 344951..345427 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene ispF CDS complement(345539..346825) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 346950..348383 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389542.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene cysS CDS 348383..349354 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804884.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rlmB CDS 349363..350676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 350935..352380 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(352516..353178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 353262..353435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 353390..353950 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 tRNA 354027..354114 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 354332..355561 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 355899..356642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 357014..358165 product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 358252..359397 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(359408..359947) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(359962..361278) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003833659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 361522..362061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 362442..363494 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(363542..364501) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(364524..365339) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(365336..366103) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(366100..366888) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene ssuC CDS complement(366885..368831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(368831..369859) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818991.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(369983..370660) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 370938..372653 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776843.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 372650..372823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 373070..375538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 375542..376165 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene recR CDS 376257..377525 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 377522..378565 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene asd CDS complement(378637..379914) product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(380141..381121) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene ugpC CDS 381582..383318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 383412..384296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 tRNA 384377..384452 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(384454..385332) product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267511.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(385372..385974) product CueP family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015531.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 386103..387119 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 387184..387564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(388171..388374) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(388371..388850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 389093..389359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(389610..392213) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(392210..394060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(394014..396905) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016452.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 397193..397540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(397679..398563) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(398695..400143) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 400247..400963 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079711.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(400968..401654) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115248746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(401896..402816) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene purU CDS complement(402909..403637) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 403771..404052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 404079..404696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 404918..406546 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230279.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene groL CDS complement(406721..407269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 407291..407434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(407473..408270) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776687.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 408412..409854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(409894..411501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(411506..412249) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(412413..413183) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(413236..415089) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729869.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 415356..415730 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 415723..416490 product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 416491..417732 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803907.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene manA CDS 417741..417938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 417935..419431 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 419565..420983 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113311.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(421006..422112) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072623621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene serC CDS 422262..422963 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 423230..424048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 424211..425125 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 tRNA 425194..425266 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(425372..426703) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 426936..427130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 427108..427692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 427760..432382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 432369..432581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(432600..433016) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063375.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene mscL CDS complement(433056..433688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 433647..433934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(434201..434824) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 434969..436183 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 436261..437517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 tRNA 437593..437666 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(438018..439361) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(439566..441164) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 441337..441726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 441739..442482 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056110.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(442479..443159) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(443301..444182) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 444267..445517 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 445600..447183 product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(447180..449891) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 450018..451190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 451415..452917 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 453106..454707 product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 454717..455322 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058105.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(455315..456298) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(456273..456623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 456740..460201 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 460282..460983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 461074..461430 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 461456..462259 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene modA CDS 462259..463770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(463767..465161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(465308..465652) product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886702.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(465740..467524) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 467561..468388 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804940.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene rsmI CDS complement(468393..469394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 469508..470479 product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 470518..470775 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 470833..472647 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene metG CDS 472655..473629 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(473696..474508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 474707..475858 product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 475858..476748 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene rsmA CDS 476810..477817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 477877..478857 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359848.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene hemH CDS complement(478858..479784) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(479784..480197) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 480409..481257 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 481257..482102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 482099..482332 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 482387..483295 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 483296..485134 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(485146..485508) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(485548..486642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 486693..487010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(486957..487259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 487528..488097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 488211..488942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(489008..489520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(489466..490026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 490134..490748 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 490872..491897 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445481.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 491894..492889 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014531406.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 492889..493935 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 493932..494753 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 494825..496567 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(496564..497370) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456614.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(497438..498484) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878372.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene gpsA CDS complement(498500..500092) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene xylB CDS 500279..501358 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776412.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 501355..502968 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene menD CDS complement(502952..504250) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(504643..505911) product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 505988..506494 product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene tamR CDS complement(506497..507693) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(507696..508688) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(508743..509351) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 tRNA 509485..509556 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 509599..510612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 510635..511618 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 511800..512027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 512163..512741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 512741..512974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(513047..514051) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene gap CDS complement(514114..514716) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 514835..515065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 515058..515417 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(515414..516004) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 515951..516247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 516470..517099 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 517160..517726 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene pth CDS 517736..521248 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068204100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene mfd CDS 521306..521833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 521974..523254 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804956.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene eno CDS 523390..523899 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 523899..524435 product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930194.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 524432..525403 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(525400..526599) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728574.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene nhaA tRNA 526728..526802 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 526905..527798 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 527969..529333 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 529330..530235 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 530232..530606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 note possible pseudo, internal stop codon CDS 530679..531041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 note possible pseudo, internal stop codon CDS 531082..531732 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 531850..532836 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 533007..533561 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015486.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 533653..534528 product MurR/RpiR family transcriptional regulator HpxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene hpxU CDS complement(534540..535880) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene purB CDS complement(535897..537264) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467018.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene dcuC CDS complement(537408..538202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(538199..539164) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975592.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 539403..540263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(540333..540737) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812671.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 540856..543189 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(543190..543864) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene msrA CDS complement(543946..544431) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene greA CDS complement(544552..545268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 545419..546240 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(546248..547243) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(547240..547506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(547499..548641) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene xseA CDS 549066..549941 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 549954..550646 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263399.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 550728..551600 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868402.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(551615..552832) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 552975..554075 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene ychF CDS 554122..554445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 554538..554945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 554962..555237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 555335..556591 product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 556935..557870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 557898..558728 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 558927..559160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 559157..559582 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(559726..560043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 560298..560714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 560787..561137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(561025..561522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 561626..562465 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(562475..563581) product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384656.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 563804..563944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 563948..565759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 note possible pseudo, internal stop codon CDS 565783..566340 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(566373..566777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 566965..567204 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 567201..567626 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 567885..568160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 568123..568686 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730391.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(568888..569976) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373195.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 570011..570826 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136617434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(570823..571236) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(571241..571567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(571560..573458) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(573543..573764) product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(573911..574186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 574148..574558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(574555..575469) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 575648..576331 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(576368..576550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 576702..577700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 577902..579587 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene hcp CDS 579584..580621 product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(580674..581471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 581742..581924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(581990..582898) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(582925..583776) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096458860.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(583812..584840) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(584837..585883) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112993.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(585886..586890) product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112994.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene fepB CDS complement(587166..587720) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 588017..589738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 590025..591392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 591403..592953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 592950..595556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 595544..596614 product thiopeptide-type bacteriocin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004937.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 596604..597695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(597795..597941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(598005..598145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 598330..599238 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 599235..599966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 599970..601649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 601660..602232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 602353..603381 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804323.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 603455..604474 product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene iolU CDS 604667..606301 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115413031.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 606401..607534 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 607534..608586 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 608583..610322 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 610350..611189 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(611195..611980) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(612002..612709) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(612753..614030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(614104..614820) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(614844..615413) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 615621..616610 product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 616846..617565 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227194.