>Feature sequence01 1503 538 gene locus_tag LOCUS_00010 1503 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3747 1891 gene locus_tag LOCUS_00020 3747 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207299.1 protein_id gnl|my_center|LOCUS_00020 5412 4363 gene locus_tag LOCUS_00030 5412 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 7680 5566 gene locus_tag LOCUS_00040 7680 5566 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_00040 8993 7680 gene locus_tag LOCUS_00050 8993 7680 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272228.1 protein_id gnl|my_center|LOCUS_00050 10746 8986 gene locus_tag LOCUS_00060 10746 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 11253 10984 gene locus_tag LOCUS_00070 11253 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11731 11940 gene locus_tag LOCUS_00080 11731 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11921 12169 gene locus_tag LOCUS_00090 11921 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12383 12574 gene locus_tag LOCUS_00100 12383 12574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12601 14289 gene locus_tag LOCUS_00110 12601 14289 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143918059.1 protein_id gnl|my_center|LOCUS_00110 14247 14173 gene locus_tag LOCUS_t00010 14247 14173 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15030 14320 gene locus_tag LOCUS_00120 15030 14320 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770033.1 protein_id gnl|my_center|LOCUS_00120 15255 18629 gene locus_tag LOCUS_00130 15255 18629 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202526.1 protein_id gnl|my_center|LOCUS_00130 18654 20225 gene locus_tag LOCUS_00140 18654 20225 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795013.1 protein_id gnl|my_center|LOCUS_00140 20254 21195 gene locus_tag LOCUS_00150 20254 21195 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_00150 21201 23828 gene locus_tag LOCUS_00160 21201 23828 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_00160 23854 25068 gene locus_tag LOCUS_00170 23854 25068 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_00170 25044 26186 gene locus_tag LOCUS_00180 25044 26186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00180 26096 26524 gene locus_tag LOCUS_00190 26096 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00190 26535 27698 gene locus_tag LOCUS_00200 26535 27698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27702 29684 gene locus_tag LOCUS_00210 27702 29684 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_00210 29785 30921 gene locus_tag LOCUS_00220 29785 30921 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_00220 30918 31736 gene locus_tag LOCUS_00230 gene ilvE 30918 31736 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_00230 31790 32407 gene locus_tag LOCUS_00240 31790 32407 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_00240 32461 33615 gene locus_tag LOCUS_00250 32461 33615 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_00250 33715 37125 gene locus_tag LOCUS_00260 33715 37125 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786045.1 protein_id gnl|my_center|LOCUS_00260 37150 38742 gene locus_tag LOCUS_00270 37150 38742 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797856.1 protein_id gnl|my_center|LOCUS_00270 39149 38796 gene locus_tag LOCUS_00280 39149 38796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 39342 39151 gene locus_tag LOCUS_00290 39342 39151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 39428 40036 gene locus_tag LOCUS_00300 39428 40036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40969 40064 gene locus_tag LOCUS_00310 40969 40064 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_00310 43702 40970 gene locus_tag LOCUS_00320 43702 40970 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_00320 44632 43703 gene locus_tag LOCUS_00330 44632 43703 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_00330 45412 44816 gene locus_tag LOCUS_00340 45412 44816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 46789 45476 gene locus_tag LOCUS_00350 46789 45476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 47705 46800 gene locus_tag LOCUS_00360 47705 46800 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762851.1 protein_id gnl|my_center|LOCUS_00360 49181 47730 gene locus_tag LOCUS_00370 49181 47730 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787024.1 protein_id gnl|my_center|LOCUS_00370 52571 49194 gene locus_tag LOCUS_00380 52571 49194 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108709.1 protein_id gnl|my_center|LOCUS_00380 52926 53489 gene locus_tag LOCUS_00390 52926 53489 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_00390 53575 53988 gene locus_tag LOCUS_00400 gene yiaA 53575 53988 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524062.1 protein_id gnl|my_center|LOCUS_00400 54169 54534 gene locus_tag LOCUS_00410 54169 54534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 55441 54569 gene locus_tag LOCUS_00420 55441 54569 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530054.1 protein_id gnl|my_center|LOCUS_00420 55941 57584 gene locus_tag LOCUS_00430 55941 57584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 57675 58010 gene locus_tag LOCUS_00440 57675 58010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 58078 59238 gene locus_tag LOCUS_00450 58078 59238 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_00450 59207 60487 gene locus_tag LOCUS_00460 59207 60487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 60499 61674 gene locus_tag LOCUS_00470 60499 61674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 61671 62744 gene locus_tag LOCUS_00480 61671 62744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 62741 63358 gene locus_tag LOCUS_00490 62741 63358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 63387 64256 gene locus_tag LOCUS_00500 63387 64256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 64281 66467 gene locus_tag LOCUS_00510 64281 66467 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_00510 66605 67822 gene locus_tag LOCUS_00520 66605 67822 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101335788.1 protein_id gnl|my_center|LOCUS_00520 69503 67893 gene locus_tag LOCUS_00530 69503 67893 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_00530 70766 69993 gene locus_tag LOCUS_00540 70766 69993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 71962 71033 gene locus_tag LOCUS_00550 71962 71033 CDS product DUF5007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698520.1 protein_id gnl|my_center|LOCUS_00550 72649 71978 gene locus_tag LOCUS_00560 72649 71978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 74131 72677 gene locus_tag LOCUS_00570 74131 72677 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766182.1 protein_id gnl|my_center|LOCUS_00570 77598 74137 gene locus_tag LOCUS_00580 77598 74137 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_00580 78768 77731 gene locus_tag LOCUS_00590 78768 77731 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_00590 79595 79005 gene locus_tag LOCUS_00600 79595 79005 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_00600 80977 79829 gene locus_tag LOCUS_00610 80977 79829 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494242.1 protein_id gnl|my_center|LOCUS_00610 81283 81819 gene locus_tag LOCUS_00620 81283 81819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 82119 81850 gene locus_tag LOCUS_00630 82119 81850 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398814.1 protein_id gnl|my_center|LOCUS_00630 82392 82318 gene locus_tag LOCUS_t00020 82392 82318 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 82534 83046 gene locus_tag LOCUS_00640 82534 83046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 83048 83560 gene locus_tag LOCUS_00650 83048 83560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 83690 84679 gene locus_tag LOCUS_00660 83690 84679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_00660 84690 86978 gene locus_tag LOCUS_00670 84690 86978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 88368 87175 gene locus_tag LOCUS_00680 88368 87175 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_00680 88579 88950 gene locus_tag LOCUS_00690 88579 88950 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233853.1 protein_id gnl|my_center|LOCUS_00690 88969 89442 gene locus_tag LOCUS_00700 88969 89442 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705527.1 protein_id gnl|my_center|LOCUS_00700 90069 89446 gene locus_tag LOCUS_00710 90069 89446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 90794 90222 gene locus_tag LOCUS_00720 90794 90222 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_00720 90898 91281 gene locus_tag LOCUS_00730 90898 91281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 91871 91278 gene locus_tag LOCUS_00740 91871 91278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 92452 93399 gene locus_tag LOCUS_00750 92452 93399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 95873 94485 gene locus_tag LOCUS_00760 95873 94485 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108256.1 protein_id gnl|my_center|LOCUS_00760 99440 95877 gene locus_tag LOCUS_00770 99440 95877 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_00770 100129 99644 gene locus_tag LOCUS_00780 100129 99644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 101826 100678 gene locus_tag LOCUS_00790 101826 100678 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_00790 101991 104273 gene locus_tag LOCUS_00800 101991 104273 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_00800 106551 104365 gene locus_tag LOCUS_00810 106551 104365 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760881.1 protein_id gnl|my_center|LOCUS_00810 108395 106761 gene locus_tag LOCUS_00820 108395 106761 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295296.1 protein_id gnl|my_center|LOCUS_00820 111327 108421 gene locus_tag LOCUS_00830 111327 108421 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_00830 113135 112095 gene locus_tag LOCUS_00840 113135 112095 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743909.1 protein_id gnl|my_center|LOCUS_00840 113534 113289 gene locus_tag LOCUS_00850 113534 113289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 114074 113709 gene locus_tag LOCUS_00860 114074 113709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 115327 115118 gene locus_tag LOCUS_00870 115327 115118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 117576 115360 gene locus_tag LOCUS_00880 117576 115360 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_00880 119887 117650 gene locus_tag LOCUS_00890 119887 117650 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_00890 121223 120036 gene locus_tag LOCUS_00900 121223 120036 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_00900 122274 121231 gene locus_tag LOCUS_00910 122274 121231 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_00910 123060 122290 gene locus_tag LOCUS_00920 gene kduD 123060 122290 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230720.1 protein_id gnl|my_center|LOCUS_00920 125256 123079 gene locus_tag LOCUS_00930 125256 123079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 126101 125259 gene locus_tag LOCUS_00940 gene kduI 126101 125259 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_00940 126323 127969 gene locus_tag LOCUS_00950 126323 127969 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336878.1 protein_id gnl|my_center|LOCUS_00950 129317 128106 gene locus_tag LOCUS_00960 129317 128106 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_00960 130115 129453 gene locus_tag LOCUS_00970 130115 129453 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_00970 131118 130120 gene locus_tag LOCUS_00980 131118 130120 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_00980 132512 131118 gene locus_tag LOCUS_00990 gene uxaC 132512 131118 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_00990 133986 132517 gene locus_tag LOCUS_01000 133986 132517 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028523746.1 protein_id gnl|my_center|LOCUS_01000 134261 135349 gene locus_tag LOCUS_01010 gene mnmA 134261 135349 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_01010 136856 135693 gene locus_tag LOCUS_01020 136856 135693 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883312.1 protein_id gnl|my_center|LOCUS_01020 136975 138387 gene locus_tag LOCUS_01030 136975 138387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 140004 138445 gene locus_tag LOCUS_01040 gene odhB 140004 138445 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003725.1 protein_id gnl|my_center|LOCUS_01040 142848 140101 gene locus_tag LOCUS_01050 142848 140101 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_01050 143122 143376 gene locus_tag LOCUS_01060 gene rpsT 143122 143376 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_01060 143590 143354 gene locus_tag LOCUS_01070 143590 143354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 143819 145525 gene locus_tag LOCUS_01080 143819 145525 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_01080 145649 146383 gene locus_tag LOCUS_01090 145649 146383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 146531 147097 gene locus_tag LOCUS_01100 146531 147097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 148116 147094 gene locus_tag LOCUS_01110 148116 147094 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_01110 149320 148106 gene locus_tag LOCUS_01120 149320 148106 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_01120 149591 149334 gene locus_tag LOCUS_01130 149591 149334 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_01130 150962 149670 gene locus_tag LOCUS_01140 150962 149670 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_01140 151721 150975 gene locus_tag LOCUS_01150 151721 150975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100836.1 protein_id gnl|my_center|LOCUS_01150 152724 151726 gene locus_tag LOCUS_01160 152724 151726 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_01160 153156 152734 gene locus_tag LOCUS_01170 153156 152734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 154412 153276 gene locus_tag LOCUS_01180 154412 153276 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_01180 155448 154522 gene locus_tag LOCUS_01190 155448 154522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_01190 156219 155506 gene locus_tag LOCUS_01200 156219 155506 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_01200 156357 157895 gene locus_tag LOCUS_01210 gene guaA 156357 157895 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_01210 158001 159326 gene locus_tag LOCUS_01220 158001 159326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 159431 160441 gene locus_tag LOCUS_01230 159431 160441 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 protein_id gnl|my_center|LOCUS_01230 160445 162043 gene locus_tag LOCUS_01240 160445 162043 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_01240 162296 163111 gene locus_tag LOCUS_01250 162296 163111 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_01250 164431 163112 gene locus_tag LOCUS_01260 164431 163112 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_01260 164479 166923 gene locus_tag LOCUS_01270 164479 166923 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921429.1 protein_id gnl|my_center|LOCUS_01270 167016 167666 gene locus_tag LOCUS_01280 gene pdeM 167016 167666 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_01280 168036 167671 gene locus_tag LOCUS_01290 168036 167671 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626607.1 protein_id gnl|my_center|LOCUS_01290 169358 168585 gene locus_tag LOCUS_01300 169358 168585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 171096 170296 gene locus_tag LOCUS_01310 171096 170296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 171172 171627 gene locus_tag LOCUS_01320 171172 171627 CDS product cytochrome B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119406804.1 protein_id gnl|my_center|LOCUS_01320 172404 171730 gene locus_tag LOCUS_01330 172404 171730 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_01330 172505 173746 gene locus_tag LOCUS_01340 gene dinB 172505 173746 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_01340 173748 176723 gene locus_tag LOCUS_01350 173748 176723 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_01350 178134 176812 gene locus_tag LOCUS_01360 178134 176812 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_01360 179231 178155 gene locus_tag LOCUS_01370 179231 178155 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_01370 179556 179245 gene locus_tag LOCUS_01380 179556 179245 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_01380 180488 179640 gene locus_tag LOCUS_01390 180488 179640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 181990 180491 gene locus_tag LOCUS_01400 181990 180491 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100991023.1 protein_id gnl|my_center|LOCUS_01400 185092 182003 gene locus_tag LOCUS_01410 185092 182003 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963331.1 protein_id gnl|my_center|LOCUS_01410 186247 185729 gene locus_tag LOCUS_01420 186247 185729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 188771 188040 gene locus_tag LOCUS_01430 188771 188040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 189528 188896 gene locus_tag LOCUS_01440 189528 188896 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_01440 190562 189558 gene locus_tag LOCUS_01450 gene trpS 190562 189558 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_01450 190711 191001 gene locus_tag LOCUS_01460 gene gatC 190711 191001 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_01460 191003 191713 gene locus_tag LOCUS_01470 191003 191713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_01470 191797 192357 gene locus_tag LOCUS_01480 191797 192357 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_01480 192450 193700 gene locus_tag LOCUS_01490 gene tyrS 192450 193700 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_01490 194144 193788 gene locus_tag LOCUS_01500 194144 193788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 195742 194438 gene locus_tag LOCUS_01510 195742 194438 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_01510 198739 195764 gene locus_tag LOCUS_01520 198739 195764 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_01520 199058 199483 gene locus_tag LOCUS_01530 199058 199483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 199480 200751 gene locus_tag LOCUS_01540 199480 200751 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_01540 200826 201989 gene locus_tag LOCUS_01550 gene uxuA 200826 201989 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_01550 203386 202082 gene locus_tag LOCUS_01560 203386 202082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 204956 203376 gene locus_tag LOCUS_01570 204956 203376 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931798.1 protein_id gnl|my_center|LOCUS_01570 206004 204961 gene locus_tag LOCUS_01580 206004 204961 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_01580 206148 206633 gene locus_tag LOCUS_01590 206148 206633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 208071 206863 gene locus_tag LOCUS_01600 208071 206863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 209873 208068 gene locus_tag LOCUS_01610 209873 208068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 212455 209909 gene locus_tag LOCUS_01620 212455 209909 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_01620 214056 212806 gene locus_tag LOCUS_01630 214056 212806 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_01630 215617 214115 gene locus_tag LOCUS_01640 215617 214115 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_01640 218675 215628 gene locus_tag LOCUS_01650 218675 215628 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_01650 220250 218898 gene locus_tag LOCUS_01660 220250 218898 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_01660 221984 220626 gene locus_tag LOCUS_01670 221984 220626 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_01670 222929 223207 gene locus_tag LOCUS_01680 222929 223207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 224109 223564 gene locus_tag LOCUS_01690 224109 223564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 224224 226647 gene locus_tag LOCUS_01700 224224 226647 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_01700 226788 227855 gene locus_tag LOCUS_01710 226788 227855 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_01710 227852 228562 gene locus_tag LOCUS_01720 227852 228562 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_01720 228592 229791 gene locus_tag LOCUS_01730 228592 229791 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036232.1 protein_id gnl|my_center|LOCUS_01730 229834 231390 gene locus_tag LOCUS_01740 229834 231390 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203738.1 protein_id gnl|my_center|LOCUS_01740 231461 232594 gene locus_tag LOCUS_01750 231461 232594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 232591 233655 gene locus_tag LOCUS_01760 232591 233655 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_01760 235881 233656 gene locus_tag LOCUS_01770 gene bglX 235881 233656 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_01770 237356 235965 gene locus_tag LOCUS_01780 237356 235965 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_01780 238332 237427 gene locus_tag LOCUS_01790 238332 237427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 238846 238460 gene locus_tag LOCUS_01800 238846 238460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 240671 238878 gene locus_tag LOCUS_01810 240671 238878 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817445.1 protein_id gnl|my_center|LOCUS_01810 243983 240699 gene locus_tag LOCUS_01820 243983 240699 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_01820 244627 245211 gene locus_tag LOCUS_01830 244627 245211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 245449 245204 gene locus_tag LOCUS_01840 245449 245204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 247376 245715 gene locus_tag LOCUS_01850 247376 245715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 250267 247736 gene locus_tag LOCUS_01860 250267 247736 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598584.1 protein_id gnl|my_center|LOCUS_01860 251463 250321 gene locus_tag LOCUS_01870 251463 250321 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_01870 251502 252218 gene locus_tag LOCUS_01880 251502 252218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 252215 252865 gene locus_tag LOCUS_01890 252215 252865 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229666.1 protein_id gnl|my_center|LOCUS_01890 253985 252831 gene locus_tag LOCUS_01900 253985 252831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 254968 254090 gene locus_tag LOCUS_01910 254968 254090 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964297.1 protein_id gnl|my_center|LOCUS_01910 255106 256413 gene locus_tag LOCUS_01920 gene tolC 255106 256413 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735268.1 protein_id gnl|my_center|LOCUS_01920 256424 257524 gene locus_tag LOCUS_01930 256424 257524 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930722.1 protein_id gnl|my_center|LOCUS_01930 257533 260706 gene locus_tag LOCUS_01940 257533 260706 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157567585.1 protein_id gnl|my_center|LOCUS_01940 262571 260703 gene locus_tag LOCUS_01950 262571 260703 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106526748.1 protein_id gnl|my_center|LOCUS_01950 263204 262590 gene locus_tag LOCUS_01960 263204 262590 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_01960 264008 263283 gene locus_tag LOCUS_01970 gene pgl 264008 263283 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_01970 265517 264012 gene locus_tag LOCUS_01980 gene zwf 265517 264012 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_01980 266948 265533 gene locus_tag LOCUS_01990 gene gndA 266948 265533 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141117.1 protein_id gnl|my_center|LOCUS_01990 267558 267001 gene locus_tag LOCUS_02000 267558 267001 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_02000 268401 267712 gene locus_tag LOCUS_02010 268401 267712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 268425 268946 gene locus_tag LOCUS_02020 268425 268946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 270279 268957 gene locus_tag LOCUS_02030 270279 268957 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764309.1 protein_id gnl|my_center|LOCUS_02030 271212 270331 gene locus_tag LOCUS_02040 271212 270331 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 protein_id gnl|my_center|LOCUS_02040 271880 271296 gene locus_tag LOCUS_02050 271880 271296 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 protein_id gnl|my_center|LOCUS_02050 272159 273295 gene locus_tag LOCUS_02060 272159 273295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 274346 273654 gene locus_tag LOCUS_02070 274346 273654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 274516 275655 gene locus_tag LOCUS_02080 274516 275655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 275688 277070 gene locus_tag LOCUS_02090 275688 277070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 283773 277141 gene locus_tag LOCUS_02100 283773 277141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 285428 284142 gene locus_tag LOCUS_02110 285428 284142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 286388 285477 gene locus_tag LOCUS_02120 286388 285477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 287633 286410 gene locus_tag LOCUS_02130 287633 286410 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766763.1 protein_id gnl|my_center|LOCUS_02130 291080 287715 gene locus_tag LOCUS_02140 291080 287715 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109397.1 protein_id gnl|my_center|LOCUS_02140 292288 291185 gene locus_tag LOCUS_02150 292288 291185 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_02150 293046 292429 gene locus_tag LOCUS_02160 293046 292429 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_02160 294509 293154 gene locus_tag LOCUS_02170 294509 293154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 295038 294682 gene locus_tag LOCUS_02180 295038 294682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 296481 295372 gene locus_tag LOCUS_02190 