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(617562..618845) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 618759..619001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(619114..620265) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(620278..621111) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804286.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(621182..621721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(621738..622445) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(622616..624277) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 624472..625512 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(625515..627383) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 627474..628085 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 628202..629488 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 629481..631115 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(631286..632107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(632413..633435) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene lipA CDS complement(633419..634042) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene lipB CDS 634575..636335 product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283994.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 636603..638129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 638137..639120 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 639120..640904 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467722.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 641006..641701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 641942..642184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 642181..642561 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 642737..644659 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804730.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene typA CDS 644670..645023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 645096..647039 product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 647060..647386 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 647406..648545 product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804734.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene dapC CDS complement(648597..649778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 649754..650023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(649908..650426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 650971..652323 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(652404..652919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 653316..654188 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776767.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 654172..655101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 655111..658698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 658703..659836 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 659821..660873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 660870..661487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 661492..662970 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(663233..663385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 663968..667873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 668188..669348 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 669371..670567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 670781..671653 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776767.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 671637..672404 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 672507..674360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 674364..675092 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene ispD CDS 675094..676158 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(676202..676981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(677176..679110) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 679211..681055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 681068..681799 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 681933..683279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(683309..684634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 685002..685784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(685906..686883) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene dapD CDS complement(686978..688126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(688123..689784) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 690054..691094 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 691164..691859 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 691866..693179 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776124.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(693193..693702) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029902.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 693735..694943 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 695017..695502 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene purE CDS complement(695542..696435) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(696898..698151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(698155..699318) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(699611..699892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(699980..700492) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126823873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(700660..701385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(701492..702151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(702207..703088) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975071.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 703392..703748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 703753..707286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 707283..708677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(708678..709115) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545171.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 709209..709595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 709719..710402 product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene mtrA CDS 710399..712267 product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776080.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene mtrB CDS 712260..713966 product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776079.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 714201..714986 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 715164..715796 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene raiA CDS 716090..717472 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(717587..718081) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 tRNA 718195..718278 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 718379..718454 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 718480..718554 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 718606..718773 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898538.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene rpmG CDS 719038..720162 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776154.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(720231..721247) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 721339..722595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 note possible pseudo, frameshifted CDS complement(722607..723815) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 tRNA 724137..724210 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 724226..724504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 724545..725264 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene nusG CDS 725387..725821 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene rplK CDS 725903..726619 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene rplA CDS 726802..728100 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083673.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 728380..729033 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene udk CDS 729277..729801 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053001.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene rplJ CDS 729862..730248 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene rplL CDS 730691..734152 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene rpoB CDS complement(734112..734288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 734256..738140 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 738511..738885 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene rpsL CDS 738885..739355 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene rpsG CDS 739406..741526 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene fusA CDS 741622..742812 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene tuf CDS complement(742888..744387) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene xylB CDS complement(744397..745074) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene deoC CDS 745362..746171 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 746445..746753 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene rpsJ CDS 746765..747430 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene rplC CDS 747433..748080 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene rplD CDS 748077..748391 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rplW CDS 748427..749263 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene rplB CDS 749277..749558 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rpsS CDS 749592..749972 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene rplV CDS 749972..750796 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene rpsC CDS 750799..751215 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene rplP CDS 751215..751445 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene rpmC CDS 751454..751729 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene rpsQ CDS 751810..752178 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rplN CDS 752178..752522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 752519..753067 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene rplE CDS 753070..753255 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 753310..753708 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene rpsH CDS 753727..754263 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene rplF CDS 754263..754634 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene rplR CDS 754664..755365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 755362..755547 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene rpmD CDS 755547..756017 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rplO CDS 756378..757664 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776357.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene secY CDS 757701..758276 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 758276..759109 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029827.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene map CDS 759244..759465 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene infA CDS 759750..760121 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene rpsM CDS 760156..760566 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene rpsK CDS 760666..761670 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 761701..762234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(762304..763173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 763112..764029 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene truA CDS 764222..764665 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene rplM CDS 764662..765180 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene rpsI CDS 765529..766878 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812074.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene glmM CDS 766878..767465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(767543..768478) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene coaA CDS 768572..770431 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015000.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene glmS CDS 770434..771951 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 771944..773080 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene alr CDS 773093..773596 product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 773593..774399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 774380..775033 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene tsaB CDS 775030..775518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 775493..776536 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene tsaD CDS 776536..776970 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(776991..778184) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804479.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 778381..781521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 781677..781973 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene groES CDS 782012..783580 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene guaB CDS complement(783577..784260) product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 784322..785434 product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 785441..786133 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728586.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(786179..787441) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 787565..788917 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene xylA CDS 788967..790316 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782901.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(790390..790578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 791175..792527 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene xylA CDS 792666..793796 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976402.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene chvE CDS 793834..795384 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene gguA CDS 795381..796556 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene gguB CDS complement(796701..797744) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 798065..799363 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 799377..800321 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803811.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 800318..801145 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 801196..803238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 803953..805380 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene aspA CDS 805396..806703 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 806771..807508 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(807505..808746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(808724..809149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(809155..811182) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(811193..811933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(811930..812667) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462188.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(812664..813032) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462187.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 813343..814368 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 814369..816087 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 816099..816404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 816506..816760 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 816757..817173 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(817331..817744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 818116..818877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 818885..819751 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771346.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 819778..821070 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461382.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 821070..821357 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 821767..822087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(822264..822647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(822892..824811) product tetracycline resistance ribosomal protection protein Tet(O) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene tet(O) CDS complement(825318..826661) product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119405.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene mobV CDS 826702..826887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 826980..827153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(827122..828276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(828284..828604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(828607..829683) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(829687..829887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 830079..830612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(830808..832373) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389788.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene guaA CDS 832418..833314 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 833427..835058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 835073..836248 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 836416..838185 product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(838182..839165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 839396..839578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 840244..840771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 840851..842494 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(842521..843681) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 843903..846059 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 846112..847026 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 847037..847963 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 847972..849336 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 849747..851852 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819332.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene pflB CDS 851885..852136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 852147..853016 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene pflA CDS 853258..854634 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889602.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 854875..855363 product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene nrfH CDS 855374..856825 product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 856815..857642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 857646..858497 product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 858510..860030 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618342.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 860014..860979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 860972..861592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 861642..864275 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene pcrA CDS 864599..866641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 866921..868087 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene sucC CDS 868090..869013 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene sucD CDS complement(868988..870265) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(870271..871035) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene nagB CDS 871290..872390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 872387..873016 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene purN CDS 873108..874565 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene purH CDS 874646..878053 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265956.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(878050..879090) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 879114..879380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 879425..880735 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 880826..882043 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813356.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 882142..883428 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804601.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(883466..885748) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 885833..887476 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804725.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene pgi CDS 887576..888568 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 888867..889619 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 889631..891403 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994305.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 891403..893007 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052982.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 893023..901962 product DUF1729 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128772428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(901959..902141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(902214..902780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 902926..904371 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(904440..904796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(904793..905590) product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460843.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 905774..907063 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene glyA CDS 907064..907948 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053562.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 908051..908842 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 908877..909959 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 909959..911041 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 911213..912301 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 912418..913974 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 913967..915148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 915145..916440 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 916442..916867 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 916860..918152 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 918194..918853 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049234098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene deoC CDS 919100..919459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 919456..920295 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(920416..922092) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(922089..922907) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 922942..924033 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929912.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene dapE CDS 924030..924848 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 924935..925102 product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(925278..925907) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(925990..927111) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(927174..927746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(927739..929022) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(929081..930568) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 930866..931852 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 932051..933082 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 933086..934168 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 934165..934920 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 934944..935786 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 935783..936400 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(936654..938264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(938420..938650) product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 938885..942016 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 942013..945471 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(945478..946428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 946575..947819 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 947810..948643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 948640..949503 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 949518..949712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 949796..950116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 950100..950552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 950554..950955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 950979..952115 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene prfB CDS 952244..952936 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene ftsE CDS 952936..953850 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene ftsX CDS 953867..955231 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 955328..955852 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene smpB tmRNA 956072..956439 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 956659..956916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 956907..957299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(957647..958942) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776637.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(958942..960327) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene fucP CDS 960658..961653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(961658..961960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 962216..962560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 962560..963912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 963924..964880 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene mvk CDS 964877..965869 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene mvaD CDS 965866..966969 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288233.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 966966..968054 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene fni CDS 968275..968703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 968821..970101 product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 970104..970625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(970622..971170) product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 971386..972750 product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 972765..976454 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 976454..977989 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene narH CDS 977982..978656 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene narJ CDS 978653..979423 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene narI CDS complement(979420..981165) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 981853..982140 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053170.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 982284..982580 product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 982577..984391 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 984964..986499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(986496..987875) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 988012..988203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 988200..988925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 988935..989735 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene murI CDS 989732..990502 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 990554..991282 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene rph CDS 991315..991884 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene rdgB CDS 992008..992841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(992891..993169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 993506..993679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(994213..994701) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 994806..995585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(995551..996414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 996479..997819 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 997819..998526 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 998523..999164 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014019.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 999169..1000218 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896435.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(1000215..1001444) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1001447..1002355) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727027.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 1002509..1003495 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 1003534..1004007 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 1004275..1005309 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 1005306..1007246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(1007227..1007682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 tRNA complement(1007747..1007831) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(1007893..1008369) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene bcp CDS complement(1008386..1008709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 1008879..1009331 product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(1009333..1010694) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705383.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1010858..1011718) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(1011718..1013520) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1013580..1014320 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1014317..1015480) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1015645..1017072 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811622.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene gltX CDS 1017091..1017297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1017308..1018597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 tRNA 1018698..1018770 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 1018810..1018883 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 1018915..1018990 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 1019213..1024909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1025017..1026354) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1026472..1027293) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1027416..1027841 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330934.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 1027991..1028815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1028890..1030008) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1030011..1030763) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 1030855..1032252 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene leuC CDS 1032263..1032919 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775883.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene leuD CDS 1033001..1034323 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399439.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene murA CDS 1034326..1035207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 1035204..1036301 product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223638.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 1036521..1037060 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532242.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 1037118..1038140 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1038335..1038526) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene rpmB CDS 1038687..1040774 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene recG CDS 1040779..1041360 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rsmD CDS 1041370..1041846 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051410.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene coaD CDS 1041843..1042442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1042433..1043014 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1043011..1043766 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene rnc CDS 1043821..1044459 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1044496..1046115) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(1046108..1047853) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene cydC CDS complement(1047850..1049526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1049530..1050660) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene cydB CDS complement(1050674..1052143) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1052312..1052476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1052602..1055382 product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 note possible pseudo, internal stop codon, frameshifted CDS 1055546..1055863 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene rplU CDS 1055907..1056164 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene rpmA CDS 1056453..1057982 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene obgE CDS 1057998..1059119 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene proB CDS 1059523..1060419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1060563..1060919) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene trxA CDS 1061048..1062313 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1062300..1062971 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene nadD CDS 1062974..1064146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 1064176..1064649 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene rsfS CDS 1064646..1065305 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 tRNA 1065392..1065465 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 1065791..1066423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1066598..1066867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1067019..1067147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1067237..1067533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1067707..1070487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1070484..1073537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1073600..1076110) product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1077308..1077781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1077810..1078091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1078195..1078947 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene tatC CDS complement(1078992..1079474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 misc_feature complement(1079775..>1080388) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187684718.1:IS3 family transposase locus_tag LOCUS_10010 sequence2 source 1..110607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 97..206 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 repeat_region 568..1424 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatcgccgtggcggataccg CDS 1507..2223 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 2232..3263 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 3253..3396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 3399..4226 product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene tlyA CDS 4232..5098 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 5123..6823 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene recN CDS 6828..8003 product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene steA CDS 8014..8979 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 8979..9791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 9788..11410 product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804979.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 11457..13136 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 13133..13711 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 13956..14669 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 14650..16101 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene sufB CDS 16102..17289 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene sufD CDS 17286..17621 product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805066.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 17637..18389 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene sufC CDS 18389..19645 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 19645..20118 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 20111..20473 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805068.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(20494..22488) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 22620..24233 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 24250..24741 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(24746..24922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(25058..25978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(25993..27243) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene glgC CDS 27391..28629 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene glgA CDS 28653..29459 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 29550..29981 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 30007..31137 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 31244..32098 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 32168..32461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(32458..32937) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775666.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(32970..33422) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 33632..34342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 34339..35901 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 35894..39208 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 39263..39745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 39745..41061 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389920.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(41058..42107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 42237..43670 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 tRNA 43857..43943 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(44001..44183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(44101..45216) product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 45699..47189 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224487.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 47305..49020 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene betA CDS 49094..51172 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene betT CDS complement(51340..52053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 52265..54307 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 54364..54684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(54690..55643) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 55689..56537 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 56548..57243 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(57240..58067) product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(58112..59530) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141897420.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene xylB CDS complement(59620..60459) product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 60501..61535 product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 61605..63257 product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene arc CDS 63267..64859 product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene dop CDS 64869..65048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 65045..66421 product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061320.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene pafA CDS 66424..67257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(67235..67822) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(67835..67987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 67958..68629 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728898.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene hisF CDS 68632..68997 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene hisI CDS 68997..70583 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene trpE CDS 70580..71398 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene trpC CDS 71400..72623 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene trpB CDS 72620..73411 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene trpA CDS 73408..74364 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466801.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene lgt CDS 74467..78957 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene gltB CDS 78950..80374 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 80442..81869 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805095.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene pyk tRNA 81875..81959 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 82023..82628 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(82625..82999) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 83022..85703 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene polA CDS 85857..87332 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene rpsA CDS complement(87423..87845) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(87860..89008) product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 89184..90374 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 90367..91389 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622979.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 91389..92057 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084191.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 92069..92908 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 92919..93749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(93736..95802) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene ftsH CDS 95859..97976 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene uvrB CDS 98156..99181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(99193..99474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 99579..102410 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805115.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene uvrA CDS 102410..104413 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082304.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene uvrC CDS 104445..105377 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene rapZ CDS 105378..106322 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene yvcK CDS 106334..107323 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene whiA CDS 107488..108492 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805120.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene gap CDS 108559..109752 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032737730.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 109756..110532 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene tpiA sequence3 source 1..390448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..360 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene secG CDS 528..1160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1157..1852 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1957..3360 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene glpT CDS 3447..4493 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(4443..4661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(4630..4815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 5113..6063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 6060..7130 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974159.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(7127..8059) product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122823891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(8075..9583) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene zwf CDS complement(9701..11773) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805127.