296481 295372 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 protein_id gnl|my_center|LOCUS_02190 297175 296462 gene locus_tag LOCUS_02200 297175 296462 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660650.1 protein_id gnl|my_center|LOCUS_02200 297888 297472 gene locus_tag LOCUS_02210 297888 297472 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_02210 298415 297909 gene locus_tag LOCUS_02220 298415 297909 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398911.1 protein_id gnl|my_center|LOCUS_02220 299524 298442 gene locus_tag LOCUS_02230 gene arsB 299524 298442 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_02230 299904 299566 gene locus_tag LOCUS_02240 299904 299566 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_02240 301549 300026 gene locus_tag LOCUS_02250 301549 300026 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_02250 302442 301546 gene locus_tag LOCUS_02260 302442 301546 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256553.1 protein_id gnl|my_center|LOCUS_02260 304751 302454 gene locus_tag LOCUS_02270 304751 302454 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 protein_id gnl|my_center|LOCUS_02270 306651 304756 gene locus_tag LOCUS_02280 gene ygjK 306651 304756 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_02280 309695 306648 gene locus_tag LOCUS_02290 gene lacZ 309695 306648 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_02290 311305 309785 gene locus_tag LOCUS_02300 311305 309785 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_02300 314345 311328 gene locus_tag LOCUS_02310 314345 311328 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_02310 316258 314627 gene locus_tag LOCUS_02320 316258 314627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 317765 316578 gene locus_tag LOCUS_02330 317765 316578 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_02330 318014 319081 gene locus_tag LOCUS_02340 318014 319081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 319315 321543 gene locus_tag LOCUS_02350 319315 321543 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_02350 321660 322178 gene locus_tag LOCUS_02360 321660 322178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 322275 322976 gene locus_tag LOCUS_02370 322275 322976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 323189 323461 gene locus_tag LOCUS_02380 323189 323461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 323978 323466 gene locus_tag LOCUS_02390 323978 323466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 323977 325152 gene locus_tag LOCUS_02400 323977 325152 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_02400 325926 325195 gene locus_tag LOCUS_02410 325926 325195 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674311.1 protein_id gnl|my_center|LOCUS_02410 326236 326006 gene locus_tag LOCUS_02420 326236 326006 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_02420 327126 326242 gene locus_tag LOCUS_02430 327126 326242 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186540.1 protein_id gnl|my_center|LOCUS_02430 327644 327162 gene locus_tag LOCUS_02440 327644 327162 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267323.1 protein_id gnl|my_center|LOCUS_02440 327743 329161 gene locus_tag LOCUS_02450 327743 329161 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208163.1 protein_id gnl|my_center|LOCUS_02450 329244 330353 gene locus_tag LOCUS_02460 329244 330353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 331837 330407 gene locus_tag LOCUS_02470 331837 330407 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_02470 334994 331830 gene locus_tag LOCUS_02480 334994 331830 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_02480 336104 335022 gene locus_tag LOCUS_02490 336104 335022 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_02490 336656 336249 gene locus_tag LOCUS_02500 336656 336249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 340572 336937 gene locus_tag LOCUS_02510 340572 336937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 344763 340777 gene locus_tag LOCUS_02520 344763 340777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 344943 345707 gene locus_tag LOCUS_02530 344943 345707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 347187 346090 gene locus_tag LOCUS_02540 347187 346090 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_02540 349759 347210 gene locus_tag LOCUS_02550 349759 347210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 351198 349765 gene locus_tag LOCUS_02560 351198 349765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 352103 351249 gene locus_tag LOCUS_02570 352103 351249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 353582 352119 gene locus_tag LOCUS_02580 353582 352119 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_02580 357195 353602 gene locus_tag LOCUS_02590 357195 353602 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108737.1 protein_id gnl|my_center|LOCUS_02590 358428 357283 gene locus_tag LOCUS_02600 358428 357283 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_02600 358986 358480 gene locus_tag LOCUS_02610 358986 358480 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_02610 361167 359098 gene locus_tag LOCUS_02620 gene prc 361167 359098 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170217.1 protein_id gnl|my_center|LOCUS_02620 361338 362597 gene locus_tag LOCUS_02630 361338 362597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 362649 363605 gene locus_tag LOCUS_02640 362649 363605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 364200 363721 gene locus_tag LOCUS_02650 364200 363721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 365481 364261 gene locus_tag LOCUS_02660 gene pbuE 365481 364261 CDS product purine transporter PbuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234105.1 protein_id gnl|my_center|LOCUS_02660 368599 365513 gene locus_tag LOCUS_02670 368599 365513 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663427.1 protein_id gnl|my_center|LOCUS_02670 369594 368740 gene locus_tag LOCUS_02680 369594 368740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 370566 369616 gene locus_tag LOCUS_02690 370566 369616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 371054 370563 gene locus_tag LOCUS_02700 371054 370563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 372153 371065 gene locus_tag LOCUS_02710 372153 371065 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529507.1 protein_id gnl|my_center|LOCUS_02710 373135 372251 gene locus_tag LOCUS_02720 373135 372251 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 protein_id gnl|my_center|LOCUS_02720 373330 374226 gene locus_tag LOCUS_02730 373330 374226 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193211.1 protein_id gnl|my_center|LOCUS_02730 375296 374289 gene locus_tag LOCUS_02740 375296 374289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 376335 375325 gene locus_tag LOCUS_02750 376335 375325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 378189 376552 gene locus_tag LOCUS_02760 378189 376552 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_02760 381428 378210 gene locus_tag LOCUS_02770 381428 378210 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_02770 382902 381694 gene locus_tag LOCUS_02780 382902 381694 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_02780 383651 383019 gene locus_tag LOCUS_02790 383651 383019 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_02790 384148 385656 gene locus_tag LOCUS_02800 384148 385656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 386960 385950 gene locus_tag LOCUS_02810 386960 385950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 387398 386967 gene locus_tag LOCUS_02820 387398 386967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331496.1 protein_id gnl|my_center|LOCUS_02820 388641 387409 gene locus_tag LOCUS_02830 388641 387409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 391795 389021 gene locus_tag LOCUS_02840 391795 389021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 392570 392869 gene locus_tag LOCUS_02850 392570 392869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 394736 393354 gene locus_tag LOCUS_02860 gene mnmE 394736 393354 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_02860 395688 394852 gene locus_tag LOCUS_02870 395688 394852 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 protein_id gnl|my_center|LOCUS_02870 396324 395734 gene locus_tag LOCUS_02880 396324 395734 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_02880 397033 396377 gene locus_tag LOCUS_02890 397033 396377 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964299.1 protein_id gnl|my_center|LOCUS_02890 397957 397103 gene locus_tag LOCUS_02900 397957 397103 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_02900 398529 401090 gene locus_tag LOCUS_02910 398529 401090 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_02910 402145 401594 gene locus_tag LOCUS_02920 402145 401594 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_02920 402221 403252 gene locus_tag LOCUS_02930 402221 403252 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_02930 403306 404118 gene locus_tag LOCUS_02940 403306 404118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 405573 404188 gene locus_tag LOCUS_02950 405573 404188 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_02950 408172 405626 gene locus_tag LOCUS_02960 408172 405626 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_02960 408186 408419 gene locus_tag LOCUS_02970 408186 408419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 409512 408406 gene locus_tag LOCUS_02980 gene lpxB 409512 408406 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_02980 409824 409522 gene locus_tag LOCUS_02990 409824 409522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 410644 409832 gene locus_tag LOCUS_03000 gene surE 410644 409832 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_03000 411460 410678 gene locus_tag LOCUS_03010 411460 410678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 412365 411472 gene locus_tag LOCUS_03020 412365 411472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_03020 414795 412396 gene locus_tag LOCUS_03030 414795 412396 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_03030 416985 414904 gene locus_tag LOCUS_03040 gene metG 416985 414904 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_03040 417095 418006 gene locus_tag LOCUS_03050 417095 418006 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108350.1 protein_id gnl|my_center|LOCUS_03050 418841 418023 gene locus_tag LOCUS_03060 418841 418023 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_03060 419643 418864 gene locus_tag LOCUS_03070 419643 418864 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_03070 420479 419673 gene locus_tag LOCUS_03080 gene moeB 420479 419673 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228615.1 protein_id gnl|my_center|LOCUS_03080 421751 420516 gene locus_tag LOCUS_03090 421751 420516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 422583 422870 gene locus_tag LOCUS_03100 422583 422870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 424013 423462 gene locus_tag LOCUS_03110 424013 423462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 424194 424745 gene locus_tag LOCUS_03120 424194 424745 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_03120 425054 424803 gene locus_tag LOCUS_03130 425054 424803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933888.1 protein_id gnl|my_center|LOCUS_03130 426583 425081 gene locus_tag LOCUS_03140 gene atpD 426583 425081 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_03140 426803 428041 gene locus_tag LOCUS_03150 426803 428041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 428723 428112 gene locus_tag LOCUS_03160 428723 428112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 430289 428817 gene locus_tag LOCUS_03170 430289 428817 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_03170 431616 430282 gene locus_tag LOCUS_03180 431616 430282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_03180 432884 431637 gene locus_tag LOCUS_03190 432884 431637 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_03190 433163 434335 gene locus_tag LOCUS_03200 433163 434335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_03200 434435 436315 gene locus_tag LOCUS_03210 434435 436315 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090974988.1 protein_id gnl|my_center|LOCUS_03210 436461 438074 gene locus_tag LOCUS_03220 436461 438074 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_03220 438472 438978 gene locus_tag LOCUS_03230 438472 438978 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967978.1 protein_id gnl|my_center|LOCUS_03230 439176 438979 gene locus_tag LOCUS_03240 439176 438979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 439315 439482 gene locus_tag LOCUS_03250 439315 439482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 439492 440052 gene locus_tag LOCUS_03260 439492 440052 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203468.1 protein_id gnl|my_center|LOCUS_03260 440122 440490 gene locus_tag LOCUS_03270 440122 440490 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_03270 440672 441145 gene locus_tag LOCUS_03280 440672 441145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 441750 441142 gene locus_tag LOCUS_03290 gene yihA 441750 441142 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_03290 441793 442536 gene locus_tag LOCUS_03300 gene ubiE 441793 442536 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764422.1 protein_id gnl|my_center|LOCUS_03300 442521 443204 gene locus_tag LOCUS_03310 442521 443204 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_03310 443223 444560 gene locus_tag LOCUS_03320 443223 444560 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_03320 444687 446021 gene locus_tag LOCUS_03330 444687 446021 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555764.1 protein_id gnl|my_center|LOCUS_03330 446047 447624 gene locus_tag LOCUS_03340 446047 447624 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_03340 449818 447680 gene locus_tag LOCUS_03350 449818 447680 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_03350 450032 451828 gene locus_tag LOCUS_03360 450032 451828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964054.1 protein_id gnl|my_center|LOCUS_03360 451879 452316 gene locus_tag LOCUS_03370 451879 452316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098264.1 protein_id gnl|my_center|LOCUS_03370 452644 453846 gene locus_tag LOCUS_03380 452644 453846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 454746 454144 gene locus_tag LOCUS_03390 454746 454144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 457110 454756 gene locus_tag LOCUS_03400 457110 454756 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_03400 457486 457184 gene locus_tag LOCUS_03410 457486 457184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 459160 457580 gene locus_tag LOCUS_03420 459160 457580 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_03420 460832 459180 gene locus_tag LOCUS_03430 460832 459180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 461404 460997 gene locus_tag LOCUS_03440 461404 460997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 462814 461606 gene locus_tag LOCUS_03450 462814 461606 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_03450 463609 462833 gene locus_tag LOCUS_03460 463609 462833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 466325 463680 gene locus_tag LOCUS_03470 466325 463680 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_03470 467332 466358 gene locus_tag LOCUS_03480 467332 466358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 467991 467401 gene locus_tag LOCUS_03490 467991 467401 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_03490 467990 469015 gene locus_tag LOCUS_03500 467990 469015 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_03500 469025 469822 gene locus_tag LOCUS_03510 469025 469822 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404948.1 protein_id gnl|my_center|LOCUS_03510 470817 469894 gene locus_tag LOCUS_03520 470817 469894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 471582 470875 gene locus_tag LOCUS_03530 471582 470875 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_03530 472953 471592 gene locus_tag LOCUS_03540 472953 471592 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_03540 474600 473026 gene locus_tag LOCUS_03550 gene dnaB 474600 473026 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_03550 475090 477522 gene locus_tag LOCUS_03560 gene pheT 475090 477522 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_03560 477526 477831 gene locus_tag LOCUS_03570 477526 477831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 478156 477845 gene locus_tag LOCUS_03580 478156 477845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 478783 478292 gene locus_tag LOCUS_03590 478783 478292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 479021 479317 gene locus_tag LOCUS_03600 479021 479317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 479483 481045 gene locus_tag LOCUS_03610 gene rny 479483 481045 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_03610 481797 481615 gene locus_tag LOCUS_03620 481797 481615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 481962 482150 gene locus_tag LOCUS_03630 481962 482150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 482194 482388 gene locus_tag LOCUS_03640 482194 482388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 482508 483515 gene locus_tag LOCUS_03650 482508 483515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 483512 483952 gene locus_tag LOCUS_03660 483512 483952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 483949 484557 gene locus_tag LOCUS_03670 483949 484557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 485243 484764 gene locus_tag LOCUS_03680 485243 484764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 485847 485377 gene locus_tag LOCUS_03690 485847 485377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 486305 485862 gene locus_tag LOCUS_03700 486305 485862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 487558 486392 gene locus_tag LOCUS_03710 487558 486392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 488549 487665 gene locus_tag LOCUS_03720 gene atpG 488549 487665 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_03720 489255 488674 gene locus_tag LOCUS_03730 489255 488674 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393578.1 protein_id gnl|my_center|LOCUS_03730 489533 490894 gene locus_tag LOCUS_03740 489533 490894 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_03740 492407 491016 gene locus_tag LOCUS_03750 492407 491016 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_03750 493629 492421 gene locus_tag LOCUS_03760 gene eboE 493629 492421 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_03760 494820 493669 gene locus_tag LOCUS_03770 494820 493669 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_03770 495900 494992 gene locus_tag LOCUS_03780 495900 494992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 496931 495945 gene locus_tag LOCUS_03790 496931 495945 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_03790 497873 496992 gene locus_tag LOCUS_03800 497873 496992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 498425 498835 gene locus_tag LOCUS_03810 498425 498835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 502944 499537 gene locus_tag LOCUS_03820 502944 499537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 503771 503040 gene locus_tag LOCUS_03830 503771 503040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 504500 503778 gene locus_tag LOCUS_03840 504500 503778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 504932 504528 gene locus_tag LOCUS_03850 504932 504528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 506031 504979 gene locus_tag LOCUS_03860 506031 504979 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_03860 507253 506090 gene locus_tag LOCUS_03870 507253 506090 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 protein_id gnl|my_center|LOCUS_03870 508564 507275 gene locus_tag LOCUS_03880 508564 507275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 509009 512338 gene locus_tag LOCUS_03890 gene secA 509009 512338 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_03890 512431 513093 gene locus_tag LOCUS_03900 gene deoC 512431 513093 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017437.1 protein_id gnl|my_center|LOCUS_03900 513159 513560 gene locus_tag LOCUS_03910 513159 513560 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_03910 513560 514735 gene locus_tag LOCUS_03920 513560 514735 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_03920 515382 514813 gene locus_tag LOCUS_03930 515382 514813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 515918 515544 gene locus_tag LOCUS_03940 515918 515544 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 protein_id gnl|my_center|LOCUS_03940 516752 515937 gene locus_tag LOCUS_03950 516752 515937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 517629 516793 gene locus_tag LOCUS_03960 517629 516793 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_03960 517839 520139 gene locus_tag LOCUS_03970 517839 520139 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_03970 521501 520221 gene locus_tag LOCUS_03980 521501 520221 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_03980 521718 522710 gene locus_tag LOCUS_03990 521718 522710 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130541252.1 protein_id gnl|my_center|LOCUS_03990 522727 523677 gene locus_tag LOCUS_04000 522727 523677 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_04000 525472 524183 gene locus_tag LOCUS_04010 525472 524183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_04010 526202 525465 gene locus_tag LOCUS_04020 526202 525465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 527167 526232 gene locus_tag LOCUS_04030 527167 526232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_04030 528820 527234 gene locus_tag LOCUS_04040 528820 527234 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_04040 529332 528934 gene locus_tag LOCUS_04050 529332 528934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 529933 531309 gene locus_tag LOCUS_04060 gene dnaA 529933 531309 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_04060 531491 532063 gene locus_tag LOCUS_04070 531491 532063 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_04070 532148 533050 gene locus_tag LOCUS_04080 532148 533050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 533207 536545 gene locus_tag LOCUS_04090 533207 536545 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202552.1 protein_id gnl|my_center|LOCUS_04090 536567 538081 gene locus_tag LOCUS_04100 536567 538081 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794953.1 protein_id gnl|my_center|LOCUS_04100 538148 539959 gene locus_tag LOCUS_04110 538148 539959 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117506598.1 protein_id gnl|my_center|LOCUS_04110 540378 539950 gene locus_tag LOCUS_04120 540378 539950 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 protein_id gnl|my_center|LOCUS_04120 540542 541018 gene locus_tag LOCUS_04130 540542 541018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 541891 541019 gene locus_tag LOCUS_04140 541891 541019 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531001.1 protein_id gnl|my_center|LOCUS_04140 542423 541983 gene locus_tag LOCUS_04150 542423 541983 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_04150 543067 542492 gene locus_tag LOCUS_04160 543067 542492 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_04160 543182 544045 gene locus_tag LOCUS_04170 543182 544045 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316074.1 protein_id gnl|my_center|LOCUS_04170 544109 545113 gene locus_tag LOCUS_04180 544109 545113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 546393 545452 gene locus_tag LOCUS_04190 546393 545452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 547052 546399 gene locus_tag LOCUS_04200 547052 546399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 547270 547100 gene locus_tag LOCUS_04210 547270 547100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 548517 547384 gene locus_tag LOCUS_04220 548517 547384 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_04220 548885 549463 gene locus_tag LOCUS_04230 548885 549463 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_04230 550261 549467 gene locus_tag LOCUS_04240 550261 549467 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_04240 550891 550337 gene locus_tag LOCUS_04250 550891 550337 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_04250 552391 551138 gene locus_tag LOCUS_04260 552391 551138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 553874 552417 gene locus_tag LOCUS_04270 553874 552417 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750838.1 protein_id gnl|my_center|LOCUS_04270 557344 553877 gene locus_tag LOCUS_04280 557344 553877 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165360391.1 protein_id gnl|my_center|LOCUS_04280 558704 557586 gene locus_tag LOCUS_04290 558704 557586 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_04290 558799 559266 gene locus_tag LOCUS_04300 558799 559266 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788988.1 protein_id gnl|my_center|LOCUS_04300 559378 559986 gene locus_tag LOCUS_04310 559378 559986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 560259 560672 gene locus_tag LOCUS_04320 560259 560672 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 protein_id gnl|my_center|LOCUS_04320 561162 562565 gene locus_tag LOCUS_04330 561162 562565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 563325 562636 gene locus_tag LOCUS_04340 563325 562636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 563925 563934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 564106 564031 gene locus_tag LOCUS_t00030 564106 564031 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 564235 564146 gene locus_tag LOCUS_t00040 564235 564146 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 564327 564971 gene locus_tag LOCUS_04350 564327 564971 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_04350 566777 564972 gene locus_tag LOCUS_04360 566777 564972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 569323 567281 gene locus_tag LOCUS_04370 569323 567281 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_04370 569378 569584 gene locus_tag LOCUS_04380 569378 569584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 569559 569954 gene locus_tag LOCUS_04390 569559 569954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 569965 571224 gene locus_tag LOCUS_04400 569965 571224 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_04400 573545 571218 gene locus_tag LOCUS_04410 gene pbpC 573545 571218 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_04410 579215 573666 gene locus_tag LOCUS_04420 579215 573666 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_04420 580712 579255 gene locus_tag LOCUS_04430 580712 579255 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_04430 580761 581288 gene locus_tag LOCUS_04440 580761 581288 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_04440 581314 582474 gene locus_tag LOCUS_04450 581314 582474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 583312 582602 gene locus_tag LOCUS_04460 583312 582602 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_04460 583772 583284 gene locus_tag LOCUS_04470 583772 583284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 586659 583780 gene locus_tag LOCUS_04480 gene uvrA 586659 583780 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_04480 587100 587963 gene locus_tag LOCUS_04490 587100 587963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 589234 588263 gene locus_tag LOCUS_04500 589234 588263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 591108 589846 gene locus_tag LOCUS_04510 gene fabF 591108 589846 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762962.1 protein_id gnl|my_center|LOCUS_04510 592718 591234 gene locus_tag LOCUS_04520 592718 591234 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964010.1 protein_id gnl|my_center|LOCUS_04520 593891 592722 gene locus_tag LOCUS_04530 593891 592722 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691388.1 protein_id gnl|my_center|LOCUS_04530 595281 593908 gene locus_tag LOCUS_04540 595281 593908 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_04540 595841 595332 gene locus_tag LOCUS_04550 595841 595332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 596403 596002 gene locus_tag LOCUS_04560 596403 596002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 598147 596429 gene locus_tag LOCUS_04570 gene aspS 598147 596429 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_04570 599262 598237 gene locus_tag LOCUS_04580 599262 598237 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838662.1 protein_id gnl|my_center|LOCUS_04580 600231 599350 gene locus_tag LOCUS_04590 gene sucD 600231 599350 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_04590 601141 600326 gene locus_tag LOCUS_04600 601141 600326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_04600 601855 601166 gene locus_tag LOCUS_04610 601855 601166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_04610 602982 601951 gene locus_tag LOCUS_04620 602982 601951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 603447 603016 gene locus_tag LOCUS_04630 603447 603016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 605907 603535 gene locus_tag LOCUS_04640 605907 603535 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_04640 605957 606406 gene locus_tag LOCUS_04650 605957 606406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 609534 606709 gene locus_tag LOCUS_04660 gene uvrA 609534 606709 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_04660 609742 610314 gene locus_tag LOCUS_04670 609742 610314 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_04670 611272 610373 gene locus_tag LOCUS_04680 611272 610373 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_04680 612546 611347 gene locus_tag LOCUS_04690 gene pcaF 612546 611347 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920265.1 protein_id gnl|my_center|LOCUS_04690 612716 613693 gene locus_tag LOCUS_04700 gene rlmN 612716 613693 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_04700 613729 615348 gene locus_tag LOCUS_04710 613729 615348 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791757.1 protein_id gnl|my_center|LOCUS_04710 615361 616095 gene locus_tag LOCUS_04720 615361 616095 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_04720 616190 617767 gene locus_tag LOCUS_04730 616190 617767 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_04730 618670 618035 gene locus_tag LOCUS_04740 618670 618035 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813333.1 protein_id gnl|my_center|LOCUS_04740 619967 619380 gene locus_tag LOCUS_04750 619967 619380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 620065 621069 gene locus_tag LOCUS_04760 620065 621069 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_04760 621862 621140 gene locus_tag LOCUS_04770 621862 621140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 621969 623609 gene locus_tag LOCUS_04780 gene ade 621969 623609 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_04780 624670 623606 gene locus_tag LOCUS_04790 624670 623606 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_04790 624788 625501 gene locus_tag LOCUS_04800 624788 625501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 625671 626324 gene locus_tag LOCUS_04810 gene upp 625671 626324 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_04810 626520 627536 gene locus_tag LOCUS_04820 626520 627536 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_04820 628230 627619 gene locus_tag LOCUS_04830 628230 627619 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_04830 628440 629102 gene locus_tag LOCUS_04840 628440 629102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 629136 629846 gene locus_tag LOCUS_04850 629136 629846 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_04850 631150 630374 gene locus_tag LOCUS_04860 631150 630374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 631779 631384 gene locus_tag LOCUS_04870 631779 631384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 633161 631788 gene locus_tag LOCUS_04880 633161 631788 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_04880 633242 634381 gene locus_tag LOCUS_04890 gene bshA 633242 634381 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_04890 635896 634454 gene locus_tag LOCUS_04900 635896 634454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 636792 635947 gene locus_tag LOCUS_04910 636792 635947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 638555 636813 gene locus_tag LOCUS_04920 638555 636813 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_04920 639001 638558 gene locus_tag LOCUS_04930 gene dut 639001 638558 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_04930 639515 639033 gene locus_tag LOCUS_04940 gene ispF 639515 639033 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_04940 640609 639611 gene locus_tag LOCUS_04950 gene porV 640609 639611 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_04950 640746 640901 gene locus_tag LOCUS_04960 640746 640901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 644266 640898 gene locus_tag LOCUS_04970 gene porU 644266 640898 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_04970 644493 645989 gene locus_tag LOCUS_04980 gene gldJ 644493 645989 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_04980 647526 646162 gene locus_tag LOCUS_04990 647526 646162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 649207 647534 gene locus_tag LOCUS_05000 649207 647534 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_05000 649353 649760 gene locus_tag LOCUS_05010 649353 649760 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_05010 650361 649816 gene locus_tag LOCUS_05020 650361 649816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 651519 650716 gene locus_tag LOCUS_05030 651519 650716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256797.1 protein_id gnl|my_center|LOCUS_05030 652301 651519 gene locus_tag LOCUS_05040 652301 651519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 654131 652365 gene locus_tag LOCUS_05050 654131 652365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 655181 654195 gene locus_tag LOCUS_05060 655181 654195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 655850 655188 gene locus_tag LOCUS_05070 655850 655188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 656181 657083 gene locus_tag LOCUS_05080 gene gldA 656181 657083 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_05080 657135 658427 gene locus_tag LOCUS_05090 gene eno 657135 658427 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931839.1 protein_id gnl|my_center|LOCUS_05090 658522 658845 gene locus_tag LOCUS_05100 658522 658845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 659010 659225 gene locus_tag LOCUS_05110 659010 659225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 659244 659888 gene locus_tag LOCUS_05120 gene nth 659244 659888 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_05120 659995 661146 gene locus_tag LOCUS_05130 659995 661146 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_05130 661170 662360 gene locus_tag LOCUS_05140 661170 662360 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_05140 663516 662896 gene locus_tag LOCUS_05150 663516 662896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 665428 663581 gene locus_tag LOCUS_05160 665428 663581 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_05160 665982 666284 gene locus_tag LOCUS_05170 665982 666284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 666442 667203 gene locus_tag LOCUS_05180 666442 667203 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_05180 667220 667837 gene locus_tag LOCUS_05190 667220 667837 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_05190 667902 668876 gene locus_tag LOCUS_05200 667902 668876 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_05200 670556 669195 gene locus_tag LOCUS_05210 670556 669195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 672088 671273 gene locus_tag LOCUS_05220 672088 671273 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_05220 673198 672101 gene locus_tag LOCUS_05230 673198 672101 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_05230 676872 673327 gene locus_tag LOCUS_05240 676872 673327 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_05240 678007 676898 gene locus_tag LOCUS_05250 678007 676898 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_05250 679405 678041 gene locus_tag LOCUS_05260 679405 678041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 680031 679420 gene locus_tag LOCUS_05270 680031 679420 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_05270 680221 680880 gene locus_tag LOCUS_05280 680221 680880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 681108 681953 gene locus_tag LOCUS_05290 681108 681953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 682281 683387 gene locus_tag LOCUS_05300 gene serC 682281 683387 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_05300 683515 684750 gene locus_tag LOCUS_05310 683515 684750 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_05310 684865 685908 gene locus_tag LOCUS_05320 684865 685908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 685963 687624 gene locus_tag LOCUS_05330 gene paaN 685963 687624 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_05330 687631 688305 gene locus_tag LOCUS_05340 687631 688305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 688410 690191 gene locus_tag LOCUS_05350 688410 690191 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_05350 690256 690328 gene locus_tag LOCUS_t00050 690256 690328 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 690475 691206 gene locus_tag LOCUS_05360 690475 691206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 691313 692299 gene locus_tag LOCUS_05370 691313 692299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433093.1 protein_id gnl|my_center|LOCUS_05370 692321 695752 gene locus_tag LOCUS_05380 692321 695752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 697258 695786 gene locus_tag LOCUS_05390 697258 695786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 697630 698658 gene locus_tag LOCUS_05400 697630 698658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 698765 699049 gene locus_tag LOCUS_05410 698765 699049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 699119 699433 gene locus_tag LOCUS_05420 699119 699433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 699763 700116 gene locus_tag LOCUS_05430 699763 700116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 700369 702747 gene locus_tag LOCUS_05440 700369 702747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_05440 704358 703153 gene locus_tag LOCUS_05450 704358 703153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 704452 705030 gene locus_tag LOCUS_05460 704452 705030 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_05460 705084 705566 gene locus_tag LOCUS_05470 705084 705566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_05470 706048 705557 gene locus_tag LOCUS_05480 706048 705557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 708224 706095 gene locus_tag LOCUS_05490 708224 706095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 709142 708291 gene locus_tag LOCUS_05500 709142 708291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 709246 709959 gene locus_tag LOCUS_05510 709246 709959 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_05510 711582 710014 gene locus_tag LOCUS_05520 711582 710014 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_05520 713054 711594 gene locus_tag LOCUS_05530 713054 711594 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_05530 716219 713076 gene locus_tag LOCUS_05540 716219 713076 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_05540 716970 718556 gene locus_tag LOCUS_05550 716970 718556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 719545 718571 gene locus_tag LOCUS_05560 719545 718571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 720672 720124 gene locus_tag LOCUS_05570 720672 720124 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_05570 721191 720682 gene locus_tag LOCUS_05580 721191 720682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 722487 721204 gene locus_tag LOCUS_05590 722487 721204 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918269.1 protein_id gnl|my_center|LOCUS_05590 722806 722606 gene locus_tag LOCUS_05600 722806 722606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 722986 722816 gene locus_tag LOCUS_05610 722986 722816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 724126 723311 gene locus_tag LOCUS_05620 724126 723311 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_05620 724395 724126 gene locus_tag LOCUS_05630 724395 724126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 724561 725250 gene locus_tag LOCUS_05640 724561 725250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 725294 726520 gene locus_tag LOCUS_05650 725294 726520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_05650 727549 726875 gene locus_tag LOCUS_05660 727549 726875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 727696 728655 gene locus_tag LOCUS_05670 727696 728655 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_05670 728694 729593 gene locus_tag LOCUS_05680 728694 729593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_05680 731005 729596 gene locus_tag LOCUS_05690 731005 729596 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_05690 731928 731002 gene locus_tag LOCUS_05700 731928 731002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 733419 731932 gene locus_tag LOCUS_05710 733419 731932 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_05710 736121 733425 gene locus_tag LOCUS_05720 736121 733425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 736714 737076 gene locus_tag LOCUS_05730 736714 737076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 738716 737184 gene locus_tag LOCUS_05740 738716 737184 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_05740 742250 738735 gene locus_tag LOCUS_05750 742250 738735 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_05750 743262 742372 gene locus_tag LOCUS_05760 743262 742372 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790969.1 protein_id gnl|my_center|LOCUS_05760 743911 743324 gene locus_tag LOCUS_05770 743911 743324 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_05770 743999 744343 gene locus_tag LOCUS_05780 743999 744343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 744739 747729 gene locus_tag LOCUS_05790 744739 747729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 747738 748433 gene locus_tag LOCUS_05800 747738 748433 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_05800 748660 749397 gene locus_tag LOCUS_05810 748660 749397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 749521 750024 gene locus_tag LOCUS_05820 749521 750024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 750125 750775 gene locus_tag LOCUS_05830 750125 750775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 751394 754543 gene locus_tag LOCUS_05840 751394 754543 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_05840 754574 756091 gene locus_tag LOCUS_05850 754574 756091 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766186.1 protein_id gnl|my_center|LOCUS_05850 756117 756800 gene locus_tag LOCUS_05860 756117 756800 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766181.1 protein_id gnl|my_center|LOCUS_05860 756851 757804 gene locus_tag LOCUS_05870 756851 757804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 759033 757870 gene locus_tag LOCUS_05880 gene aar 759033 757870 CDS product bifunctional L-alanine/L-glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_05880 760373 759036 gene locus_tag LOCUS_05890 760373 759036 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_05890 760721 762622 gene locus_tag LOCUS_05900 760721 762622 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_05900 762638 763234 gene locus_tag LOCUS_05910 762638 763234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_05910 763292 764233 gene locus_tag LOCUS_05920 763292 764233 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_05920 766146 764638 gene locus_tag LOCUS_05930 766146 764638 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_05930 769292 766164 gene locus_tag LOCUS_05940 769292 766164 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_05940 769597 770925 gene locus_tag LOCUS_05950 769597 770925 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_05950 770922 772028 gene locus_tag LOCUS_05960 gene phnW 770922 772028 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203965.1 protein_id gnl|my_center|LOCUS_05960 773601 772159 gene locus_tag LOCUS_05970 gene phnY 773601 772159 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194628.1 protein_id gnl|my_center|LOCUS_05970 774857 773613 gene locus_tag LOCUS_05980 gene phnA 774857 773613 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040446.1 protein_id gnl|my_center|LOCUS_05980 775541 774957 gene locus_tag LOCUS_05990 775541 774957 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430090.1 protein_id gnl|my_center|LOCUS_05990 775627 776199 gene locus_tag LOCUS_06000 775627 776199 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_06000 776266 776340 gene locus_tag LOCUS_t00060 776266 776340 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 777626 776448 gene locus_tag LOCUS_06010 777626 776448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 777805 778146 gene locus_tag LOCUS_06020 777805 778146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 780172 778565 gene locus_tag LOCUS_06030 780172 778565 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136013900.1 protein_id gnl|my_center|LOCUS_06030 783535 780284 gene locus_tag LOCUS_06040 783535 780284 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_06040 784195 784755 gene locus_tag LOCUS_06050 784195 784755 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275291.1 protein_id gnl|my_center|LOCUS_06050 784764 786344 gene locus_tag LOCUS_06060 784764 786344 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083762.1 protein_id gnl|my_center|LOCUS_06060 786505 788265 gene locus_tag LOCUS_06070 786505 788265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 788324 788848 gene locus_tag LOCUS_06080 788324 788848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 788872 789384 gene locus_tag LOCUS_06090 788872 789384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 789435 790160 gene locus_tag LOCUS_06100 789435 790160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 790665 790135 gene locus_tag LOCUS_06110 gene idi 790665 790135 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_06110 791495 790995 gene locus_tag LOCUS_06120 791495 790995 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108357.1 protein_id gnl|my_center|LOCUS_06120 791970 793262 gene locus_tag LOCUS_06130 791970 793262 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_06130 793395 795929 gene locus_tag LOCUS_06140 793395 795929 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_06140 795958 797031 gene locus_tag LOCUS_06150 795958 797031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 797144 798292 gene locus_tag LOCUS_06160 797144 798292 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 protein_id gnl|my_center|LOCUS_06160 798319 798954 gene locus_tag LOCUS_06170 798319 798954 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942617.1 protein_id gnl|my_center|LOCUS_06170 798958 799965 gene locus_tag LOCUS_06180 gene neuB 798958 799965 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_06180 799962 801137 gene locus_tag LOCUS_06190 gene neuC 799962 801137 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 protein_id gnl|my_center|LOCUS_06190 801134 802021 gene locus_tag LOCUS_06200 801134 802021 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403379.1 protein_id gnl|my_center|LOCUS_06200 802018 802692 gene locus_tag LOCUS_06210 802018 802692 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_06210 802689 803735 gene locus_tag LOCUS_06220 802689 803735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 803750 804472 gene locus_tag LOCUS_06230 803750 804472 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 protein_id gnl|my_center|LOCUS_06230 804469 805404 gene locus_tag LOCUS_06240 804469 805404 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289368.1 protein_id gnl|my_center|LOCUS_06240 805385 806125 gene locus_tag LOCUS_06250 805385 806125 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261008.1 protein_id gnl|my_center|LOCUS_06250 806147 806725 gene locus_tag LOCUS_06260 806147 806725 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231291.1 protein_id gnl|my_center|LOCUS_06260 806722 808536 gene locus_tag LOCUS_06270 806722 808536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 810545 810823 gene locus_tag LOCUS_06280 810545 810823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 810825 811397 gene locus_tag LOCUS_06290 810825 811397 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261028.1 protein_id gnl|my_center|LOCUS_06290 812059 812571 gene locus_tag LOCUS_06300 812059 812571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 812587 813549 gene locus_tag LOCUS_06310 812587 813549 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942605.1 protein_id gnl|my_center|LOCUS_06310 813567 814478 gene locus_tag LOCUS_06320 813567 814478 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068986.1 protein_id gnl|my_center|LOCUS_06320 814546 815670 gene locus_tag LOCUS_06330 814546 815670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 815651 816502 gene locus_tag LOCUS_06340 815651 816502 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897935.1 protein_id gnl|my_center|LOCUS_06340 816504 817817 gene locus_tag LOCUS_06350 816504 817817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 818434 818859 gene locus_tag LOCUS_06360 818434 818859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 819018 820106 gene locus_tag LOCUS_06370 819018 820106 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_06370 820170 820865 gene locus_tag LOCUS_06380 820170 820865 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208589.1 protein_id gnl|my_center|LOCUS_06380 820946 822568 gene locus_tag LOCUS_06390 820946 822568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 823210 825114 gene locus_tag LOCUS_06400 823210 825114 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_06400 825241 826311 gene locus_tag LOCUS_06410 825241 826311 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_06410 826411 827523 gene locus_tag LOCUS_06420 gene gmd 826411 827523 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036868.1 protein_id gnl|my_center|LOCUS_06420 827528 828457 gene locus_tag LOCUS_06430 827528 828457 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_06430 830004 828535 gene locus_tag LOCUS_06440 830004 828535 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202983.1 protein_id gnl|my_center|LOCUS_06440 830600 830019 gene locus_tag LOCUS_06450 830600 830019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 830853 830647 gene locus_tag LOCUS_06460 830853 830647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 831494 830928 gene locus_tag LOCUS_06470 831494 830928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 834218 832017 gene locus_tag LOCUS_06480 834218 832017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 836135 834225 gene locus_tag LOCUS_06490 836135 834225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 837398 836214 gene locus_tag LOCUS_06500 837398 836214 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_06500 838624 837542 gene locus_tag LOCUS_06510 838624 837542 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_06510 840457 838676 gene locus_tag LOCUS_06520 840457 838676 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_06520 843878 840537 gene locus_tag LOCUS_06530 843878 840537 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143960588.1 protein_id gnl|my_center|LOCUS_06530 844250 845002 gene locus_tag LOCUS_06540 844250 845002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 846915 846211 gene locus_tag LOCUS_06550 846915 846211 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_06550 848588 846954 gene locus_tag LOCUS_06560 848588 846954 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_06560 848661 850751 gene locus_tag LOCUS_06570 gene ligA 848661 850751 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880378.1 