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene tkt CDS 11893..12831 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene xerD CDS 12845..13696 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 13687..14439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 14436..14999 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene scpB CDS 14996..15733 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 15733..17499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 17496..18953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 note possible pseudo, frameshifted CDS complement(18958..20892) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(21027..21935) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(21945..22787) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 22850..23686 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(23678..24046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(24043..24438) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(24426..24974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 25105..27885 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(27863..28921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(28925..31030) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 31196..31321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(31523..32692) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228175.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(32826..34259) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 34496..37879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 38237..38440 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 38552..39946 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 40003..40293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(40263..41297) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(41395..42789) product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 43023..43925 product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 43936..45387 product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 45401..46027 product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(46024..47412) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 tRNA complement(47488..47562) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 47705..48148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 48151..48900 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 48977..49540 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(49605..51515) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(51559..53007) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015077.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 53278..53631 product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(53700..54440) product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(54437..55972) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805197.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene lnt CDS complement(55972..58581) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(58581..58955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(58952..59920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(59913..60794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 60899..61936 product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(61933..62775) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene hisG CDS complement(62783..63058) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061184.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(63090..64118) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(64115..64909) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(65174..65464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 65487..66260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 66260..67231 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 67231..67995 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(67992..68813) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(68840..70330) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730456.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene putP CDS complement(70345..71115) product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene ddaH CDS complement(71129..72604) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(72708..73559) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene ppk2 CDS complement(73647..73883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(73942..74922) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(75121..75372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(75369..75605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(75695..76912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(77023..77682) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene rpe CDS complement(77679..79097) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(79097..80008) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene fmt CDS complement(80018..82093) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(82135..82968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(82965..83660) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(83657..84034) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(84154..85347) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene metK CDS complement(85344..86555) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene coaBC CDS complement(86552..86821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(86857..87420) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene gmk CDS complement(87431..88252) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene pyrF CDS complement(88249..91539) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene carB CDS complement(91539..92693) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819349.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene carA CDS complement(92690..93985) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(93982..94935) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(94937..95458) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene pyrR CDS complement(95509..95934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(95935..96510) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene efp CDS complement(96572..97102) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(97099..97602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(97599..98810) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805102.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene aroC CDS complement(98826..100538) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(100670..101206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(101246..101869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(101866..102951) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene mltG CDS complement(102948..103412) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene ruvX CDS complement(103412..106072) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775671.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene alaS CDS complement(106096..106443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(106498..107121) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775672.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene rpsD CDS complement(107204..108556) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067922.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(108561..109292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(109289..110737) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014498.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene aspS CDS 110618..111058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 111242..112645 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 112780..114660 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805008.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(114671..115462) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(115496..118048) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene pheT CDS complement(118050..119135) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene pheS CDS 119238..120089 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(120086..120865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(120911..122545) product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(122549..123607) product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(123607..124863) product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene porA CDS complement(124847..125389) product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(125546..126388) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(126501..126881) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812406.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene rplT CDS complement(126901..127095) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene rpmI CDS complement(127150..127746) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene infC CDS 127720..128001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 128235..129698 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(129695..130708) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 130867..136869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(136866..137603) product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(137603..138334) product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene priA CDS complement(138343..138975) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776205.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene hisH CDS complement(138999..139598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(139602..140201) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene hisB CDS complement(140202..141305) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(141356..142222) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 142477..143184 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(143170..144504) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene hisD CDS complement(144540..145358) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(145368..146111) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene recO CDS 146222..146944 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 146946..148100 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(148115..149845) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene leuA CDS complement(150078..151487) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 151435..151617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(151661..152590) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene era CDS complement(152583..153848) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052157.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(153848..154342) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene ybeY CDS complement(154339..155313) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412235.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(155320..156078) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(156075..157202) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene dnaJ CDS complement(157232..158239) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene hrcA CDS 158360..159205 product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775761.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(159216..160412) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene hemW CDS complement(160396..161250) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804561.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene trmB CDS complement(161254..163110) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775765.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene lepA CDS 163268..163870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 163908..164441 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(164447..165502) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876538.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 165744..166007 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene rpsT CDS 166081..167622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(167623..168135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(168168..169607) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene pntB CDS complement(169609..171138) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene pntA CDS complement(171252..172232) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(172246..174414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(174482..175270) product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(175367..176338) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(176361..179282) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene leuS CDS 179378..179815 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(179812..180483) product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(180473..181267) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389769.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(181264..181791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 181898..182698 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224891.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene deoD CDS 182712..183404 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 183708..184700 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929841.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 184697..185383 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 185455..186297 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803995.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(186382..189006) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082793861.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 189288..190220 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene metF CDS 190230..192542 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene metE CDS complement(192534..193727) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene rocD CDS complement(193760..194857) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972532.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(194952..195710) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(195707..197746) product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(197743..198462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 198856..200808 product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224706.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 201103..201597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 202486..202731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 note possible pseudo, internal stop codon CDS 202834..203187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 note possible pseudo, internal stop codon CDS 203181..204860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 204779..205381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(205398..206438) product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(206599..207645) product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(207798..209303) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(209431..210183) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene fabG CDS complement(210230..211225) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(211225..212778) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(212787..213350) product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene glpP CDS complement(213347..214144) product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(214800..215348) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(215335..215547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(215581..217590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 218394..219017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 note possible pseudo, internal stop codon CDS 219076..219903 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(219962..221053) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene tal CDS 221133..221303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(221433..221771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(221870..222190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(222190..222792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 222981..223376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(223427..224368) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014813.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 224452..224829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 note possible pseudo, internal stop codon CDS 224920..225405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(225543..226733) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 226879..227778 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(227844..228854) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(228907..229737) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(229777..232068) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 232296..232979 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(233085..233423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(233674..234186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 234233..234391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 234397..235110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(235156..236910) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(237053..237901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(238014..238667) product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(238670..239491) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 239691..241226 product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 241234..241779 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 242045..242914 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene mutM CDS 242970..243218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 243238..243495 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 243588..244271 product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(244354..244719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(244815..245189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(245351..247684) product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850287.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene dmsA CDS 248096..248587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(249059..249331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(250127..251053) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110454.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(252926..253327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 253940..255316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776735.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 255412..256434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 256479..259532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(259538..261469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(261532..261936) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(261933..262133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 262260..262883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 262902..263117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(263418..263678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 263596..264186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 264101..264418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(264544..266184) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140819.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(266186..268333) product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene brxL CDS complement(268347..270842) product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene pglZ CDS complement(270839..272320) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(272331..275834) product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene pglX CDS complement(275849..279370) product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene brxC CDS complement(279367..279966) product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(279963..280571) product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 280731..281042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(281320..281916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(281965..282654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(282761..283771) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(283793..285232) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(285229..286137) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(286134..287138) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(287212..288471) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(288744..289439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(290086..290817) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene fabG CDS complement(290826..291962) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(291946..293208) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(293250..294383) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995458.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(294380..295234) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(295234..296142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(296147..297211) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(297275..298330) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903958.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(298327..299625) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(300103..300534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(300586..300714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(301061..303247) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(303244..305766) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(305836..306126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(306123..306347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 306527..307849 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(308161..308970) product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776690.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 309594..310754 product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 note possible pseudo, internal stop codon CDS 310824..312128 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(312144..312272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(312282..313304) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195765892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 313514..315733 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 315986..317428 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 317609..318466 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 318466..319389 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 319395..320546 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(320649..323063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 323136..324275 product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970872.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(324287..325909) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 326333..332857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(333039..334277) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539109.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(334467..335474) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857593.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(335650..336570) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090007.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(336564..338063) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157776019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(338067..339434) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014843.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 339585..339833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 340067..343039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 343659..345266 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 345379..346311 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971489.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(346316..346981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 347141..348691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 348966..350363 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(350404..351675) product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(352011..352598) product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(352603..354255) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(354346..356625) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 356949..357638 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(357717..359441) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene poxB CDS 360646..361131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(361385..363106) product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(363110..364921) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229240.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(365002..366357) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(366478..367515) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(367515..368456) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467636.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 368671..369675 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051005886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(369780..370067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(370130..371059) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(371202..372263) product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(372361..373932) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 374330..375304 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(375331..376326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 376475..377146 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707473.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(377134..378000) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479983.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(378149..379147) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 379374..379796 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(379800..380318) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(380367..381974) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(382044..382364) product branched-chain amino acid exporter BrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene brnE CDS complement(382361..383113) product branched-chain amino acid exporter BrnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene brnF CDS 383255..384376 product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776447.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 384435..387185 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(387349..387894) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(388188..388958) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015439062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene istB CDS complement(389037..390113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 note possible pseudo, internal stop codon sequence4 source 1..482958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(804..1193) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728011.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1335..2099) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(2128..3570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(3937..4977) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183373870.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(4974..6329) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 6557..10279 product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 10517..12055 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 12171..12767 product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 12816..14276 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804358.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(14711..15016) product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene rsrA CDS complement(15013..15618) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 15749..16303 product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 16300..17706 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene aroA CDS 17703..18725 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene rsgA CDS 18722..19537 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene hisN CDS 19633..20124 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(20494..20781) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(20967..21290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 21376..21600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 22122..22283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 22353..23051 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116382.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 23044..24369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 24366..25061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 25090..26319 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776705.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 26316..29348 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776704.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(29423..29935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(29945..31243) product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(31240..31851) product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 31966..32172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(32169..32705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(32953..33153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 33223..33537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 33534..34091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(34170..37043) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776076.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene secA CDS complement(37373..38374) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776173.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(38371..39948) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene nuoN CDS complement(39945..41525) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(41545..43497) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene nuoL CDS complement(43514..43813) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene nuoK CDS complement(43810..44727) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(44727..45368) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene nuoI CDS complement(45361..46689) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147918608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene nuoH CDS complement(46686..49232) product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026459974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(49229..50539) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene nuoF CDS complement(50536..51192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(51192..52541) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(52541..53245) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(53242..53799) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(53811..54170) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(54226..55485) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(55617..56276) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 56393..57988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 57981..58892 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 58885..60000 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene menE CDS 60012..60890 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 60932..61291 product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776417.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(61340..62011) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776422.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(62008..62490) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930002.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(62767..62982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 63198..64598 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 64607..65260 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 65500..69243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 69517..70725 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(70789..71496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 71585..72454 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222914.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(72598..74106) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467018.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene dcuC CDS 74519..75769 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096861.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 75898..77016 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(77044..78897) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 79117..80493 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene radA CDS complement(80545..81408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(81436..81852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(82075..82563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(82719..83174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 83612..84325 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 84547..84957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(84954..85454) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(85451..86455) product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462291.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(86565..86711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 86664..88190 product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene glpA CDS 88187..89371 product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259131.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene glpB CDS 89368..90639 product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259130.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 90844..92370 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene glpK CDS 92780..94447 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028722.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 94459..95247 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 95247..96902 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 96899..97537 product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 97524..98369 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 98369..98998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(99042..100031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(100038..100529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(100855..102384) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene lysS CDS complement(102590..103024) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(103017..103829) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene panC CDS complement(104031..104372) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(104369..104689) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(104868..105056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(105281..105493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(105605..106801) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(106909..107574) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(107571..108815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(108825..109616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(109805..110230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(110448..110687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(110708..111658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(112514..113422) product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(113464..114981) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(114981..115469) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457918.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(115540..116598) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(116598..117371) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070943583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(117368..118774) product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(118761..119408) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728695.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(119784..120191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(120235..121089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(121089..122021) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene folP CDS complement(122030..122605) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene folE CDS complement(122602..124743) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004575067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene ftsH CDS complement(124753..125307) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene hpt CDS complement(125234..126397) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene tilS CDS complement(126394..127425) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230475.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(127465..128793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 128901..129401 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(129622..131184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 131630..132931 product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 132932..134179 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 134512..135564 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804802.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 135730..136773 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819405.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(136770..138482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(138611..141487) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(141748..142656) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(142665..143741) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(143745..145118) product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(145392..145637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(145634..147664) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene feoB CDS complement(147709..147906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(148207..150915) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene ppdK CDS complement(151214..152854) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836509.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(152990..153445) product D-erythrulose 4-phosphate isomerase DerI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728942.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene derI1 CDS complement(153486..155201) product L-erythrulose 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene lerK CDS complement(155324..157021) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene ptsP CDS 157118..157906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 note possible pseudo, frameshifted CDS complement(158045..159097) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804802.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(160040..160537) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(160793..161251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(161223..161480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(161682..162461) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(162641..163702) product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(163731..165269) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(165398..166102) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776915.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(166099..167787) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene araB CDS complement(167814..169181) product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(169261..170841) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(170950..171798) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(171890..172906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388678.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(172936..173235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(173698..174948) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(175180..177762) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(177853..178305) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804517.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene dtd CDS complement(178348..178680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(178680..179849) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(179859..180437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(180447..181274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 181602..182276 product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene glnR CDS 182934..183554 product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 183557..184576 product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene pitH CDS complement(184457..184666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(184670..185449) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730783.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene pstB CDS complement(185484..186563) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene pstA CDS complement(186560..187663) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814417.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene pstC CDS complement(187723..188838) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene pstS CDS complement(189099..190181) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(190184..192646) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(192756..193385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 tRNA 193598..193672 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(193609..194811) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(194795..195313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 195472..195663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 195653..197365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 197362..197805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 197805..199265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 199277..200566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 200563..201156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 201153..201626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 201641..201808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 201808..202149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 202275..203129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 203168..203488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(204265..204471) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(204605..205663) product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(205702..206604) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(206612..207535) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(207581..208276) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892748.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(208371..208829) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene msrB CDS complement(208840..210528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 tRNA 210732..210805 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 210849..210923 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 210976..211049 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(211212..212216) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 212376..213248 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 213245..214042 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 214042..215925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 215922..217226 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775660.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(217463..218656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 219110..219607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(219766..221172) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(221315..221818) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803955.