protein_id gnl|my_center|LOCUS_06570 850748 851188 gene locus_tag LOCUS_06580 850748 851188 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_06580 852670 851261 gene locus_tag LOCUS_06590 852670 851261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 853680 852736 gene locus_tag LOCUS_06600 853680 852736 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027774.1 protein_id gnl|my_center|LOCUS_06600 854074 853865 gene locus_tag LOCUS_06610 854074 853865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 854984 854283 gene locus_tag LOCUS_06620 854984 854283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 855233 855829 gene locus_tag LOCUS_06630 gene sodA 855233 855829 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_06630 856674 855898 gene locus_tag LOCUS_06640 856674 855898 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_06640 858161 856689 gene locus_tag LOCUS_06650 858161 856689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 858971 858162 gene locus_tag LOCUS_06660 858971 858162 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_06660 860732 859074 gene locus_tag LOCUS_06670 860732 859074 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_06670 861009 860776 gene locus_tag LOCUS_06680 gene yidD 861009 860776 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962760.1 protein_id gnl|my_center|LOCUS_06680 861296 861006 gene locus_tag LOCUS_06690 861296 861006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 862359 861823 gene locus_tag LOCUS_06700 862359 861823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 862923 862429 gene locus_tag LOCUS_06710 862923 862429 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_06710 865681 862997 gene locus_tag LOCUS_06720 865681 862997 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_06720 866480 865719 gene locus_tag LOCUS_06730 866480 865719 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_06730 867483 866620 gene locus_tag LOCUS_06740 867483 866620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 868433 867543 gene locus_tag LOCUS_06750 868433 867543 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_06750 869876 868434 gene locus_tag LOCUS_06760 869876 868434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 870480 869896 gene locus_tag LOCUS_06770 870480 869896 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839781.1 protein_id gnl|my_center|LOCUS_06770 871449 870673 gene locus_tag LOCUS_06780 871449 870673 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_06780 872060 871524 gene locus_tag LOCUS_06790 872060 871524 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767606.1 protein_id gnl|my_center|LOCUS_06790 872520 872068 gene locus_tag LOCUS_06800 872520 872068 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_06800 872916 872533 gene locus_tag LOCUS_06810 gene gldC 872916 872533 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_06810 874000 872930 gene locus_tag LOCUS_06820 874000 872930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 874519 874088 gene locus_tag LOCUS_06830 874519 874088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 875698 874568 gene locus_tag LOCUS_06840 875698 874568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 876031 877023 gene locus_tag LOCUS_06850 876031 877023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 878191 877046 gene locus_tag LOCUS_06860 878191 877046 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_06860 879001 878195 gene locus_tag LOCUS_06870 879001 878195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 879108 880901 gene locus_tag LOCUS_06880 879108 880901 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_06880 880995 882776 gene locus_tag LOCUS_06890 880995 882776 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888269.1 protein_id gnl|my_center|LOCUS_06890 883316 883660 gene locus_tag LOCUS_06900 883316 883660 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_06900 883693 884730 gene locus_tag LOCUS_06910 883693 884730 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931856.1 protein_id gnl|my_center|LOCUS_06910 884958 885407 gene locus_tag LOCUS_06920 884958 885407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 885470 885655 gene locus_tag LOCUS_06930 885470 885655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 886399 885761 gene locus_tag LOCUS_06940 886399 885761 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246469.1 protein_id gnl|my_center|LOCUS_06940 887952 886411 gene locus_tag LOCUS_06950 887952 886411 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_06950 888038 888811 gene locus_tag LOCUS_06960 888038 888811 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_06960 888815 889843 gene locus_tag LOCUS_06970 gene thiL 888815 889843 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_06970 891567 889903 gene locus_tag LOCUS_06980 891567 889903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 892391 891600 gene locus_tag LOCUS_06990 892391 891600 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 protein_id gnl|my_center|LOCUS_06990 892927 892466 gene locus_tag LOCUS_07000 892927 892466 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_07000 895323 892990 gene locus_tag LOCUS_07010 895323 892990 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_07010 896968 895451 gene locus_tag LOCUS_07020 896968 895451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 897549 897091 gene locus_tag LOCUS_07030 gene rpiB 897549 897091 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_07030 898392 897589 gene locus_tag LOCUS_07040 gene tatC 898392 897589 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_07040 900331 899060 gene locus_tag LOCUS_07050 900331 899060 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_07050 900958 900389 gene locus_tag LOCUS_07060 gene gmk 900958 900389 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_07060 902277 900964 gene locus_tag LOCUS_07070 gene murA 902277 900964 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964114.1 protein_id gnl|my_center|LOCUS_07070 902972 902274 gene locus_tag LOCUS_07080 902972 902274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 903146 903931 gene locus_tag LOCUS_07090 903146 903931 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968528.1 protein_id gnl|my_center|LOCUS_07090 904051 905091 gene locus_tag LOCUS_07100 904051 905091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 905635 905168 gene locus_tag LOCUS_07110 905635 905168 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_07110 906297 907004 gene locus_tag LOCUS_07120 gene trmB 906297 907004 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_07120 906976 907173 gene locus_tag LOCUS_07130 906976 907173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 907106 907519 gene locus_tag LOCUS_07140 907106 907519 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_07140 907550 907993 gene locus_tag LOCUS_07150 907550 907993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 908039 908278 gene locus_tag LOCUS_07160 908039 908278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 908338 910353 gene locus_tag LOCUS_07170 908338 910353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 910375 911127 gene locus_tag LOCUS_07180 910375 911127 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937899.1 protein_id gnl|my_center|LOCUS_07180 912285 911131 gene locus_tag LOCUS_07190 912285 911131 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_07190 912493 913539 gene locus_tag LOCUS_07200 912493 913539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 913806 913540 gene locus_tag LOCUS_07210 913806 913540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 914843 913887 gene locus_tag LOCUS_07220 914843 913887 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_07220 915430 914900 gene locus_tag LOCUS_07230 915430 914900 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_07230 917053 915617 gene locus_tag LOCUS_07240 gene asnS 917053 915617 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_07240 917415 919124 gene locus_tag LOCUS_07250 gene rho 917415 919124 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_07250 919663 919205 gene locus_tag LOCUS_07260 919663 919205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 920955 920341 gene locus_tag LOCUS_07270 920955 920341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 921680 921072 gene locus_tag LOCUS_07280 921680 921072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 922943 921969 gene locus_tag LOCUS_07290 922943 921969 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_07290 923510 923064 gene locus_tag LOCUS_07300 923510 923064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 923921 924511 gene locus_tag LOCUS_07310 923921 924511 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 protein_id gnl|my_center|LOCUS_07310 924567 925184 gene locus_tag LOCUS_07320 924567 925184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 925579 926718 gene locus_tag LOCUS_07330 925579 926718 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_07330 926818 927591 gene locus_tag LOCUS_07340 926818 927591 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_07340 927607 928545 gene locus_tag LOCUS_07350 927607 928545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 928545 928880 gene locus_tag LOCUS_07360 928545 928880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 929608 928946 gene locus_tag LOCUS_07370 929608 928946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 931538 929679 gene locus_tag LOCUS_07380 931538 929679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 931673 932689 gene locus_tag LOCUS_07390 931673 932689 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674020.1 protein_id gnl|my_center|LOCUS_07390 932699 933586 gene locus_tag LOCUS_07400 932699 933586 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_07400 934627 933893 gene locus_tag LOCUS_07410 934627 933893 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_07410 935506 934679 gene locus_tag LOCUS_07420 935506 934679 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_07420 935705 937243 gene locus_tag LOCUS_07430 gene lysS 935705 937243 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_07430 937390 937776 gene locus_tag LOCUS_07440 937390 937776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 938086 940134 gene locus_tag LOCUS_07450 938086 940134 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_07450 941473 941135 gene locus_tag LOCUS_07460 941473 941135 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_07460 942709 941720 gene locus_tag LOCUS_07470 942709 941720 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083050.1 protein_id gnl|my_center|LOCUS_07470 943459 942908 gene locus_tag LOCUS_07480 943459 942908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 944615 943464 gene locus_tag LOCUS_07490 944615 943464 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_07490 945426 944740 gene locus_tag LOCUS_07500 945426 944740 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964522.1 protein_id gnl|my_center|LOCUS_07500 946128 945493 gene locus_tag LOCUS_07510 946128 945493 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_07510 946240 947139 gene locus_tag LOCUS_07520 gene meaB 946240 947139 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869690.1 protein_id gnl|my_center|LOCUS_07520 947316 947642 gene locus_tag LOCUS_07530 gene sugE 947316 947642 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941368.1 protein_id gnl|my_center|LOCUS_07530 948122 948733 gene locus_tag LOCUS_07540 948122 948733 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143585.1 protein_id gnl|my_center|LOCUS_07540 948946 948752 gene locus_tag LOCUS_07550 948946 948752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 949594 949022 gene locus_tag LOCUS_07560 949594 949022 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_07560 950254 949604 gene locus_tag LOCUS_07570 950254 949604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 950829 950431 gene locus_tag LOCUS_07580 950829 950431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 951559 950882 gene locus_tag LOCUS_07590 951559 950882 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066651.1 protein_id gnl|my_center|LOCUS_07590 952176 951613 gene locus_tag LOCUS_07600 952176 951613 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_07600 953017 952181 gene locus_tag LOCUS_07610 gene cyoE 953017 952181 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_07610 954846 953149 gene locus_tag LOCUS_07620 954846 953149 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_07620 956133 955090 gene locus_tag LOCUS_07630 956133 955090 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_07630 957392 956193 gene locus_tag LOCUS_07640 957392 956193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 958077 957439 gene locus_tag LOCUS_07650 958077 957439 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_07650 958753 958181 gene locus_tag LOCUS_07660 958753 958181 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_07660 960228 958795 gene locus_tag LOCUS_07670 gene nrfD 960228 958795 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_07670 963456 960349 gene locus_tag LOCUS_07680 963456 960349 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_07680 964644 963520 gene locus_tag LOCUS_07690 964644 963520 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_07690 965324 965887 gene locus_tag LOCUS_07700 gene purN 965324 965887 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796813.1 protein_id gnl|my_center|LOCUS_07700 965945 966595 gene locus_tag LOCUS_07710 965945 966595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 968845 966596 gene locus_tag LOCUS_07720 968845 966596 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765025.1 protein_id gnl|my_center|LOCUS_07720 970243 969011 gene locus_tag LOCUS_07730 gene zigA 970243 969011 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_07730 970812 970393 gene locus_tag LOCUS_07740 970812 970393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 970974 971603 gene locus_tag LOCUS_07750 970974 971603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_07750 971600 972838 gene locus_tag LOCUS_07760 971600 972838 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400343.1 protein_id gnl|my_center|LOCUS_07760 972831 973400 gene locus_tag LOCUS_07770 972831 973400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 973468 974094 gene locus_tag LOCUS_07780 973468 974094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 974106 974534 gene locus_tag LOCUS_07790 974106 974534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 976322 974601 gene locus_tag LOCUS_07800 976322 974601 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_07800 977493 976864 gene locus_tag LOCUS_07810 977493 976864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 979160 977580 gene locus_tag LOCUS_07820 979160 977580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 979352 980341 gene locus_tag LOCUS_07830 979352 980341 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_07830 980830 981081 gene locus_tag LOCUS_07840 980830 981081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 981839 981174 gene locus_tag LOCUS_07850 981839 981174 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_07850 983081 982026 gene locus_tag LOCUS_07860 983081 982026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 984516 983281 gene locus_tag LOCUS_07870 984516 983281 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_07870 987142 985094 gene locus_tag LOCUS_07880 gene uvrB 987142 985094 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_07880 987234 988028 gene locus_tag LOCUS_07890 987234 988028 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence02 279 683 gene locus_tag LOCUS_07900 279 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 800 985 gene locus_tag LOCUS_07910 800 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1165 944 gene locus_tag LOCUS_07920 1165 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1622 2572 gene locus_tag LOCUS_07930 1622 2572 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_07930 3989 2643 gene locus_tag LOCUS_07940 gene hisS 3989 2643 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_07940 4443 4021 gene locus_tag LOCUS_07950 4443 4021 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_07950 5055 5921 gene locus_tag LOCUS_07960 5055 5921 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_07960 5956 7680 gene locus_tag LOCUS_07970 5956 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7923 9635 gene locus_tag LOCUS_07980 7923 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 10057 10272 gene locus_tag LOCUS_07990 10057 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 10336 10899 gene locus_tag LOCUS_08000 10336 10899 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_08000 10919 11440 gene locus_tag LOCUS_08010 10919 11440 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964320.1 protein_id gnl|my_center|LOCUS_08010 11465 12682 gene locus_tag LOCUS_08020 11465 12682 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_08020 12790 13287 gene locus_tag LOCUS_08030 12790 13287 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_08030 13331 14689 gene locus_tag LOCUS_08040 gene nuoF 13331 14689 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_08040 14729 15835 gene locus_tag LOCUS_08050 14729 15835 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_08050 15844 16890 gene locus_tag LOCUS_08060 gene nuoH 15844 16890 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_08060 16916 17434 gene locus_tag LOCUS_08070 16916 17434 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_08070 17439 17933 gene locus_tag LOCUS_08080 17439 17933 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_08080 17944 18261 gene locus_tag LOCUS_08090 gene nuoK 17944 18261 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_08090 18284 20182 gene locus_tag LOCUS_08100 gene nuoL 18284 20182 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_08100 20208 21653 gene locus_tag LOCUS_08110 20208 21653 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_08110 21726 23048 gene locus_tag LOCUS_08120 21726 23048 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_08120 23171 24448 gene locus_tag LOCUS_08130 23171 24448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_08130 24650 25426 gene locus_tag LOCUS_08140 24650 25426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 26492 26046 gene locus_tag LOCUS_08150 gene rplI 26492 26046 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933786.1 protein_id gnl|my_center|LOCUS_08150 26804 26499 gene locus_tag LOCUS_08160 gene rpsR 26804 26499 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_08160 27129 26776 gene locus_tag LOCUS_08170 gene rpsF 27129 26776 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_08170 27387 29210 gene locus_tag LOCUS_08180 gene htpG 27387 29210 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_08180 29469 30257 gene locus_tag LOCUS_08190 29469 30257 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_08190 32023 30317 gene locus_tag LOCUS_08200 gene recJ 32023 30317 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_08200 33105 32140 gene locus_tag LOCUS_08210 33105 32140 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_08210 33342 34892 gene locus_tag LOCUS_08220 33342 34892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 35096 37063 gene locus_tag LOCUS_08230 35096 37063 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_08230 37128 38867 gene locus_tag LOCUS_08240 37128 38867 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814343.1 protein_id gnl|my_center|LOCUS_08240 40693 38969 gene locus_tag LOCUS_08250 40693 38969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 42211 40802 gene locus_tag LOCUS_08260 gene ftsA 42211 40802 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_08260 43267 42227 gene locus_tag LOCUS_08270 43267 42227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 44641 43283 gene locus_tag LOCUS_08280 gene murC 44641 43283 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_08280 45740 44646 gene locus_tag LOCUS_08290 gene murG 45740 44646 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_08290 46925 45759 gene locus_tag LOCUS_08300 46925 45759 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_08300 48287 46944 gene locus_tag LOCUS_08310 gene murD 48287 46944 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_08310 49545 48295 gene locus_tag LOCUS_08320 gene mraY 49545 48295 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_08320 51029 49563 gene locus_tag LOCUS_08330 51029 49563 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_08330 53139 51037 gene locus_tag LOCUS_08340 53139 51037 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_08340 53548 53177 gene locus_tag LOCUS_08350 53548 53177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 54531 53623 gene locus_tag LOCUS_08360 gene rsmH 54531 53623 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_08360 55013 54543 gene locus_tag LOCUS_08370 gene mraZ 55013 54543 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_08370 55323 56156 gene locus_tag LOCUS_08380 55323 56156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 56125 56466 gene locus_tag LOCUS_08390 56125 56466 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_08390 56543 57748 gene locus_tag LOCUS_08400 gene coaBC 56543 57748 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_08400 57741 58655 gene locus_tag LOCUS_08410 57741 58655 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015543.1 protein_id gnl|my_center|LOCUS_08410 58661 59137 gene locus_tag LOCUS_08420 58661 59137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 59169 59900 gene locus_tag LOCUS_08430 59169 59900 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_08430 59908 60564 gene locus_tag LOCUS_08440 59908 60564 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_08440 60579 61409 gene locus_tag LOCUS_08450 gene ilvE 60579 61409 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528132.1 protein_id gnl|my_center|LOCUS_08450 61493 62791 gene locus_tag LOCUS_08460 61493 62791 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_08460 64056 63259 gene locus_tag LOCUS_08470 64056 63259 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139445789.1 protein_id gnl|my_center|LOCUS_08470 64724 64068 gene locus_tag LOCUS_08480 gene mqnB 64724 64068 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228023.1 protein_id gnl|my_center|LOCUS_08480 64762 65199 gene locus_tag LOCUS_08490 64762 65199 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_08490 65220 65825 gene locus_tag LOCUS_08500 gene folE 65220 65825 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_08500 65940 66842 gene locus_tag LOCUS_08510 gene fabD 65940 66842 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_08510 66903 67307 gene locus_tag LOCUS_08520 66903 67307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 67759 67358 gene locus_tag LOCUS_08530 67759 67358 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_08530 69039 67819 gene locus_tag LOCUS_08540 gene megL 69039 67819 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_08540 69118 69612 gene locus_tag LOCUS_08550 69118 69612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 69644 70339 gene locus_tag LOCUS_08560 69644 70339 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_08560 70543 70806 gene locus_tag LOCUS_08570 70543 70806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 71863 70859 gene locus_tag LOCUS_08580 71863 70859 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_08580 71957 72544 gene locus_tag LOCUS_08590 gene ruvA 71957 72544 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_08590 72726 79826 gene locus_tag LOCUS_08600 gene sprA 72726 79826 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_08600 79948 80307 gene locus_tag LOCUS_08610 79948 80307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963894.1 protein_id gnl|my_center|LOCUS_08610 80570 82777 gene locus_tag LOCUS_08620 80570 82777 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_08620 82774 83988 gene locus_tag LOCUS_08630 82774 83988 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536056.1 protein_id gnl|my_center|LOCUS_08630 85172 84411 gene locus_tag LOCUS_08640 85172 84411 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_08640 87116 85185 gene locus_tag LOCUS_08650 87116 85185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 89868 87271 gene locus_tag LOCUS_08660 89868 87271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 90698 89895 gene locus_tag LOCUS_08670 90698 89895 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_08670 92286 90679 gene locus_tag LOCUS_08680 gene lnt 92286 90679 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_08680 94073 92595 gene locus_tag LOCUS_08690 gene guaB 94073 92595 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_08690 95294 94188 gene locus_tag LOCUS_08700 gene dprA 95294 94188 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_08700 95457 96245 gene locus_tag LOCUS_08710 95457 96245 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922649.1 protein_id gnl|my_center|LOCUS_08710 97133 96672 gene locus_tag LOCUS_08720 97133 96672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 98978 97140 gene locus_tag LOCUS_08730 98978 97140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 99660 99079 gene locus_tag LOCUS_08740 99660 99079 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_08740 100623 99736 gene locus_tag LOCUS_08750 100623 99736 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_08750 102340 100739 gene locus_tag LOCUS_08760 gene pckA 102340 100739 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_08760 102646 103938 gene locus_tag LOCUS_08770 102646 103938 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_08770 104108 104875 gene locus_tag LOCUS_08780 104108 104875 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_08780 104942 105187 gene locus_tag LOCUS_08790 gene purS 104942 105187 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_08790 105191 105865 gene locus_tag LOCUS_08800 gene rsmI 105191 105865 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_08800 106211 105840 gene locus_tag LOCUS_08810 106211 105840 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052031444.1 protein_id gnl|my_center|LOCUS_08810 106638 106261 gene locus_tag LOCUS_08820 106638 106261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 