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 221950..222783 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 222788..223441 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 223438..224100 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 224124..225032 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 225302..227761 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(227909..228109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 228417..229274 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(229447..230085) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389114.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene dhaL CDS complement(230082..231086) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389115.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(231309..232103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(232093..233034) product multidrug efflux ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900295.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(233034..233744) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005097973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(233882..234889) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(234995..235324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 235502..236122 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295919.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 236383..236805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 note possible pseudo, frameshifted CDS 236802..237122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 note possible pseudo, frameshifted CDS 237083..237442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 note possible pseudo, frameshifted CDS complement(237517..238053) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(238187..238684) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene tpx CDS 238860..239273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 239270..239569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 239769..239978 product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804526.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(240220..241344) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene purM CDS complement(241341..242921) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene purF CDS complement(243101..243454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(243578..246163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 246415..246594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(246605..247945) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene gdhA CDS complement(248081..250426) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene purL CDS complement(250438..251133) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene purQ CDS complement(251130..251387) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene purS CDS complement(251527..252438) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(252462..253736) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene purD CDS 254281..255114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(255292..257154) product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 257501..258517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 258584..259660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(259721..261004) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 261290..263659 product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene malP CDS 263927..265264 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 265334..266179 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 266176..267120 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 267126..267755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(267968..269620) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(269646..270527) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(270527..271441) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776455.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(271452..272660) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776454.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 272927..274099 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930008.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(274168..275193) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene fbaA CDS complement(275313..275990) product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(275987..276553) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(276570..277139) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene pyrE CDS complement(277144..281676) product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 281770..282459 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(282448..283179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(283181..283948) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 284028..284816 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 284820..285308 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386780.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(285290..286096) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893817.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 286206..286412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 286417..286743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 287303..287482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 287571..288359 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(288334..288753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(288750..289031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(289147..291759) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene clpB CDS 292051..292917 product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 292918..293565 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 293558..294226 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 294226..294963 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815845.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(294960..295382) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969950.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 295422..295931 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene ybaK CDS 296013..296195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 296403..297308 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 note possible pseudo, internal stop codon CDS complement(297298..298110) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene gluQRS CDS complement(298217..299527) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(299585..301636) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 301784..302824 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(302796..304232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(304798..308718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 308624..309028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(309029..311968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 312484..316167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(316363..319449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 319827..321059 product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(321062..321940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(322153..323652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(323769..326204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 326143..326523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(326874..329453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(329462..332023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 331985..332170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(332323..334215) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804276.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(334401..335225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 note possible pseudo, frameshifted CDS complement(335245..335745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 note possible pseudo, frameshifted CDS complement(335781..336968) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 337111..338256 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149722.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene rlmC CDS complement(338358..339854) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 340224..341747 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(341772..342335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 342546..343508 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461396.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 343495..344490 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461395.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 344480..345871 product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(346085..347338) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(347677..348243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(348246..349250) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804832.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(349305..349967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(349964..351847) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814044.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene dnaK CDS 352182..352550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(352728..353930) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(354105..355199) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene ald CDS 355428..355994 product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776334.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(356042..356230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(356278..358647) product carbon starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(358916..360292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 360427..361368 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 361434..362723 product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(362818..363651) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(363745..364797) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974571.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(364794..365891) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 365959..366951 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 366984..367772 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(367908..369287) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 369377..370252 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854943.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(370268..371014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(371301..371951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(371948..373690) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(373696..374742) product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(374888..375178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(375189..375563) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene mnhG CDS complement(375556..375954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(375954..376592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(376585..378219) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(378209..378658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(378655..381798) product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727236.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(382061..382657) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene dcd tRNA 382815..382888 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(382855..383904) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 384009..384356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 384432..385109 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 385111..386388 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 386451..387179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(387234..388619) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369213.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 388895..389839 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 389836..390579 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 390576..391472 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(391469..392182) product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 392284..392733 product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 392934..393827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 393932..394750 product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(394763..395830) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene hisC CDS complement(395990..397510) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene galT CDS complement(397514..398506) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene galE CDS complement(398529..399887) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(399972..400187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 400126..401838 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877788.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 401848..402108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 402284..403141 product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052848.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 403185..403565 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 403573..404430 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 404517..405944 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene purB CDS 405904..406212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 406205..406906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 406949..408364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 408390..411077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 411074..412450 product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929884.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 412923..414230 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 414227..415087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 note possible pseudo, internal stop codon, frameshifted CDS 415126..416073 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 416268..417944 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene pgm CDS 417970..419427 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804424.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene gndA CDS 419452..420597 product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014988.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(420594..421412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(421415..421681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 421764..422360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(422357..423376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 423457..427476 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene hrpA CDS complement(427463..428347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(428453..429145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(429148..430224) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223768.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 430430..430894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 430919..431830 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776805.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 431836..432723 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 432836..434191 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776807.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(434260..434769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(434870..435940) product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803865.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(435937..436542) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(436683..439217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 439426..439962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(439910..440176) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(440281..441075) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776260.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(441178..441927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(441937..443571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(443675..445096) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(445332..446246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(446230..447270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(447542..448519) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070938867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene nrdF CDS complement(448641..450302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 450450..451565 product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130055604.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(451614..451781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 451759..453126 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 453132..454604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 454601..455164 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(455184..455567) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804865.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(455570..457027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(458372..460438) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876938.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene nrdE CDS complement(460507..460911) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776482.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene nrdI CDS complement(461043..461291) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene nrdH CDS complement(461857..463290) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072262.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(463296..463598) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 463764..464195 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 464692..465156 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 465153..466463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(466523..467407) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(467519..467851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(467848..468876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(469182..471311) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(471355..472173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 472512..473033 product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405517.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 473023..473295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 473338..473646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 473643..473948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 474114..475043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(475225..476259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(476365..477447) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(477563..478237) product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 478179..478400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(478401..480146) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(480143..482017) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(482051..482224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 rRNA complement(482753..482862) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence5 source 1..275323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 860..1726 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 1980..2429 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805144.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(2443..4755) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(4855..5979) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 6122..6715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 6726..7424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 7661..8173 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192886228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 8497..9759 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730404.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(9798..10220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(10253..10849) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 11144..12112 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 12236..13180 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 13211..13330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(13340..13921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 13991..15628 product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730906.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene kstD CDS 15762..16727 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015422.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 16740..16970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(16967..18097) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 18293..19972 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 20017..20598 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857452.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene bioY CDS 20595..21302 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 21299..21901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(21905..23260) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene mgtE CDS complement(23482..23781) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(23778..26033) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(26069..26278) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 26751..28007 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 28057..30225 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257888.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 30222..31142 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 31142..31981 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 32048..33058 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 33085..33861 product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 34005..36800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(36801..37658) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(37795..38163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(38277..39239) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(39283..39927) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene orn CDS 40057..42873 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031757.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 43226..46831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 46912..48486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 48580..49800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 tRNA complement(49865..49938) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 50194..51618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 51680..53125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 53256..53762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 53857..55539 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene ettA CDS complement(55541..56449) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 56702..58849 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene malQ CDS 58899..59135 product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 59153..59608 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224597.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(59690..62245) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene pepN CDS 62364..62960 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(62964..64907) product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 65033..65497 product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730007.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(65501..66079) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929921.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene cysE CDS 67016..67339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(67356..68291) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene cysK CDS complement(68355..69029) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 69210..69374 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804941.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene rpmF CDS 69464..71716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(72024..73358) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118196.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(73367..73903) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(73997..75454) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene gndA CDS 75621..76358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 76635..78143 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 tRNA complement(78273..78346) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 78484..78557 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 78599..79450 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777021.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(79470..81443) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776837.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(81440..83170) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776838.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 83468..84985 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804577.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene tig CDS 85181..85798 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 85805..86473 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 86590..87855 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene clpX CDS 87869..88189 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 88787..89053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 89098..91089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 91102..91740 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905030.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(91744..93561) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 93642..95618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(95689..96801) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene chvE CDS complement(96831..98183) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776910.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene gguB CDS complement(98198..99796) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene gguA CDS 99983..100123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 100143..101252 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068797.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 101249..101989 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 102080..103243 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(103224..105887) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene valS CDS 105954..106514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(106511..107296) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene proC CDS complement(107373..107987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 note possible pseudo, internal stop codon, frameshifted CDS 108317..109099 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 109391..112633 product mupirocin-resistant isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene ileS CDS 112639..114186 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 114311..114727 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene ndk CDS 114764..115759 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene dhaK CDS 115762..116391 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene dhaL CDS 116388..117080 product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene dhaM CDS 117148..120705 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene smc CDS 120884..121249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(121246..122445) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803931.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(122445..123500) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803930.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene tdh CDS 123601..124785 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene ftsY CDS 124888..126192 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 126195..126533 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 126535..128298 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 128352..129923 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene ffh CDS complement(129920..130858) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 130832..131122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 131143..131571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 131571..131810 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 131887..132417 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene rimM CDS 132407..133792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 133927..134271 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene rplS CDS 134421..135239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 135229..135924 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 135857..136231 product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804628.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(136145..136366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 136476..136799 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877409.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 136796..138313 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 138306..139430 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804631.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene dprA CDS 139484..140410 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(140411..140974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 141333..142205 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804634.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene rpsB CDS 142236..143084 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene tsf CDS complement(143161..144519) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(144534..144803) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 145118..146131 product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942014.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 146179..147258 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 147507..148436 product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene ttdA CDS 148433..149059 product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene ttdB CDS 149056..150531 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 150626..152140 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 152167..152658 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 152740..153495 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene pyrH CDS 153498..154055 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene frr CDS 154059..154904 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804638.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 154956..156215 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804639.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene rlmN CDS 156208..156756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 156767..158002 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389635.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene dxr CDS 158021..159319 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 159384..160511 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene ispG CDS 160531..161391 product DUF4081 domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193499286.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 161456..163222 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055676.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(163212..164144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 164204..164761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 164771..165775 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene nusA CDS 166260..169109 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152204006.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene infB CDS 169179..169622 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene rbfA CDS 169615..170574 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene truB CDS 170611..170769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 170792..171793 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 171941..172210 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene rpsO CDS 172350..174653 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929901.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 174776..176107 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 176113..176847 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene dapB CDS complement(176844..177479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 177622..179178 product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994324.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 179190..179813 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390319.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 179918..181183 product DUF2318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 181186..182451 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679164.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 182456..183583 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 183583..184305 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669030.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 184289..184735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 184746..185669 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(185666..186025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 186264..187493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 187519..187710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(187876..188028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(187980..188309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(188396..188527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(189202..189588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(189593..190084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(190089..190676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 190934..191839 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053723.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene dapA CDS 191864..193147 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015391.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 193160..194833 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804669.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 194993..197482 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929902.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(197491..198453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(198503..199765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 199829..200437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 200434..200910 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(200943..201098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 201097..201498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 201495..201734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 201985..203070 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804675.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene recA CDS 203070..203588 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894108.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene recX CDS 203600..205132 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene miaB CDS 205142..206053 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene miaA CDS 206059..206904 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene dapF CDS complement(206917..207765) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646328.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(207841..208452) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 208548..210044 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene hflX CDS 210041..211990 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804683.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 212081..213091 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(213177..213893) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene lexA CDS 214093..214380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 214539..214883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(214880..216835) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(216891..218102) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene serA CDS complement(218158..220419) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052539.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 220617..221789 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(221786..222694) product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 222745..223971 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene dinB CDS 224064..224453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 224802..225233 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene mraZ CDS 225348..226352 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene rsmH CDS 226349..226777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 226816..228675 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 228668..230179 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 230176..231576 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 231577..232662 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene mraY CDS 232659..234119 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene murD CDS 234112..235359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 235361..236470 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812327.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 236475..237842 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene murC CDS 237839..238885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 239028..240200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 240321..241091 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene pgeF CDS 241162..241584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 241586..241879 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060938.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 242004..242585 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804709.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 242649..243146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 243136..244065 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 244062..244529 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721534.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 244560..248090 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene dnaE CDS complement(248087..248308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(248311..248832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(248924..249316) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(249309..250205) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(250202..250969) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(250991..251899) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 252083..253480 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729870.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 253487..254662 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029314.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 254659..255873 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene dusB CDS 255900..257132 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740616.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 257142..259103 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene dnaG tRNA 259170..259244 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(259269..260648) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 260703..260837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 261134..263068 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399360.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 263065..264294 product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 264376..265647 product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068405.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 265740..265994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 266025..266507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 tRNA 266592..266666 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 266760..267245 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115099.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene def CDS 267315..267821 product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(267818..268036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 268071..268688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 268688..269305 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804860.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 269302..269958 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296486.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(269991..272735) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775706.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene aceE CDS 273012..273410 product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 tRNA 273498..273572 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 273689..273847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 274106..274684 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225273.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 274705..275199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 sequence6 source 1..176402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(464..634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 914..1456 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730359.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(1459..1779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(2054..2530) product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948700.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(2527..2991) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949080.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 3165..4274 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 4317..4721 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 4718..6676 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 7008..7622 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229313.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 7668..8600 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(8654..9499) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 9958..10539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 10556..11701 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068194.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 11794..13431 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 13497..14630 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 14627..17962 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 17973..19583 product TIGR04141 family sporadically distributed protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149523363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 19971..20099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(20293..20712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(21083..21391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(21539..22642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 23011..24468 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776487.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(24478..25017) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(25098..25586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 25681..26229 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 26279..26956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 27032..28210 product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 28300..28806 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975405.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(28778..29515) product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene nagR CDS complement(29577..30431) product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 30583..31377 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 31433..32155 product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 32175..32666 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(32626..33156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 33305..35689 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123738087.