107872 108465 gene locus_tag LOCUS_08830 107872 108465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 108510 109262 gene locus_tag LOCUS_08840 108510 109262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 109278 110726 gene locus_tag LOCUS_08850 109278 110726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 110740 112767 gene locus_tag LOCUS_08860 110740 112767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 112798 113229 gene locus_tag LOCUS_08870 112798 113229 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_08870 113233 113745 gene locus_tag LOCUS_08880 113233 113745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 113758 113940 gene locus_tag LOCUS_08890 113758 113940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 113942 114718 gene locus_tag LOCUS_08900 113942 114718 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_08900 114715 116451 gene locus_tag LOCUS_08910 114715 116451 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_08910 116464 116748 gene locus_tag LOCUS_08920 116464 116748 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_08920 116769 117170 gene locus_tag LOCUS_08930 116769 117170 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_08930 117172 120441 gene locus_tag LOCUS_08940 117172 120441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 120461 121534 gene locus_tag LOCUS_08950 120461 121534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 121538 124867 gene locus_tag LOCUS_08960 121538 124867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 124878 126470 gene locus_tag LOCUS_08970 124878 126470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 126470 128830 gene locus_tag LOCUS_08980 126470 128830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 128995 130380 gene locus_tag LOCUS_08990 128995 130380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 130373 131737 gene locus_tag LOCUS_09000 130373 131737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 131756 132430 gene locus_tag LOCUS_09010 131756 132430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 132435 136304 gene locus_tag LOCUS_09020 132435 136304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 136385 138262 gene locus_tag LOCUS_09030 136385 138262 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_09030 139350 138337 gene locus_tag LOCUS_09040 139350 138337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 140776 139421 gene locus_tag LOCUS_09050 140776 139421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 141731 140757 gene locus_tag LOCUS_09060 141731 140757 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108163.1 protein_id gnl|my_center|LOCUS_09060 142235 141756 gene locus_tag LOCUS_09070 142235 141756 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_09070 142976 142416 gene locus_tag LOCUS_09080 142976 142416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 143229 142990 gene locus_tag LOCUS_09090 143229 142990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 143630 143256 gene locus_tag LOCUS_09100 143630 143256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 144193 143633 gene locus_tag LOCUS_09110 144193 143633 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366547.1 protein_id gnl|my_center|LOCUS_09110 144301 145203 gene locus_tag LOCUS_09120 144301 145203 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_09120 145821 145204 gene locus_tag LOCUS_09130 gene rsmG 145821 145204 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_09130 146971 145823 gene locus_tag LOCUS_09140 146971 145823 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_09140 147542 147081 gene locus_tag LOCUS_09150 147542 147081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 147835 148962 gene locus_tag LOCUS_09160 gene tgt 147835 148962 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_09160 149063 150142 gene locus_tag LOCUS_09170 149063 150142 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_09170 150276 151601 gene locus_tag LOCUS_09180 150276 151601 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_09180 151721 153832 gene locus_tag LOCUS_09190 gene recG 151721 153832 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_09190 154136 157714 gene locus_tag LOCUS_09200 154136 157714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 157721 158734 gene locus_tag LOCUS_09210 157721 158734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 158820 159377 gene locus_tag LOCUS_09220 158820 159377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 159439 160560 gene locus_tag LOCUS_09230 159439 160560 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073077526.1 protein_id gnl|my_center|LOCUS_09230 160669 162171 gene locus_tag LOCUS_09240 160669 162171 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_09240 162237 162908 gene locus_tag LOCUS_09250 162237 162908 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_09250 163154 163795 gene locus_tag LOCUS_09260 163154 163795 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_09260 163822 165180 gene locus_tag LOCUS_09270 163822 165180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 165202 165732 gene locus_tag LOCUS_09280 gene hpt 165202 165732 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_09280 165847 167571 gene locus_tag LOCUS_09290 165847 167571 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_09290 168973 167576 gene locus_tag LOCUS_09300 168973 167576 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_09300 169924 168980 gene locus_tag LOCUS_09310 169924 168980 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122317.1 protein_id gnl|my_center|LOCUS_09310 171202 170036 gene locus_tag LOCUS_09320 gene dnaJ 171202 170036 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_09320 171848 171282 gene locus_tag LOCUS_09330 171848 171282 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_09330 171975 173147 gene locus_tag LOCUS_09340 171975 173147 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_09340 174210 173860 gene locus_tag LOCUS_09350 174210 173860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 175413 174373 gene locus_tag LOCUS_09360 175413 174373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 178254 175417 gene locus_tag LOCUS_09370 178254 175417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 183098 178323 gene locus_tag LOCUS_09380 183098 178323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 183370 183975 gene locus_tag LOCUS_09390 183370 183975 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_09390 184039 184716 gene locus_tag LOCUS_09400 184039 184716 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964101.1 protein_id gnl|my_center|LOCUS_09400 185512 184760 gene locus_tag LOCUS_09410 185512 184760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 187026 185509 gene locus_tag LOCUS_09420 187026 185509 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_09420 187077 188204 gene locus_tag LOCUS_09430 187077 188204 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_09430 188208 188960 gene locus_tag LOCUS_09440 188208 188960 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_09440 189149 190525 gene locus_tag LOCUS_09450 189149 190525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 190542 192194 gene locus_tag LOCUS_09460 gene recN 190542 192194 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_09460 192243 193055 gene locus_tag LOCUS_09470 192243 193055 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_09470 193403 193182 gene locus_tag LOCUS_09480 193403 193182 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_09480 193501 194154 gene locus_tag LOCUS_09490 193501 194154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_09490 195006 194158 gene locus_tag LOCUS_09500 gene rfbD 195006 194158 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_09500 195577 195017 gene locus_tag LOCUS_09510 gene rfbC 195577 195017 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_09510 196632 195577 gene locus_tag LOCUS_09520 gene rfbB 196632 195577 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_09520 197606 196659 gene locus_tag LOCUS_09530 197606 196659 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_09530 198933 197599 gene locus_tag LOCUS_09540 198933 197599 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020726.1 protein_id gnl|my_center|LOCUS_09540 200068 198941 gene locus_tag LOCUS_09550 200068 198941 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_09550 200190 201425 gene locus_tag LOCUS_09560 200190 201425 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_09560 202135 201395 gene locus_tag LOCUS_09570 202135 201395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 202252 202827 gene locus_tag LOCUS_09580 202252 202827 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_09580 203323 202844 gene locus_tag LOCUS_09590 203323 202844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 204893 203403 gene locus_tag LOCUS_09600 gene accC 204893 203403 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_09600 204960 205628 gene locus_tag LOCUS_09610 204960 205628 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_09610 205764 206429 gene locus_tag LOCUS_09620 gene ccsA 205764 206429 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_09620 206422 206679 gene locus_tag LOCUS_09630 206422 206679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 206742 208178 gene locus_tag LOCUS_09640 206742 208178 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_09640 209033 208563 gene locus_tag LOCUS_09650 209033 208563 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761554.1 protein_id gnl|my_center|LOCUS_09650 209099 209869 gene locus_tag LOCUS_09660 209099 209869 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_09660 209869 211593 gene locus_tag LOCUS_09670 209869 211593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_09670 211660 212709 gene locus_tag LOCUS_09680 gene queA 211660 212709 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_09680 212788 213465 gene locus_tag LOCUS_09690 212788 213465 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_09690 213817 213467 gene locus_tag LOCUS_09700 213817 213467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 214443 214093 gene locus_tag LOCUS_09710 214443 214093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 215088 214648 gene locus_tag LOCUS_09720 215088 214648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 216079 215108 gene locus_tag LOCUS_09730 216079 215108 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_09730 216205 218196 gene locus_tag LOCUS_09740 216205 218196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 219052 218288 gene locus_tag LOCUS_09750 gene radC 219052 218288 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_09750 219193 220143 gene locus_tag LOCUS_09760 219193 220143 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_09760 220180 220770 gene locus_tag LOCUS_09770 220180 220770 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_09770 220869 221444 gene locus_tag LOCUS_09780 gene pth 220869 221444 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_09780 221644 222255 gene locus_tag LOCUS_09790 221644 222255 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_09790 222781 222347 gene locus_tag LOCUS_09800 222781 222347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 222891 224942 gene locus_tag LOCUS_09810 222891 224942 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_09810 227318 224943 gene locus_tag LOCUS_09820 227318 224943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_09820 227873 227499 gene locus_tag LOCUS_09830 227873 227499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 228128 228970 gene locus_tag LOCUS_09840 228128 228970 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727784.1 protein_id gnl|my_center|LOCUS_09840 229170 229958 gene locus_tag LOCUS_09850 229170 229958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 232553 230028 gene locus_tag LOCUS_09860 232553 230028 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849784.1 protein_id gnl|my_center|LOCUS_09860 232995 233540 gene locus_tag LOCUS_09870 232995 233540 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_09870 233556 234674 gene locus_tag LOCUS_09880 233556 234674 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_09880 234842 238207 gene locus_tag LOCUS_09890 234842 238207 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048699137.1 protein_id gnl|my_center|LOCUS_09890 238226 240049 gene locus_tag LOCUS_09900 238226 240049 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_09900 240082 241371 gene locus_tag LOCUS_09910 240082 241371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 241379 242914 gene locus_tag LOCUS_09920 241379 242914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 243180 242917 gene locus_tag LOCUS_09930 243180 242917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 243279 244040 gene locus_tag LOCUS_09940 243279 244040 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_09940 244165 245328 gene locus_tag LOCUS_09950 244165 245328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 245482 245556 gene locus_tag LOCUS_t00070 245482 245556 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 245822 246922 gene locus_tag LOCUS_09960 245822 246922 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_09960 246906 247859 gene locus_tag LOCUS_09970 246906 247859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 247898 248239 gene locus_tag LOCUS_09980 247898 248239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence03 1394 588 gene locus_tag LOCUS_09990 gene ispE 1394 588 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_09990 2003 1401 gene locus_tag LOCUS_10000 2003 1401 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_10000 3136 2165 gene locus_tag LOCUS_10010 3136 2165 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_10010 3928 3188 gene locus_tag LOCUS_10020 3928 3188 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_10020 4043 4348 gene locus_tag LOCUS_10030 4043 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4335 5702 gene locus_tag LOCUS_10040 gene tilS 4335 5702 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_10040 6305 5703 gene locus_tag LOCUS_10050 6305 5703 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_10050 6822 6337 gene locus_tag LOCUS_10060 gene rlmH 6822 6337 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_10060 6938 7012 gene locus_tag LOCUS_t00080 6938 7012 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7306 7097 gene locus_tag LOCUS_10070 7306 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 7886 7416 gene locus_tag LOCUS_10080 7886 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791963.1 protein_id gnl|my_center|LOCUS_10080 9777 7912 gene locus_tag LOCUS_10090 9777 7912 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668016.1 protein_id gnl|my_center|LOCUS_10090 13074 9805 gene locus_tag LOCUS_10100 13074 9805 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797388.1 protein_id gnl|my_center|LOCUS_10100 14339 13281 gene locus_tag LOCUS_10110 14339 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 14912 14412 gene locus_tag LOCUS_10120 14912 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 15987 15346 gene locus_tag LOCUS_10130 15987 15346 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033930894.1 protein_id gnl|my_center|LOCUS_10130 17902 15968 gene locus_tag LOCUS_10140 17902 15968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 18295 18369 gene locus_tag LOCUS_t00090 18295 18369 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18782 18540 gene locus_tag LOCUS_10150 18782 18540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 19839 19243 gene locus_tag LOCUS_10160 19839 19243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 20700 19849 gene locus_tag LOCUS_10170 20700 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 21474 20761 gene locus_tag LOCUS_10180 21474 20761 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877924.1 protein_id gnl|my_center|LOCUS_10180 21979 21518 gene locus_tag LOCUS_10190 21979 21518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 26800 22304 gene locus_tag LOCUS_10200 26800 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 29356 26804 gene locus_tag LOCUS_10210 29356 26804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 29488 31263 gene locus_tag LOCUS_10220 29488 31263 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640046.1 protein_id gnl|my_center|LOCUS_10220 31388 32260 gene locus_tag LOCUS_10230 31388 32260 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256732.1 protein_id gnl|my_center|LOCUS_10230 32356 32538 gene locus_tag LOCUS_10240 32356 32538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 32977 32618 gene locus_tag LOCUS_10250 32977 32618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 33058 33489 gene locus_tag LOCUS_10260 33058 33489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 33581 34354 gene locus_tag LOCUS_10270 33581 34354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 36779 34356 gene locus_tag LOCUS_10280 36779 34356 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099839674.1 protein_id gnl|my_center|LOCUS_10280 36865 37908 gene locus_tag LOCUS_10290 36865 37908 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612376.1 protein_id gnl|my_center|LOCUS_10290 38024 39307 gene locus_tag LOCUS_10300 38024 39307 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_10300 40264 39371 gene locus_tag LOCUS_10310 40264 39371 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_10310 40662 41978 gene locus_tag LOCUS_10320 40662 41978 CDS product DUF5074 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202480.1 protein_id gnl|my_center|LOCUS_10320 41981 43975 gene locus_tag LOCUS_10330 41981 43975 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_10330 43990 45126 gene locus_tag LOCUS_10340 43990 45126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 45163 46338 gene locus_tag LOCUS_10350 45163 46338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 46406 47311 gene locus_tag LOCUS_10360 46406 47311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 47358 47903 gene locus_tag LOCUS_10370 47358 47903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 48792 48010 gene locus_tag LOCUS_10380 48792 48010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 51011 50031 gene locus_tag LOCUS_10390 51011 50031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 51448 51191 gene locus_tag LOCUS_10400 51448 51191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 51703 53883 gene locus_tag LOCUS_10410 51703 53883 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_10410 53980 54372 gene locus_tag LOCUS_10420 53980 54372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 55079 54444 gene locus_tag LOCUS_10430 55079 54444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 56317 55076 gene locus_tag LOCUS_10440 gene rocD 56317 55076 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_10440 56580 56320 gene locus_tag LOCUS_10450 56580 56320 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_10450 56756 58549 gene locus_tag LOCUS_10460 gene lepA 56756 58549 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_10460 58542 59201 gene locus_tag LOCUS_10470 58542 59201 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_10470 59867 59274 gene locus_tag LOCUS_10480 59867 59274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 61117 59903 gene locus_tag LOCUS_10490 gene manA 61117 59903 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480231.1 protein_id gnl|my_center|LOCUS_10490 61157 61513 gene locus_tag LOCUS_10500 61157 61513 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_10500 61722 62009 gene locus_tag LOCUS_10510 61722 62009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 63243 62434 gene locus_tag LOCUS_10520 gene cdaA 63243 62434 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_10520 64076 63273 gene locus_tag LOCUS_10530 gene folP 64076 63273 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_10530 64226 64756 gene locus_tag LOCUS_10540 64226 64756 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_10540 64777 65865 gene locus_tag LOCUS_10550 64777 65865 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_10550 65871 66929 gene locus_tag LOCUS_10560 65871 66929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311351.1 protein_id gnl|my_center|LOCUS_10560 67045 67560 gene locus_tag LOCUS_10570 67045 67560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 67547 68041 gene locus_tag LOCUS_10580 67547 68041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 68098 68655 gene locus_tag LOCUS_10590 68098 68655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 68652 69263 gene locus_tag LOCUS_10600 68652 69263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 69547 69260 gene locus_tag LOCUS_10610 69547 69260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 70020 69583 gene locus_tag LOCUS_10620 70020 69583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312655.1 protein_id gnl|my_center|LOCUS_10620 70101 71039 gene locus_tag LOCUS_10630 70101 71039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 71094 71678 gene locus_tag LOCUS_10640 71094 71678 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_10640 71767 72186 gene locus_tag LOCUS_10650 71767 72186 CDS product DUF3995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905581.1 protein_id gnl|my_center|LOCUS_10650 72963 72208 gene locus_tag LOCUS_10660 72963 72208 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_10660 73085 73861 gene locus_tag LOCUS_10670 73085 73861 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037192.1 protein_id gnl|my_center|LOCUS_10670 74254 73862 gene locus_tag LOCUS_10680 74254 73862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 74813 74274 gene locus_tag LOCUS_10690 74813 74274 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531041.1 protein_id gnl|my_center|LOCUS_10690 75334 74945 gene locus_tag LOCUS_10700 75334 74945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 75588 76223 gene locus_tag LOCUS_10710 75588 76223 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974526.1 protein_id gnl|my_center|LOCUS_10710 81308 76296 gene locus_tag LOCUS_10720 81308 76296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 83067 81895 gene locus_tag LOCUS_10730 83067 81895 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089761628.1 protein_id gnl|my_center|LOCUS_10730 84324 83080 gene locus_tag LOCUS_10740 84324 83080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 85671 84346 gene locus_tag LOCUS_10750 85671 84346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 88736 85683 gene locus_tag LOCUS_10760 88736 85683 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_10760 89008 89949 gene locus_tag LOCUS_10770 89008 89949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 89954 91027 gene locus_tag LOCUS_10780 89954 91027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 90996 91691 gene locus_tag LOCUS_10790 90996 91691 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_10790 91777 92130 gene locus_tag LOCUS_10800 91777 92130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 92087 93289 gene locus_tag LOCUS_10810 92087 93289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 94230 93274 gene locus_tag LOCUS_10820 94230 93274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 96082 94946 gene locus_tag LOCUS_10830 96082 94946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 96687 96250 gene locus_tag LOCUS_10840 96687 96250 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 protein_id gnl|my_center|LOCUS_10840 96817 97293 gene locus_tag LOCUS_10850 96817 97293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 97958 97383 gene locus_tag LOCUS_10860 97958 97383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 98776 98015 gene locus_tag LOCUS_10870 98776 98015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 98932 99576 gene locus_tag LOCUS_10880 gene nreC 98932 99576 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706315.1 protein_id gnl|my_center|LOCUS_10880 100975 99653 gene locus_tag LOCUS_10890 100975 99653 CDS product DUF3472 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121875.1 protein_id gnl|my_center|LOCUS_10890 102387 101158 gene locus_tag LOCUS_10900 102387 101158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 105111 102568 gene locus_tag LOCUS_10910 105111 102568 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 protein_id gnl|my_center|LOCUS_10910 105603 106475 gene locus_tag LOCUS_10920 105603 106475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 106492 106956 gene locus_tag LOCUS_10930 106492 106956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 107329 106934 gene locus_tag LOCUS_10940 107329 106934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 107487 109877 gene locus_tag LOCUS_10950 107487 109877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_10950 111109 110102 gene locus_tag LOCUS_10960 111109 110102 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_10960 114855 111247 gene locus_tag LOCUS_10970 114855 111247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 115661 114864 gene locus_tag LOCUS_10980 115661 114864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 115711 115989 gene locus_tag LOCUS_10990 115711 115989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 116297 116590 gene locus_tag LOCUS_11000 116297 116590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 116740 117210 gene locus_tag LOCUS_11010 116740 117210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689404.1 protein_id gnl|my_center|LOCUS_11010 117436 119712 gene locus_tag LOCUS_11020 gene katG 117436 119712 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_11020 119852 120175 gene locus_tag LOCUS_11030 119852 120175 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_11030 120182 120652 gene locus_tag LOCUS_11040 120182 120652 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_11040 120661 121044 gene locus_tag LOCUS_11050 120661 121044 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_11050 121055 121636 gene locus_tag LOCUS_11060 121055 121636 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_11060 122142 122330 gene locus_tag LOCUS_11070 122142 122330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 122437 122919 gene locus_tag LOCUS_11080 122437 122919 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105215.1 