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(35696..36205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(36289..37176) product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681313.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(37199..37888) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227310.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(37893..39050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 39199..39759 product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903682.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 39792..40793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(40790..42412) product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730437.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 42469..43251 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 43297..44031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(44020..45684) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(45687..45851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 45948..46226 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(46223..46924) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene yaaA CDS complement(47326..48189) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(48199..49098) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene map CDS 49159..49371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(49359..50168) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene panB CDS 50258..51412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 51440..52777 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052524.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene glnA CDS 52787..55834 product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 55834..56460 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(56432..57193) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(57196..58161) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(58163..59068) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(59227..60651) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene glnA CDS complement(60806..61507) product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775683.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 61649..62131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(62192..63886) product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene sucB CDS complement(63901..65277) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene lpdA CDS 65421..65759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 65837..66271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 66272..67294 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930218.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(67297..67980) product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582465.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 68112..69470 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 69467..70525 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411420.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 70577..70927 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene erpA CDS 70947..71960 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 72075..73466 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114709.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(73523..74146) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 74418..74840 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 74840..75901 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805022.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene trpD CDS 75921..76784 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804784.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(76801..77079) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(77113..78870) product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(78867..79313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 79393..80604 product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775974.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 80668..82044 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(82045..83874) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene pknB CDS complement(83962..85032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 85149..85547 product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(85544..86620) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 86739..87809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 87927..89024 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804852.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene gcvT CDS 89051..89419 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888446.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene gcvH CDS 89419..92304 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene gcvP CDS 92456..93784 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 93981..95525 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 95541..95849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(95818..96465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 96570..96764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224457.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 96825..98960 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 98999..100021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(100006..102429) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 102539..103105 product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 103102..104223 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054496.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 104223..104873 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(104870..105817) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805049.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene sepH CDS 106091..106390 product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 106410..107081 product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 107078..107350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 107347..108012 product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113335.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(107984..108667) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057268.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(108667..109329) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 109449..111182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 111184..112407 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147599412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 112501..115155 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene acnA CDS 115221..117089 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene dxs CDS complement(117079..118290) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224510.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(118287..118868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 118954..119970 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068007.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(119936..121705) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene treZ CDS complement(121734..124280) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene treY CDS complement(124290..126533) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804991.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene glgX CDS 126697..127308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 127305..127706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 tRNA complement(127906..127978) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 128160..128233 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 128267..128338 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 128343..128415 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 128462..128537 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(128695..129429) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 129558..131582 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene thrS CDS 131579..132127 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(132124..133029) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067998.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(133026..133910) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(133907..134815) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804213.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(134869..136188) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(136262..137416) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 137503..138834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 138905..139519 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057532.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 139521..140519 product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 140523..141650 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 141647..142222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 142219..143430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 143414..144004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 144102..144863 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 144864..145502 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446569.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene ruvC CDS 145538..146128 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene ruvA CDS 146125..147156 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804998.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene ruvB CDS 147260..147622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 147654..149516 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene secD CDS 149516..150619 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene secF CDS 150616..151161 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 151349..153550 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene relA CDS complement(153507..154127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(154210..155559) product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 155726..156448 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 156506..157822 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene hisS CDS 157822..159549 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 159546..161102 product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 161211..162257 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776182.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene argC CDS 162254..163411 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene argJ CDS 163408..164316 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813526.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene argB CDS 164313..165482 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 165482..165967 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858683.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 166040..167281 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(167352..168785) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 168854..169615 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 169719..170513 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene zupT CDS complement(170516..171514) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene argF CDS 171603..173030 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene argH CDS 173033..173701 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 173716..174138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 174243..175505 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene tyrS sequence7 source 1..71002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 376..485 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(547..981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 1585..3339 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene ilvD CDS 3454..5064 product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941681.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(5069..5674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 5988..7826 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775906.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 7847..8377 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene ilvN CDS 8495..9526 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene ilvC CDS 9613..10620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(10637..11680) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene corA CDS complement(11720..13138) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102219.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(13513..14529) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 15157..16752 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 16806..18317 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776919.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene araA CDS 18457..19923 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095311.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene cycA CDS complement(19901..20956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(21046..21888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 22150..23535 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435282.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 23548..24624 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645191.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 24657..25562 product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878893.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 25813..27186 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438819.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 27283..28335 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 28367..29356 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369231.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 29401..30372 product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723716.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene ydjG CDS 30520..31218 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215694.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene rpe CDS complement(31290..32036) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(32376..33281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 33498..35744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(35971..36144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(36358..37515) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816288.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene fucO CDS 37755..38972 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900009.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 38972..39172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 39202..40938 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775094.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 40935..42074 product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437621.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene mcrC CDS 42142..43209 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 43350..44489 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111815.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 44727..46442 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene cimA CDS 46543..47313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 47292..47513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(47525..48280) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674311.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(48638..49207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(49471..50094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(50158..52902) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 tRNA 53075..53147 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 53358..54476 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(54510..54851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 55307..56404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 56401..57762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 57778..58854 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139305256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 58851..59750 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 59747..61405 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498066.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 61456..63126 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 63144..64490 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 64502..65944 product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229918.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 tRNA 66058..66130 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 66301..67482 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803828.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(67529..69100) product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803796.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(69571..70689) product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 sequence8 source 1..64609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(473..546) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 683..2359 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene argS CDS 2387..3763 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene lysA CDS complement(3790..4626) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721277.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene aroD CDS 4816..6123 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 6123..7223 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene thrC CDS 7223..8122 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775957.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene thrB CDS 8213..9343 product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 9589..11490 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene rho CDS 11650..11862 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814855.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene rpmE CDS 11947..13047 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814857.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene prfA CDS 13047..13898 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055663.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene prmC CDS 13895..14521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 14542..15693 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 15686..16126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 16324..17139 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051483.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene atpB CDS 17196..17411 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene atpE CDS 17411..17974 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 17974..18783 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775941.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 18853..20478 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene atpA CDS 20481..21416 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 21446..22903 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814333.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene atpD CDS 22903..23160 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817785.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 23160..23585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 23607..24299 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene nucS CDS 24355..25518 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775935.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 25580..25864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084651.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(25872..27140) product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 27362..28630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 28623..29633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051473.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 29638..30561 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(30722..31732) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 32095..33345 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 33415..35025 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 35025..35942 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(36005..37228) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031719.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 37272..37805 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 37805..38386 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031717.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(38508..40766) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene glgB CDS complement(40861..42204) product trehalose biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(42215..44023) product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene treS CDS complement(44093..46249) product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775929.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(46307..47413) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene trpS CDS complement(47479..49713) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene glgX CDS 49838..50764 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804757.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene nudC CDS complement(50782..51030) product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 51162..53147 product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(53127..54170) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(54351..55823) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 55953..57056 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(57162..57698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 57930..60962 product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389747.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 tRNA 61260..61334 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(61385..62677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 62888..63757 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104392.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 63835..64164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960