protein_id gnl|my_center|LOCUS_11080 123041 123622 gene locus_tag LOCUS_11090 123041 123622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 123702 124649 gene locus_tag LOCUS_11100 123702 124649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640628.1 protein_id gnl|my_center|LOCUS_11100 124879 127476 gene locus_tag LOCUS_11110 gene ppsA 124879 127476 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_11110 128460 127522 gene locus_tag LOCUS_11120 128460 127522 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975928.1 protein_id gnl|my_center|LOCUS_11120 128711 129049 gene locus_tag LOCUS_11130 128711 129049 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721437.1 protein_id gnl|my_center|LOCUS_11130 132465 129148 gene locus_tag LOCUS_11140 132465 129148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 133310 132657 gene locus_tag LOCUS_11150 133310 132657 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_11150 134910 133396 gene locus_tag LOCUS_11160 134910 133396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 135422 135784 gene locus_tag LOCUS_11170 135422 135784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 136865 135858 gene locus_tag LOCUS_11180 136865 135858 CDS product DUF6528 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332817.1 protein_id gnl|my_center|LOCUS_11180 137273 138463 gene locus_tag LOCUS_11190 137273 138463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 138985 138590 gene locus_tag LOCUS_11200 gene glxB 138985 138590 CDS product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 protein_id gnl|my_center|LOCUS_11200 139424 139038 gene locus_tag LOCUS_11210 139424 139038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 140002 139445 gene locus_tag LOCUS_11220 140002 139445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 140639 140073 gene locus_tag LOCUS_11230 140639 140073 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_11230 140781 141647 gene locus_tag LOCUS_11240 140781 141647 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100978.1 protein_id gnl|my_center|LOCUS_11240 141631 142443 gene locus_tag LOCUS_11250 141631 142443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 143061 143819 gene locus_tag LOCUS_11260 143061 143819 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_11260 145086 143821 gene locus_tag LOCUS_11270 145086 143821 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892189.1 protein_id gnl|my_center|LOCUS_11270 145407 147647 gene locus_tag LOCUS_11280 145407 147647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 148136 148975 gene locus_tag LOCUS_11290 148136 148975 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_11290 148985 150004 gene locus_tag LOCUS_11300 148985 150004 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967069.1 protein_id gnl|my_center|LOCUS_11300 151171 150083 gene locus_tag LOCUS_11310 151171 150083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 151542 151177 gene locus_tag LOCUS_11320 151542 151177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 152171 155662 gene locus_tag LOCUS_11330 152171 155662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 155704 156093 gene locus_tag LOCUS_11340 155704 156093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 156173 156688 gene locus_tag LOCUS_11350 156173 156688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 158038 156695 gene locus_tag LOCUS_11360 158038 156695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 158858 158103 gene locus_tag LOCUS_11370 158858 158103 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_11370 160677 158821 gene locus_tag LOCUS_11380 160677 158821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 160818 162017 gene locus_tag LOCUS_11390 160818 162017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 163368 162112 gene locus_tag LOCUS_11400 163368 162112 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_11400 165946 163520 gene locus_tag LOCUS_11410 165946 163520 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_11410 166245 166838 gene locus_tag LOCUS_11420 166245 166838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 167045 168214 gene locus_tag LOCUS_11430 167045 168214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 168250 168969 gene locus_tag LOCUS_11440 168250 168969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 168911 169564 gene locus_tag LOCUS_11450 168911 169564 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963650.1 protein_id gnl|my_center|LOCUS_11450 169832 169626 gene locus_tag LOCUS_11460 169832 169626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964410.1 protein_id gnl|my_center|LOCUS_11460 170636 169878 gene locus_tag LOCUS_11470 170636 169878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964412.1 protein_id gnl|my_center|LOCUS_11470 171279 171458 gene locus_tag LOCUS_11480 171279 171458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 171465 171959 gene locus_tag LOCUS_11490 171465 171959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 172363 172025 gene locus_tag LOCUS_11500 172363 172025 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391821.1 protein_id gnl|my_center|LOCUS_11500 172556 172795 gene locus_tag LOCUS_11510 172556 172795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 173037 176162 gene locus_tag LOCUS_11520 173037 176162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 176140 177150 gene locus_tag LOCUS_11530 176140 177150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence04 928 245 gene locus_tag LOCUS_11540 928 245 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968527.1 protein_id gnl|my_center|LOCUS_11540 1853 981 gene locus_tag LOCUS_11550 1853 981 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138475095.1 protein_id gnl|my_center|LOCUS_11550 4502 1869 gene locus_tag LOCUS_11560 4502 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 5004 4603 gene locus_tag LOCUS_11570 5004 4603 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_11570 5188 6657 gene locus_tag LOCUS_11580 5188 6657 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_11580 7686 6730 gene locus_tag LOCUS_11590 7686 6730 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 protein_id gnl|my_center|LOCUS_11590 7758 8726 gene locus_tag LOCUS_11600 7758 8726 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256717.1 protein_id gnl|my_center|LOCUS_11600 8789 11065 gene locus_tag LOCUS_11610 8789 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 11437 11661 gene locus_tag LOCUS_11620 11437 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 11689 12207 gene locus_tag LOCUS_11630 11689 12207 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_11630 12673 13512 gene locus_tag LOCUS_11640 12673 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 13947 17348 gene locus_tag LOCUS_11650 13947 17348 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_11650 17431 19062 gene locus_tag LOCUS_11660 17431 19062 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_11660 19086 20435 gene locus_tag LOCUS_11670 19086 20435 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_11670 20906 21478 gene locus_tag LOCUS_11680 20906 21478 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_11680 21584 22600 gene locus_tag LOCUS_11690 21584 22600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 22623 25994 gene locus_tag LOCUS_11700 22623 25994 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_11700 26046 27482 gene locus_tag LOCUS_11710 26046 27482 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_11710 27803 30703 gene locus_tag LOCUS_11720 27803 30703 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_11720 30716 32224 gene locus_tag LOCUS_11730 30716 32224 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766186.1 protein_id gnl|my_center|LOCUS_11730 32224 33243 gene locus_tag LOCUS_11740 32224 33243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 33254 34318 gene locus_tag LOCUS_11750 33254 34318 CDS product DUF5007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698520.1 protein_id gnl|my_center|LOCUS_11750 34373 37456 gene locus_tag LOCUS_11760 34373 37456 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_11760 37469 38932 gene locus_tag LOCUS_11770 37469 38932 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766182.1 protein_id gnl|my_center|LOCUS_11770 38929 39606 gene locus_tag LOCUS_11780 38929 39606 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766181.1 protein_id gnl|my_center|LOCUS_11780 39625 41241 gene locus_tag LOCUS_11790 39625 41241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 41258 42922 gene locus_tag LOCUS_11800 41258 42922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 42950 44620 gene locus_tag LOCUS_11810 42950 44620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 45120 47513 gene locus_tag LOCUS_11820 45120 47513 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_11820 47640 48197 gene locus_tag LOCUS_11830 47640 48197 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_11830 48342 48608 gene locus_tag LOCUS_11840 48342 48608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 49176 48712 gene locus_tag LOCUS_11850 49176 48712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 50069 49254 gene locus_tag LOCUS_11860 50069 49254 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 protein_id gnl|my_center|LOCUS_11860 50423 51010 gene locus_tag LOCUS_11870 50423 51010 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_11870 51107 52270 gene locus_tag LOCUS_11880 51107 52270 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_11880 52402 55770 gene locus_tag LOCUS_11890 52402 55770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_11890 55819 57378 gene locus_tag LOCUS_11900 55819 57378 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_11900 57474 58595 gene locus_tag LOCUS_11910 57474 58595 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_11910 58588 59670 gene locus_tag LOCUS_11920 58588 59670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 60205 59675 gene locus_tag LOCUS_11930 60205 59675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 61346 60219 gene locus_tag LOCUS_11940 61346 60219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 62021 61359 gene locus_tag LOCUS_11950 62021 61359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 62154 63584 gene locus_tag LOCUS_11960 62154 63584 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_11960 63861 65093 gene locus_tag LOCUS_11970 63861 65093 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_11970 65097 68855 gene locus_tag LOCUS_11980 65097 68855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 69168 68917 gene locus_tag LOCUS_11990 69168 68917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 69645 69208 gene locus_tag LOCUS_12000 69645 69208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 69827 70300 gene locus_tag LOCUS_12010 69827 70300 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_12010 70782 70306 gene locus_tag LOCUS_12020 70782 70306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 72949 70802 gene locus_tag LOCUS_12030 72949 70802 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_12030 73317 75611 gene locus_tag LOCUS_12040 73317 75611 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_12040 75630 76847 gene locus_tag LOCUS_12050 75630 76847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 76919 78076 gene locus_tag LOCUS_12060 76919 78076 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_12060 80589 78142 gene locus_tag LOCUS_12070 80589 78142 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_12070 81655 80720 gene locus_tag LOCUS_12080 81655 80720 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359145.1 protein_id gnl|my_center|LOCUS_12080 81761 82264 gene locus_tag LOCUS_12090 81761 82264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 82633 82331 gene locus_tag LOCUS_12100 82633 82331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 83901 83119 gene locus_tag LOCUS_12110 83901 83119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 84180 84794 gene locus_tag LOCUS_12120 84180 84794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 85704 84946 gene locus_tag LOCUS_12130 85704 84946 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_12130 86789 85842 gene locus_tag LOCUS_12140 86789 85842 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583995.1 protein_id gnl|my_center|LOCUS_12140 87217 88305 gene locus_tag LOCUS_12150 87217 88305 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445143.1 protein_id gnl|my_center|LOCUS_12150 88412 88340 gene locus_tag LOCUS_t00100 88412 88340 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 88910 89650 gene locus_tag LOCUS_12160 88910 89650 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531692.1 protein_id gnl|my_center|LOCUS_12160 90886 89762 gene locus_tag LOCUS_12170 90886 89762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 91155 91997 gene locus_tag LOCUS_12180 91155 91997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 92099 93313 gene locus_tag LOCUS_12190 92099 93313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 93340 94170 gene locus_tag LOCUS_12200 93340 94170 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107118.1 protein_id gnl|my_center|LOCUS_12200 95211 94171 gene locus_tag LOCUS_12210 95211 94171 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551357.1 protein_id gnl|my_center|LOCUS_12210 95302 96915 gene locus_tag LOCUS_12220 95302 96915 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108902.1 protein_id gnl|my_center|LOCUS_12220 96950 98803 gene locus_tag LOCUS_12230 96950 98803 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_12230 99145 99753 gene locus_tag LOCUS_12240 99145 99753 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_12240 99844 101031 gene locus_tag LOCUS_12250 99844 101031 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_12250 101197 104400 gene locus_tag LOCUS_12260 101197 104400 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_12260 104421 105806 gene locus_tag LOCUS_12270 104421 105806 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_12270 105796 107589 gene locus_tag LOCUS_12280 105796 107589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 107656 108285 gene locus_tag LOCUS_12290 107656 108285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 108594 108286 gene locus_tag LOCUS_12300 108594 108286 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764805.1 protein_id gnl|my_center|LOCUS_12300 108902 108594 gene locus_tag LOCUS_12310 108902 108594 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764805.1 protein_id gnl|my_center|LOCUS_12310 109548 108949 gene locus_tag LOCUS_12320 109548 108949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 111037 109868 gene locus_tag LOCUS_12330 111037 109868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 protein_id gnl|my_center|LOCUS_12330 112282 111041 gene locus_tag LOCUS_12340 112282 111041 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618882.1 protein_id gnl|my_center|LOCUS_12340 112391 112765 gene locus_tag LOCUS_12350 112391 112765 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061015.1 protein_id gnl|my_center|LOCUS_12350 113412 116669 gene locus_tag LOCUS_12360 113412 116669 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_12360 116681 118201 gene locus_tag LOCUS_12370 116681 118201 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_12370 118210 119742 gene locus_tag LOCUS_12380 118210 119742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 119863 122331 gene locus_tag LOCUS_12390 119863 122331 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963253.1 protein_id gnl|my_center|LOCUS_12390 122291 123553 gene locus_tag LOCUS_12400 122291 123553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 124190 127213 gene locus_tag LOCUS_12410 124190 127213 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_12410 127226 128665 gene locus_tag LOCUS_12420 127226 128665 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764026.1 protein_id gnl|my_center|LOCUS_12420 128742 131474 gene locus_tag LOCUS_12430 128742 131474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 132102 131662 gene locus_tag LOCUS_12440 132102 131662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 133421 133347 gene locus_tag LOCUS_t00110 133421 133347 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 133563 134579 gene locus_tag LOCUS_12450 gene gap 133563 134579 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 protein_id gnl|my_center|LOCUS_12450 134676 135872 gene locus_tag LOCUS_12460 134676 135872 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962199.1 protein_id gnl|my_center|LOCUS_12460 137315 135942 gene locus_tag LOCUS_12470 137315 135942 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_12470 138013 137549 gene locus_tag LOCUS_12480 138013 137549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 138346 138924 gene locus_tag LOCUS_12490 138346 138924 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_12490 139012 139467 gene locus_tag LOCUS_12500 139012 139467 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_12500 139477 140292 gene locus_tag LOCUS_12510 139477 140292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 140379 141320 gene locus_tag LOCUS_12520 140379 141320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 141369 141836 gene locus_tag LOCUS_12530 141369 141836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 142771 141920 gene locus_tag LOCUS_12540 142771 141920 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096479.1 protein_id gnl|my_center|LOCUS_12540 143910 142834 gene locus_tag LOCUS_12550 143910 142834 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_12550 144932 143937 gene locus_tag LOCUS_12560 144932 143937 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_12560 145503 145039 gene locus_tag LOCUS_12570 145503 145039 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_12570 147455 146127 gene locus_tag LOCUS_12580 147455 146127 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966868.1 protein_id gnl|my_center|LOCUS_12580 150112 147572 gene locus_tag LOCUS_12590 150112 147572 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_12590 150289 150795 gene locus_tag LOCUS_12600 150289 150795 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_12600 150816 152384 gene locus_tag LOCUS_12610 150816 152384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 152468 153220 gene locus_tag LOCUS_12620 gene truA 152468 153220 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_12620 153936 155461 gene locus_tag LOCUS_r00010 153936 155461 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 155560 155637 gene locus_tag LOCUS_t00120 155560 155637 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 155701 155775 gene locus_tag LOCUS_t00130 155701 155775 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 155997 158874 gene locus_tag LOCUS_r00020 155997 158874 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 159008 159102 gene locus_tag LOCUS_r00030 159008 159102 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence05 906 103 gene locus_tag LOCUS_12630 906 103 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102407668.1 protein_id gnl|my_center|LOCUS_12630 1095 1673 gene locus_tag LOCUS_12640 1095 1673 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_12640 2062 2754 gene locus_tag LOCUS_12650 2062 2754 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_12650 3332 2847 gene locus_tag LOCUS_12660 3332 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 3669 3427 gene locus_tag LOCUS_12670 3669 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 5956 4487 gene locus_tag LOCUS_12680 5956 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6113 6406 gene locus_tag LOCUS_12690 6113 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 6602 6961 gene locus_tag LOCUS_12700 6602 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 7760 8272 gene locus_tag LOCUS_12710 7760 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 8809 8411 gene locus_tag LOCUS_12720 8809 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 10276 9356 gene locus_tag LOCUS_12730 10276 9356 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962435.1 protein_id gnl|my_center|LOCUS_12730 11655 10891 gene locus_tag LOCUS_12740 11655 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 13106 11916 gene locus_tag LOCUS_12750 13106 11916 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963747.1 protein_id gnl|my_center|LOCUS_12750 13586 13155 gene locus_tag LOCUS_12760 gene queF 13586 13155 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_12760 14098 13637 gene locus_tag LOCUS_12770 14098 13637 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073873.1 protein_id gnl|my_center|LOCUS_12770 15035 14151 gene locus_tag LOCUS_12780 15035 14151 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_12780 15312 16652 gene locus_tag LOCUS_12790 15312 16652 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_12790 16663 19998 gene locus_tag LOCUS_12800 16663 19998 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_12800 20013 22712 gene locus_tag LOCUS_12810 20013 22712 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_12810 23043 22831 gene locus_tag LOCUS_12820 23043 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 24763 23120 gene locus_tag LOCUS_12830 24763 23120 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_12830 26922 24784 gene locus_tag LOCUS_12840 26922 24784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 29186 26940 gene locus_tag LOCUS_12850 29186 26940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 30424 29201 gene locus_tag LOCUS_12860 30424 29201 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_12860 31899 30433 gene locus_tag LOCUS_12870 31899 30433 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_12870 35370 31918 gene locus_tag LOCUS_12880 35370 31918 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_12880 36369 35392 gene locus_tag LOCUS_12890 36369 35392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 37044 36451 gene locus_tag LOCUS_12900 37044 36451 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767805.1 protein_id gnl|my_center|LOCUS_12900 38080 37139 gene locus_tag LOCUS_12910 38080 37139 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_12910 39628 38093 gene locus_tag LOCUS_12920 39628 38093 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_12920 39774 40631 gene locus_tag LOCUS_12930 39774 40631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 41420 41049 gene locus_tag LOCUS_12940 41420 41049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255011.1 protein_id gnl|my_center|LOCUS_12940 42439 41573 gene locus_tag LOCUS_12950 42439 41573 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_12950 43545 42436 gene locus_tag LOCUS_12960 43545 42436 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_12960 44286 43573 gene locus_tag LOCUS_12970 44286 43573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 47492 44292 gene locus_tag LOCUS_12980 47492 44292 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090339627.1 protein_id gnl|my_center|LOCUS_12980 49075 47498 gene locus_tag LOCUS_12990 49075 47498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_12990 50163 49099 gene locus_tag LOCUS_13000 50163 49099 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_13000 50890 50183 gene locus_tag LOCUS_13010 50890 50183 CDS product DUF3823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053826137.1 protein_id gnl|my_center|LOCUS_13010 52803 50908 gene locus_tag LOCUS_13020 52803 50908 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_13020 55996 52823 gene locus_tag LOCUS_13030 55996 52823 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291394.1 protein_id gnl|my_center|LOCUS_13030 56388 59450 gene locus_tag LOCUS_13040 56388 59450 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13040 59457 60230 gene locus_tag LOCUS_13050 59457 60230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13050 60325 60954 gene locus_tag LOCUS_13060 60325 60954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 60959 61192 gene locus_tag LOCUS_13070 60959 61192 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_13070 62124 61189 gene locus_tag LOCUS_13080 62124 61189 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_13080 62207 62767 gene locus_tag LOCUS_13090 62207 62767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 63921 62764 gene locus_tag LOCUS_13100 63921 62764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 64478 64032 gene locus_tag LOCUS_13110 64478 64032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447940.1 protein_id gnl|my_center|LOCUS_13110 64866 65516 gene locus_tag LOCUS_13120 64866 65516 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_13120 65543 65806 gene locus_tag LOCUS_13130 65543 65806 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115710.1 protein_id gnl|my_center|LOCUS_13130 66048 68435 gene locus_tag LOCUS_13140 66048 68435 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_13140 68807 68562 gene locus_tag LOCUS_13150 68807 68562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 68833 69048 gene locus_tag LOCUS_13160 68833 69048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 70173 69085 gene locus_tag LOCUS_13170 70173 69085 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764889.1 protein_id gnl|my_center|LOCUS_13170 70757 70170 gene locus_tag LOCUS_13180 70757 70170 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_13180 71701 70823 gene locus_tag LOCUS_13190 71701 70823 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_13190 71987 71763 gene locus_tag LOCUS_13200 71987 71763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 72717 72052 gene locus_tag LOCUS_13210 72717 72052 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_13210 74106 72739 gene locus_tag LOCUS_13220 74106 72739 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_13220 74887 74192 gene locus_tag LOCUS_13230 74887 74192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 75567 74908 gene locus_tag LOCUS_13240 75567 74908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 76325 75642 gene locus_tag LOCUS_13250 76325 75642 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_13250 77032 77808 gene locus_tag LOCUS_13260 77032 77808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 78714 78094 gene locus_tag LOCUS_13270 78714 78094 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_13270 79369 78698 gene locus_tag LOCUS_13280 79369 78698 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963651.1 protein_id gnl|my_center|LOCUS_13280 81628 79817 gene locus_tag LOCUS_13290 81628 79817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 83406 81649 gene locus_tag LOCUS_13300 83406 81649 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_13300 86547 83440 gene locus_tag LOCUS_13310 86547 83440 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_13310 88479 86584 gene locus_tag LOCUS_13320 88479 86584 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_13320 91633 88499 gene locus_tag LOCUS_13330 91633 88499 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_13330 93489 91726 gene locus_tag LOCUS_13340 93489 91726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 94609 93998 gene locus_tag LOCUS_13350 94609 93998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 94960 94637 gene locus_tag LOCUS_13360 94960 94637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 95192 96577 gene locus_tag LOCUS_13370 95192 96577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 96678 97415 gene locus_tag LOCUS_13380 96678 97415 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971351.1 protein_id gnl|my_center|LOCUS_13380 97519 98706 gene locus_tag LOCUS_13390 97519 98706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 98719 99738 gene locus_tag LOCUS_13400 98719 99738 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764715.1 protein_id gnl|my_center|LOCUS_13400 99735 100439 gene locus_tag LOCUS_13410 99735 100439 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_13410 100632 101441 gene locus_tag LOCUS_13420 100632 101441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 102746 101538 gene locus_tag LOCUS_13430 102746 101538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 102927 104003 gene locus_tag LOCUS_13440 102927 104003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 104099 104416 gene locus_tag LOCUS_13450 104099 104416 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897230.1 protein_id gnl|my_center|LOCUS_13450 105468 104422 gene locus_tag LOCUS_13460 105468 104422 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929827.1 protein_id gnl|my_center|LOCUS_13460 105573 105980 gene locus_tag LOCUS_13470 105573 105980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 108774 105946 gene locus_tag LOCUS_13480 108774 105946 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 protein_id gnl|my_center|LOCUS_13480 108976 109332 gene locus_tag LOCUS_13490 108976 109332 CDS product DUF3088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265530.1 protein_id gnl|my_center|LOCUS_13490 109439 111853 gene locus_tag LOCUS_13500 109439 111853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_13500 111863 114274 gene locus_tag LOCUS_13510 111863 114274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_13510 115779 114994 gene locus_tag LOCUS_13520 115779 114994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 116768 115968 gene locus_tag LOCUS_13530 116768 115968 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_13530 117251 116811 gene locus_tag LOCUS_13540 117251 116811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 117929 117303 gene locus_tag LOCUS_13550 117929 117303 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_13550 119195 117951 gene locus_tag LOCUS_13560 119195 117951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_13560 120280 119234 gene locus_tag LOCUS_13570 120280 119234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 121852 120344 gene locus_tag LOCUS_13580 121852 120344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 122804 121857 gene locus_tag LOCUS_13590 122804 121857 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_13590 123967 122837 gene locus_tag LOCUS_13600 123967 122837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 125165 124008 gene locus_tag LOCUS_13610 125165 124008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 126651 125176 gene locus_tag LOCUS_13620 126651 125176 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 protein_id gnl|my_center|LOCUS_13620 130024 126677 gene locus_tag LOCUS_13630 130024 126677 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203530.1 protein_id gnl|my_center|LOCUS_13630 131022 130342 gene locus_tag LOCUS_13640 131022 130342 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770033.1 protein_id gnl|my_center|LOCUS_13640 131179 131790 gene locus_tag LOCUS_13650 131179 131790 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_13650 131829 132899 gene locus_tag LOCUS_13660 131829 132899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 133181 134497 gene locus_tag LOCUS_13670 133181 134497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 135390 134500 gene locus_tag LOCUS_13680 135390 134500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 135890 135480 gene locus_tag LOCUS_13690 135890 135480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 137167 135908 gene locus_tag LOCUS_13700 137167 135908 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_13700 137632 140502 gene locus_tag LOCUS_13710 137632 140502 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_13710 140522 142126 gene locus_tag LOCUS_13720 140522 142126 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_13720 142322 142834 gene locus_tag LOCUS_13730 142322 142834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 143247 142951 gene locus_tag LOCUS_13740 143247 142951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 145246 143465 gene locus_tag LOCUS_13750 145246 143465 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817445.1 protein_id gnl|my_center|LOCUS_13750 148636 145265 gene locus_tag LOCUS_13760 148636 145265 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_13760 149944 148883 gene locus_tag LOCUS_13770 149944 148883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 150272 150841 gene locus_tag LOCUS_13780 150272 150841 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763953.1 protein_id gnl|my_center|LOCUS_13780 153024 150910 gene locus_tag LOCUS_13790 153024 150910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 153390 155762 gene locus_tag LOCUS_13800 153390 155762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence06 1300 683 gene locus_tag LOCUS_13810 1300 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1543 2295 gene locus_tag LOCUS_13820 1543 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2868 2575 gene locus_tag LOCUS_13830 gene rplT 2868 2575 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_13830 3156 2959 gene locus_tag LOCUS_13840 gene rpmI 3156 2959 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015481.1 protein_id gnl|my_center|LOCUS_13840 3660 24767 gene locus_tag LOCUS_13850 3660 24767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 24880 25281 gene locus_tag LOCUS_13860 24880 25281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 25331 25666 gene locus_tag LOCUS_13870 25331 25666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 25671 26060 gene locus_tag LOCUS_13880 25671 26060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 26091 26486 gene locus_tag LOCUS_13890 26091 26486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 26923 26543 gene locus_tag LOCUS_13900 26923 26543 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527883.1 protein_id gnl|my_center|LOCUS_13900 28722 27445 gene locus_tag LOCUS_13910 gene serA 28722 27445 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 protein_id gnl|my_center|LOCUS_13910 28934 30142 gene locus_tag LOCUS_13920 28934 30142 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_13920 31606 30254 gene locus_tag LOCUS_13930 31606 30254 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_13930 32812 31619 gene locus_tag LOCUS_13940 32812 31619 CDS product DUF4998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108514.1 protein_id gnl|my_center|LOCUS_13940 33996 32833 gene locus_tag LOCUS_13950 33996 32833 CDS product DUF4959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108515.1 protein_id gnl|my_center|LOCUS_13950 35867 34011 gene locus_tag LOCUS_13960 35867 34011 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108516.1 protein_id gnl|my_center|LOCUS_13960 39296 35886 gene locus_tag LOCUS_13970 39296 35886 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765284.1 protein_id gnl|my_center|LOCUS_13970 40492 39431 gene locus_tag LOCUS_13980 40492 39431 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_13980 41228 40626 gene locus_tag LOCUS_13990 41228 40626 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_13990 41622 41440 gene locus_tag LOCUS_14000 41622 41440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 44753 41652 gene locus_tag LOCUS_14010 44753 41652 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_14010 45855 44758 gene locus_tag LOCUS_14020 45855 44758 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765562.1 protein_id gnl|my_center|LOCUS_14020 47141 45852 gene locus_tag LOCUS_14030 47141 45852 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107396.1 protein_id gnl|my_center|LOCUS_14030 48562 47186 gene locus_tag LOCUS_14040 48562 47186 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_14040 49258 48569 gene locus_tag LOCUS_14050 49258 48569 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_14050 50247 49300 gene locus_tag LOCUS_14060 50247 49300 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_14060 50347 50883 gene locus_tag LOCUS_14070 50347 50883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 51610 50933 gene locus_tag LOCUS_14080 gene infC 51610 50933 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_14080 53737 51794 gene locus_tag LOCUS_14090 gene thrS 53737 51794 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_14090 54519 55199 gene locus_tag LOCUS_14100 54519 55199 CDS product SMUG2 DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 protein_id gnl|my_center|LOCUS_14100 55801 55223 gene locus_tag LOCUS_14110 55801 55223 CDS product DUF3347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073122886.1 protein_id gnl|my_center|LOCUS_14110 55828 57810 gene locus_tag LOCUS_14120 55828 57810 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_14120 58086 58640 gene locus_tag LOCUS_14130 58086 58640 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761748.1 protein_id gnl|my_center|LOCUS_14130 58685 59695 gene locus_tag LOCUS_14140 58685 59695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 59770 62946 gene locus_tag LOCUS_14150 59770 62946 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_14150 63007 64413 gene locus_tag LOCUS_14160 63007 64413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764295.1 protein_id gnl|my_center|LOCUS_14160 64495 65337 gene locus_tag LOCUS_14170 64495 65337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 65476 66534 gene locus_tag LOCUS_14180 65476 66534 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_14180 66531 67223 gene locus_tag LOCUS_14190 66531 67223 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_14190 68207 67212 gene locus_tag LOCUS_14200 68207 67212 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705028.1 protein_id gnl|my_center|LOCUS_14200 71307 68812 gene locus_tag LOCUS_14210 71307 68812 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_14210 71743 71387 gene locus_tag LOCUS_14220 71743 71387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 72939 71842 gene locus_tag LOCUS_14230 72939 71842 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_14230 73469 73050 gene locus_tag LOCUS_14240 73469 73050 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_14240 73630 74652 gene locus_tag LOCUS_14250 gene metX 73630 74652 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_14250 74895 77747 gene locus_tag LOCUS_14260 74895 77747 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_14260 78890 77838 gene locus_tag LOCUS_14270 gene ychF 78890 77838 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_14270 79102 80334 gene locus_tag LOCUS_14280 79102 80334 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_14280 80342 81604 gene locus_tag LOCUS_14290 80342 81604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 81785 82582 gene locus_tag LOCUS_14300 81785 82582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 82765 83589 gene locus_tag LOCUS_14310 82765 83589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 83949 83653 gene locus_tag LOCUS_14320 83949 83653 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256333.1 protein_id gnl|my_center|LOCUS_14320 85476 83953 gene locus_tag LOCUS_14330 85476 83953 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107456.1 protein_id gnl|my_center|LOCUS_14330 85610 86815 gene locus_tag LOCUS_14340 85610 86815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 91971 86812 gene locus_tag LOCUS_14350 91971 86812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 92456 93784 gene locus_tag LOCUS_14360 92456 93784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 93789 94628 gene locus_tag LOCUS_14370 93789 94628 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289068.1 protein_id gnl|my_center|LOCUS_14370 95739 94972 gene locus_tag LOCUS_14380 95739 94972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 96886 95750 gene locus_tag LOCUS_14390 96886 95750 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_14390 98789 96888 gene locus_tag LOCUS_14400 gene asnB 98789 96888 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 protein_id gnl|my_center|LOCUS_14400 99702 98764 gene locus_tag LOCUS_14410 99702 98764 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_14410 100894 99683 gene locus_tag LOCUS_14420 100894 99683 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_14420 102045 100894 gene locus_tag LOCUS_14430 102045 100894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 102480 102091 gene locus_tag LOCUS_14440 102480 102091 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_14440 103012 104172 gene locus_tag LOCUS_14450 103012 104172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 104597 106801 gene locus_tag LOCUS_14460 104597 106801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 106894 107922 gene locus_tag LOCUS_14470 106894 107922 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967713.1 protein_id gnl|my_center|LOCUS_14470 108043 109482 gene locus_tag LOCUS_14480 108043 109482 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765879.1 protein_id gnl|my_center|LOCUS_14480 109479 110216 gene locus_tag LOCUS_14490 109479 110216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 110257 111057 gene locus_tag LOCUS_14500 110257 111057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 111054 111629 gene locus_tag LOCUS_14510 111054 111629 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383266.1 protein_id gnl|my_center|LOCUS_14510 111611 112816 gene locus_tag LOCUS_14520 111611 112816 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_14520 112834 113991 gene locus_tag LOCUS_14530 gene mdoC 112834 113991 CDS product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816063.1 protein_id gnl|my_center|LOCUS_14530 114330 121100 gene locus_tag LOCUS_14540 114330 121100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 121165 122862 gene locus_tag LOCUS_14550 121165 122862 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_14550 124183 122930 gene locus_tag LOCUS_14560 gene metK 124183 122930 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_14560 125560 124196 gene locus_tag LOCUS_14570 125560 124196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 126422 125676 gene locus_tag LOCUS_14580 126422 125676 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_14580 126608 127456 gene locus_tag LOCUS_14590 gene panC 126608 127456 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262612.1 protein_id gnl|my_center|LOCUS_14590 127503 127847 gene locus_tag LOCUS_14600 127503 127847 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_14600 127877 128911 gene locus_tag LOCUS_14610 127877 128911 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_14610 129108 131258 gene locus_tag LOCUS_14620 gene ppk1 129108 131258 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460183.1 protein_id gnl|my_center|LOCUS_14620 131333 132226 gene locus_tag LOCUS_14630 131333 132226 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_14630 132309 133127 gene locus_tag LOCUS_14640 gene panB 132309 133127 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_14640 133353 134246 gene locus_tag LOCUS_14650 133353 134246 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256553.1 protein_id gnl|my_center|LOCUS_14650 134662 134252 gene locus_tag LOCUS_14660 134662 134252 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_14660 135156 134659 gene locus_tag LOCUS_14670 135156 134659 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_14670 135258 136784 gene locus_tag LOCUS_14680 135258 136784 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence07 323 1342 gene locus_tag LOCUS_14690 323 1342 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224028.1 protein_id gnl|my_center|LOCUS_14690 1353 1997 gene locus_tag LOCUS_14700 1353 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2080 2892 gene locus_tag LOCUS_14710 2080 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3005 3580 gene locus_tag LOCUS_14720 3005 3580 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 protein_id gnl|my_center|LOCUS_14720 3717 4805 gene locus_tag LOCUS_14730 3717 4805 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 protein_id gnl|my_center|LOCUS_14730 5001 8384 gene locus_tag LOCUS_14740 5001 8384 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303130.1 protein_id gnl|my_center|LOCUS_14740 8395 10323 gene locus_tag LOCUS_14750 8395 10323 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767188.1 protein_id gnl|my_center|LOCUS_14750 10341 11513 gene locus_tag LOCUS_14760 10341 11513 CDS product DUF5000 domain-containing lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767187.1 protein_id gnl|my_center|LOCUS_14760 11538 12644 gene locus_tag LOCUS_14770 11538 12644 CDS product DUF4998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109119.1 protein_id gnl|my_center|LOCUS_14770 13684 13865 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gacagtaagtttaaatctcc 14926 14126 gene locus_tag LOCUS_14780 14926 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 15720 14938 gene locus_tag LOCUS_14790 15720 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 19178 15747 gene locus_tag LOCUS_14800 19178 15747 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680902.1 protein_id gnl|my_center|LOCUS_14800 20277 19342 gene locus_tag LOCUS_14810 20277 19342 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_14810 20919 20347 gene locus_tag LOCUS_14820 20919 20347 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 protein_id gnl|my_center|LOCUS_14820 21123 22007 gene locus_tag LOCUS_14830 21123 22007 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798133.1 protein_id gnl|my_center|LOCUS_14830 22598 23779 gene locus_tag LOCUS_14840 gene moeA 22598 23779 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_14840 23871 24407 gene locus_tag LOCUS_14850 23871 24407 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861311.1 protein_id gnl|my_center|LOCUS_14850 24419 25327 gene locus_tag LOCUS_14860 gene moaCB 24419 25327 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_14860 28695 25357 gene locus_tag LOCUS_14870 28695 25357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 30419 29913 gene locus_tag LOCUS_14880 30419 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 31273 30545 gene locus_tag LOCUS_14890 31273 30545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 31369 31773 gene locus_tag LOCUS_14900 31369 31773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 31809 32372 gene locus_tag LOCUS_14910 31809 32372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 32395 32649 gene locus_tag LOCUS_14920 32395 32649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 32728 33435 gene locus_tag LOCUS_14930 32728 33435 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_14930 33901 33464 gene locus_tag LOCUS_14940 33901 33464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 34863 34267 gene locus_tag LOCUS_14950 34863 34267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 37388 36327 gene locus_tag LOCUS_14960 gene rsgA 37388 36327 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107648.1 protein_id gnl|my_center|LOCUS_14960 37726 37640 gene locus_tag LOCUS_t00140 37726 37640 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38744 37800 gene locus_tag LOCUS_14970 38744 37800 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_14970 40547 38865 gene locus_tag LOCUS_14980 40547 38865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 41668 40673 gene locus_tag LOCUS_14990 41668 40673 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_14990 41760 42110 gene locus_tag LOCUS_15000 41760 42110 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974830.1 protein_id gnl|my_center|LOCUS_15000 42893 42105 gene locus_tag LOCUS_15010 42893 42105 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_15010 43315 46389 gene locus_tag LOCUS_15020 43315 46389 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_15020 46408 47949 gene locus_tag LOCUS_15030 46408 47949 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_15030 48189 50225 gene locus_tag LOCUS_15040 48189 50225 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_15040 50239 51540 gene locus_tag LOCUS_15050 gene gntT 50239 51540 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209513.1 protein_id gnl|my_center|LOCUS_15050 51555 52025 gene locus_tag LOCUS_15060 51555 52025 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_15060 52018 53097 gene locus_tag LOCUS_15070 52018 53097 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_15070 56247 53104 gene locus_tag LOCUS_15080 56247 53104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 58094 56247 gene locus_tag LOCUS_15090 58094 56247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 58292 61189 gene locus_tag LOCUS_15100 58292 61189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 61201 63804 gene locus_tag LOCUS_15110 61201 63804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 64033 67632 gene locus_tag LOCUS_15120 64033 67632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 67697 68914 gene locus_tag LOCUS_15130 67697 68914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 68911 69969 gene locus_tag LOCUS_15140 68911 69969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 70285 69962 gene locus_tag LOCUS_15150 70285 69962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 71157 70288 gene locus_tag LOCUS_15160 71157 70288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 72229 71261 gene locus_tag LOCUS_15170 72229 71261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 72689 72330 gene locus_tag LOCUS_15180 72689 72330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 74136 72829 gene locus_tag LOCUS_15190 74136 72829 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070569087.1 protein_id gnl|my_center|LOCUS_15190 74278 75090 gene locus_tag LOCUS_15200 74278 75090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 76037 75312 gene locus_tag LOCUS_15210 76037 75312 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_15210 77112 76006 gene locus_tag LOCUS_15220 77112 76006 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403516.1 protein_id gnl|my_center|LOCUS_15220 77341 77700 gene locus_tag LOCUS_15230 77341 77700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 78515 77709 gene locus_tag LOCUS_15240 78515 77709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 78593 79264 gene locus_tag LOCUS_15250 gene rpiA 78593 79264 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920162.1 protein_id gnl|my_center|LOCUS_15250 79292 80194 gene locus_tag LOCUS_15260 gene alkA 79292 80194 CDS product DNA-3-methyladenine glycosidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123533.1 protein_id gnl|my_center|LOCUS_15260 80917 80204 gene locus_tag LOCUS_15270 80917 80204 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_15270 81784 80945 gene locus_tag LOCUS_15280 81784 80945 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_15280 82455 81856 gene locus_tag LOCUS_15290 82455 81856 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_15290 82697 82431 gene locus_tag LOCUS_15300 82697 82431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 86167 83006 gene locus_tag LOCUS_15310 86167 83006 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_15310 86706 87557 gene locus_tag LOCUS_15320 86706 87557 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528856.1 protein_id gnl|my_center|LOCUS_15320 87600 88997 gene locus_tag LOCUS_15330 87600 88997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 89884 89000 gene locus_tag LOCUS_15340 89884 89000 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056838.1 protein_id gnl|my_center|LOCUS_15340 90243 91001 gene locus_tag LOCUS_15350 90243 91001 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_15350 91148 91618 gene locus_tag LOCUS_15360 91148 91618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 92466 91633 gene locus_tag LOCUS_15370 92466 91633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256777.1 protein_id gnl|my_center|LOCUS_15370 96268 92501 gene locus_tag LOCUS_15380 96268 92501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 96859 97362 gene locus_tag LOCUS_15390 96859 97362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence08 99 314 gene locus_tag LOCUS_15400 99 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1043 1831 gene locus_tag LOCUS_15410 1043 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1846 2040 gene locus_tag LOCUS_15420 1846 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2249 2995 gene locus_tag LOCUS_15430 2249 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3312 3743 gene locus_tag LOCUS_15440 3312 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3753 6650 gene locus_tag LOCUS_15450 3753 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 7004 7477 gene locus_tag LOCUS_15460 7004 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 7693 7977 gene locus_tag LOCUS_15470 7693 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 8109 8291 gene locus_tag LOCUS_15480 8109 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 8393 8776 gene locus_tag LOCUS_15490 8393 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 8889 9353 gene locus_tag LOCUS_15500 8889 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 10142 9354 gene locus_tag LOCUS_15510 10142 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 10710 11189 gene locus_tag LOCUS_15520 10710 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 11828 12706 gene locus_tag LOCUS_15530 11828 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 13700 12795 gene locus_tag LOCUS_15540 13700 12795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 16352 14034 gene locus_tag LOCUS_15550 16352 14034 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_15550 21379 16352 gene locus_tag LOCUS_15560 21379 16352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 21622 22467 gene locus_tag LOCUS_15570 21622 22467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 22834 23019 gene locus_tag LOCUS_15580 22834 23019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 23620 23285 gene locus_tag LOCUS_15590 23620 23285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 25393 23810 gene locus_tag LOCUS_15600 25393 23810 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932499.1 protein_id gnl|my_center|LOCUS_15600 25485 26738 gene locus_tag LOCUS_15610 25485 26738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_15610 26788 27516 gene locus_tag LOCUS_15620 26788 27516 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_15620 27571 28578 gene locus_tag LOCUS_15630 gene tsaD 27571 28578 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_15630 28587 29300 gene locus_tag LOCUS_15640 28587 29300 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692148.1 protein_id gnl|my_center|LOCUS_15640 29488 31500 gene locus_tag LOCUS_15650 29488 31500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 32510 31851 gene locus_tag LOCUS_15660 32510 31851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 32841 32757 gene locus_tag LOCUS_t00150 32841 32757 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33188 32856 gene locus_tag LOCUS_15670 33188 32856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 33268 34476 gene locus_tag LOCUS_15680 33268 34476 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_15680 34908 34486 gene locus_tag LOCUS_15690 34908 34486 CDS product DUF6194 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434115.1 protein_id gnl|my_center|LOCUS_15690 35064 35360 gene locus_tag LOCUS_15700 35064 35360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 35451 36185 gene locus_tag LOCUS_15710 35451 36185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 36547 36308 gene locus_tag LOCUS_15720 36547 36308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 36711 36938 gene locus_tag LOCUS_15730 36711 36938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 38190 37000 gene locus_tag LOCUS_15740 38190 37000 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_15740 39236 38199 gene locus_tag LOCUS_15750 39236 38199 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213126768.1 protein_id gnl|my_center|LOCUS_15750 40276 39260 gene locus_tag LOCUS_15760 40276 39260 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_15760 41554 40301 gene locus_tag LOCUS_15770 41554 40301 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815865.1 protein_id gnl|my_center|LOCUS_15770 41966 42994 gene locus_tag LOCUS_15780 41966 42994 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_15780 43028 44368 gene locus_tag LOCUS_15790 43028 44368 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_15790 44386 45765 gene locus_tag LOCUS_15800 44386 45765 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 protein_id gnl|my_center|LOCUS_15800 45737 46963 gene locus_tag LOCUS_15810 gene nagA 45737 46963 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_15810 46960 47781 gene locus_tag LOCUS_15820 46960 47781 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_15820 48849 47788 gene locus_tag LOCUS_15830 48849 47788 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107293.1 protein_id gnl|my_center|LOCUS_15830 48945 49928 gene locus_tag LOCUS_15840 48945 49928 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784057.1 protein_id gnl|my_center|LOCUS_15840 50694 50020 gene locus_tag LOCUS_15850 50694 50020 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_15850 51558 50764 gene locus_tag LOCUS_15860 51558 50764 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_15860 52727 51576 gene locus_tag LOCUS_15870 52727 51576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 53709 52714 gene locus_tag LOCUS_15880 53709 52714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 54590 53736 gene locus_tag LOCUS_15890 54590 53736 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_15890 54702 55808 gene locus_tag LOCUS_15900 54702 55808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 56005 56985 gene locus_tag LOCUS_15910 56005 56985 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246419.1 protein_id gnl|my_center|LOCUS_15910 58176 56986 gene locus_tag LOCUS_15920 58176 56986 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265890.1 protein_id gnl|my_center|LOCUS_15920 58793 58329 gene locus_tag LOCUS_15930 58793 58329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 58900 59319 gene locus_tag LOCUS_15940 58900 59319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 59406 59618 gene locus_tag LOCUS_15950 59406 59618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 59714 61351 gene locus_tag LOCUS_15960 59714 61351 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_15960 62088 62561 gene locus_tag LOCUS_15970 gene rnhA 62088 62561 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_15970 62649 63794 gene locus_tag LOCUS_15980 gene ehxD 62649 63794 CDS product enterohemolysin T1SS ABC transporter subunit EhxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213545.1 protein_id gnl|my_center|LOCUS_15980 63842 66019 gene locus_tag LOCUS_15990 63842 66019 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_15990 67094 66651 gene locus_tag LOCUS_16000 67094 66651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 68289 67144 gene locus_tag LOCUS_16010 68289 67144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 68831 68391 gene locus_tag LOCUS_16020 gene smpB 68831 68391 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760495.1 protein_id gnl|my_center|LOCUS_16020 69733 68888 gene locus_tag LOCUS_16030 gene accD 69733 68888 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_16030 70929 69862 gene locus_tag LOCUS_16040 gene fbaA 70929 69862 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_16040 71593 71108 gene locus_tag LOCUS_16050 71593 71108 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731351.1 protein_id gnl|my_center|LOCUS_16050 72406 71630 gene locus_tag LOCUS_16060 72406 71630 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_16060 73767 72409 gene locus_tag LOCUS_16070 73767 72409 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_16070 73831 74472 gene locus_tag LOCUS_16080 gene bioD 73831 74472 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973493.1 protein_id gnl|my_center|LOCUS_16080 74469 75062 gene locus_tag LOCUS_16090 74469 75062 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_16090 75055 76155 gene locus_tag LOCUS_16100 gene lpxK 75055 76155 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_16100 76180 78261 gene locus_tag LOCUS_16110 gene rnr 76180 78261 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_16110 78263 79234 gene locus_tag LOCUS_16120 78263 79234 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_16120 79319 80971 gene locus_tag LOCUS_16130 79319 80971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 81067 81516 gene locus_tag LOCUS_16140 81067 81516 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376389.1 protein_id gnl|my_center|LOCUS_16140 81553 82572 gene locus_tag LOCUS_16150 81553 82572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 84749 83043 gene locus_tag LOCUS_16160 84749 83043 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_16160 85083 85607 gene locus_tag LOCUS_16170 85083 85607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence09 322 783 gene locus_tag LOCUS_16180 322 783 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_16180 871 1926 gene locus_tag LOCUS_16190 871 1926 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 protein_id gnl|my_center|LOCUS_16190 3140 2061 gene locus_tag LOCUS_16200 3140 2061 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083132.1 protein_id gnl|my_center|LOCUS_16200 6276 3142 gene locus_tag LOCUS_16210 6276 3142 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_16210 7657 6281 gene locus_tag LOCUS_16220 7657 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 8579 7764 gene locus_tag LOCUS_16230 8579 7764 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_16230 10230 8698 gene locus_tag LOCUS_16240 10230 8698 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203463.1 protein_id gnl|my_center|LOCUS_16240 10876 10433 gene locus_tag LOCUS_16250 10876 10433 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143451.1 protein_id gnl|my_center|LOCUS_16250 11369 10908 gene locus_tag LOCUS_16260 11369 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 12067 11396 gene locus_tag LOCUS_16270 12067 11396 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_16270 12272 12634 gene locus_tag LOCUS_16280 12272 12634 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061015.1 protein_id gnl|my_center|LOCUS_16280 13508 12627 gene locus_tag LOCUS_16290 13508 12627 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731219.1 protein_id gnl|my_center|LOCUS_16290 16040 13629 gene locus_tag LOCUS_16300 16040 13629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_16300 18533 16269 gene locus_tag LOCUS_16310 18533 16269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 18915 19742 gene locus_tag LOCUS_16320 18915 19742 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_16320 19881 19954 gene locus_tag LOCUS_t00160 19881 19954 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20808 23939 gene locus_tag LOCUS_16330 20808 23939 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108905.1 protein_id gnl|my_center|LOCUS_16330 23970 25715 gene locus_tag LOCUS_16340 23970 25715 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765815.1 protein_id gnl|my_center|LOCUS_16340 29591 25872 gene locus_tag LOCUS_16350 29591 25872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 30850 29588 gene locus_tag LOCUS_16360 30850 29588 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_16360 31704 31306 gene locus_tag LOCUS_16370 31704 31306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 31779 32513 gene locus_tag LOCUS_16380 31779 32513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 33290 32520 gene locus_tag LOCUS_16390 gene xth 33290 32520 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969370.1 protein_id gnl|my_center|LOCUS_16390 34448 33312 gene locus_tag LOCUS_16400 34448 33312 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767372.1 protein_id gnl|my_center|LOCUS_16400 35086 36180 gene locus_tag LOCUS_16410 35086 36180 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_16410 37547 36249 gene locus_tag LOCUS_16420 37547 36249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 39146 37701 gene locus_tag LOCUS_16430 39146 37701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 39920 39174 gene locus_tag LOCUS_16440 39920 39174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 41384 39966 gene locus_tag LOCUS_16450 41384 39966 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108730.1 protein_id gnl|my_center|LOCUS_16450 44831 41397 gene locus_tag LOCUS_16460 44831 41397 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303104.1 protein_id gnl|my_center|LOCUS_16460 46297 45068 gene locus_tag LOCUS_16470 46297 45068 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_16470 46931 46377 gene locus_tag LOCUS_16480 46931 46377 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 protein_id gnl|my_center|LOCUS_16480 47079 48209 gene locus_tag LOCUS_16490 47079 48209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 48341 49015 gene locus_tag LOCUS_16500 48341 49015 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110886.1 protein_id gnl|my_center|LOCUS_16500 49861 49019 gene locus_tag LOCUS_16510 49861 49019 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 protein_id gnl|my_center|LOCUS_16510 49949 50959 gene locus_tag LOCUS_16520 49949 50959 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_16520 51507 51127 gene locus_tag LOCUS_16530 51507 51127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 51672 52508 gene locus_tag LOCUS_16540 51672 52508 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976361.1 protein_id gnl|my_center|LOCUS_16540 54382 52505 gene locus_tag LOCUS_16550 54382 52505 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_16550 56607 54445 gene locus_tag LOCUS_16560 56607 54445 CDS product chitobiase/beta-hexosaminidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222583402.1 protein_id gnl|my_center|LOCUS_16560 57632 56607 gene locus_tag LOCUS_16570 57632 56607 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_16570 59097 57643 gene locus_tag LOCUS_16580 59097 57643 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_16580 61442 59127 gene locus_tag LOCUS_16590 61442 59127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 61684 62544 gene locus_tag LOCUS_16600 61684 62544 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_16600 62686 63240 gene locus_tag LOCUS_16610 62686 63240 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_16610 63315 64394 gene locus_tag LOCUS_16620 63315 64394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 64502 67939 gene locus_tag LOCUS_16630 64502 67939 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107268.1 protein_id gnl|my_center|LOCUS_16630 67949 69898 gene locus_tag LOCUS_16640 67949 69898 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010535408.1 protein_id gnl|my_center|LOCUS_16640 69892 71082 gene locus_tag LOCUS_16650 69892 71082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 71101 73779 gene locus_tag LOCUS_16660 71101 73779 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_16660 73779 74345 gene locus_tag LOCUS_16670 73779 74345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence10 1028 270 gene locus_tag LOCUS_16680 1028 270 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_16680 2770 1058 gene locus_tag LOCUS_16690 2770 1058 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528172.1 protein_id gnl|my_center|LOCUS_16690 3911 2892 gene locus_tag LOCUS_16700 3911 2892 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 protein_id gnl|my_center|LOCUS_16700 5491 3923 gene locus_tag LOCUS_16710 5491 3923 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_16710 8720 5478 gene locus_tag LOCUS_16720 8720 5478 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714627.1 protein_id gnl|my_center|LOCUS_16720 9874 8909 gene locus_tag LOCUS_16730 9874 8909 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_16730 10474 9929 gene locus_tag LOCUS_16740 10474 9929 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_16740 11378 10617 gene locus_tag LOCUS_16750 11378 10617 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931028.1 protein_id gnl|my_center|LOCUS_16750 11469 11837 gene locus_tag LOCUS_16760 11469 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 12223 11855 gene locus_tag LOCUS_16770 12223 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 13401 12238 gene locus_tag LOCUS_16780 13401 12238 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205325.1 protein_id gnl|my_center|LOCUS_16780 14308 13466 gene locus_tag LOCUS_16790 14308 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 14814 14362 gene locus_tag LOCUS_16800 14814 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 14996 16780 gene locus_tag LOCUS_16810 14996 16780 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108456.1 protein_id gnl|my_center|LOCUS_16810 17054 17617 gene locus_tag LOCUS_16820 17054 17617 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_16820 17714 18856 gene locus_tag LOCUS_16830 17714 18856 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_16830 19119 22544 gene locus_tag LOCUS_16840 19119 22544 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202212.1 protein_id gnl|my_center|LOCUS_16840 22571 24034 gene locus_tag LOCUS_16850 22571 24034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 24061 25140 gene locus_tag LOCUS_16860 24061 25140 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_16860 25182 26372 gene locus_tag LOCUS_16870 25182 26372 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089761628.1 protein_id gnl|my_center|LOCUS_16870 26892 26434 gene locus_tag LOCUS_16880 26892 26434 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266276.1 protein_id gnl|my_center|LOCUS_16880 27929 27471 gene locus_tag LOCUS_16890 27929 27471 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_16890 28080 29333 gene locus_tag LOCUS_16900 28080 29333 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_16900 29681 30280 gene locus_tag LOCUS_16910 29681 30280 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_16910 30361 31500 gene locus_tag LOCUS_16920 30361 31500 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_16920 31615 34998 gene locus_tag LOCUS_16930 31615 34998 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_16930 35010 36518 gene locus_tag LOCUS_16940 35010 36518 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_16940 36518 37375 gene locus_tag LOCUS_16950 36518 37375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 37381 39432 gene locus_tag LOCUS_16960 37381 39432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 40516 39518 gene locus_tag LOCUS_16970 gene ldhA 40516 39518 CDS product lactate dehydrogenase LdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071244.1 protein_id gnl|my_center|LOCUS_16970 40608 41579 gene locus_tag LOCUS_16980 40608 41579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 41756 44374 gene locus_tag LOCUS_16990 41756 44374 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766590.1 protein_id gnl|my_center|LOCUS_16990 44395 45777 gene locus_tag LOCUS_17000 44395 45777 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_17000 45800 49096 gene locus_tag LOCUS_17010 45800 49096 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence11 299 135 gene locus_tag LOCUS_17020 299 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1635 358 gene locus_tag LOCUS_17030 1635 358 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_17030 3690 1783 gene locus_tag LOCUS_17040 3690 1783 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_17040 4943 3759 gene locus_tag LOCUS_17050 4943 3759 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_17050 6788 4992 gene locus_tag LOCUS_17060 6788 4992 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510954.1 protein_id gnl|my_center|LOCUS_17060 8485 6860 gene locus_tag LOCUS_17070 8485 6860 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_17070 11552 8535 gene locus_tag LOCUS_17080 11552 8535 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_17080 12841 11966 gene locus_tag LOCUS_17090 12841 11966 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_17090 15373 12965 gene locus_tag LOCUS_17100 15373 12965 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_17100 16609 15842 gene locus_tag LOCUS_17110 16609 15842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 17450 16809 gene locus_tag LOCUS_17120 gene rqpR 17450 16809 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_17120 17974 20970 gene locus_tag LOCUS_17130 17974 20970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 21505 20933 gene locus_tag LOCUS_17140 21505 20933 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence12 1233 310 gene locus_tag LOCUS_17150 1233 310 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_17150 2692 1286 gene locus_tag LOCUS_17160 2692 1286 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_17160 3016 3507 gene locus_tag LOCUS_17170 3016 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 5706 3691 gene locus_tag LOCUS_17180 5706 3691 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_17180 6738 5728 gene locus_tag LOCUS_17190 6738 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 22561 6833 gene locus_tag LOCUS_17200 22561 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 23283 25868 gene locus_tag LOCUS_17210 23283 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 25915 26823 gene locus_tag LOCUS_17220 25915 26823 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963182.1 protein_id gnl|my_center|LOCUS_17220 26854 27327 gene locus_tag LOCUS_17230 26854 27327 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_17230 29225 27729 gene locus_tag LOCUS_17240 29225 27729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 29434 30189 gene locus_tag LOCUS_17250 29434 30189 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_17250 30466 33174 gene locus_tag LOCUS_17260 30466 33174 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_17260 34597 33257 gene locus_tag LOCUS_17270 34597 33257 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_17270 35579 34599 gene locus_tag LOCUS_17280 35579 34599 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_17280 36829 35579 gene locus_tag LOCUS_17290 36829 35579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 37746 36826 gene locus_tag LOCUS_17300 37746 36826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 38729 37743 gene locus_tag LOCUS_17310 38729 37743 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_17310 38781 39575 gene locus_tag LOCUS_17320 38781 39575 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_17320 40199 41764 gene locus_tag LOCUS_17330 40199 41764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 41846 42085 gene locus_tag LOCUS_17340 41846 42085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 43273 42173 gene locus_tag LOCUS_17350 gene nagA 43273 42173 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478503.1 protein_id gnl|my_center|LOCUS_17350 45013 43295 gene locus_tag LOCUS_17360 45013 43295 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201999.1 protein_id gnl|my_center|LOCUS_17360 48484 45035 gene locus_tag LOCUS_17370 48484 45035 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202000.1 protein_id gnl|my_center|LOCUS_17370 49870 48866 gene locus_tag LOCUS_17380 49870 48866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 50119 50604 gene locus_tag LOCUS_17390 50119 50604 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_17390 52324 50567 gene locus_tag LOCUS_17400 52324 50567 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_17400 53059 52472 gene locus_tag LOCUS_17410 53059 52472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 53756 53349 gene locus_tag LOCUS_17420 53756 53349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 53909 54340 gene locus_tag LOCUS_17430 53909 54340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 55808 54399 gene locus_tag LOCUS_17440 55808 54399 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918535.1 protein_id gnl|my_center|LOCUS_17440 56998 55868 gene locus_tag LOCUS_17450 56998 55868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 57471 57542 gene locus_tag LOCUS_t00170 57471 57542 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 57569 57636 gene locus_tag LOCUS_t00180 57569 57636 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57781 57852 gene locus_tag LOCUS_t00190 57781 57852 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 60757 58313 gene locus_tag LOCUS_17460 60757 58313 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_17460 62392 60839 gene locus_tag LOCUS_17470 62392 60839 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_17470 65368 62417 gene locus_tag LOCUS_17480 65368 62417 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108938.1 protein_id gnl|my_center|LOCUS_17480 67184 65592 gene locus_tag LOCUS_17490 67184 65592 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_17490 67303 67377 gene locus_tag LOCUS_t00200 67303 67377 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 67898 68998 gene locus_tag LOCUS_17500 67898 68998 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_17500 69102 69698 gene locus_tag LOCUS_17510 69102 69698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 69831 70835 gene locus_tag LOCUS_17520 69831 70835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 70850 71572 gene locus_tag LOCUS_17530 70850 71572 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_17530 72571 71663 gene locus_tag LOCUS_17540 72571 71663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 73584 72748 gene locus_tag LOCUS_17550 73584 72748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 74772 73615 gene locus_tag LOCUS_17560 74772 73615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 75619 74906 gene locus_tag LOCUS_17570 75619 74906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 76679 75672 gene locus_tag LOCUS_17580 76679 75672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 77410 76679 gene locus_tag LOCUS_17590 77410 76679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 78177 77407 gene locus_tag LOCUS_17600 78177 77407 CDS product HmuY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963611.1 protein_id gnl|my_center|LOCUS_17600 78878 78186 gene locus_tag LOCUS_17610 78878 78186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 79053 79382 gene locus_tag LOCUS_17620 79053 79382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 79383 79505 gene locus_tag LOCUS_17630 79383 79505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 80559 79582 gene locus_tag LOCUS_17640 80559 79582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 80788 82932 gene locus_tag LOCUS_17650 80788 82932 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_17650 83790 82933 gene locus_tag LOCUS_17660 83790 82933 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_17660 85161 83818 gene locus_tag LOCUS_17670 85161 83818 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_17670 85607 85242 gene locus_tag LOCUS_17680 gene nirD 85607 85242 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084762.1 protein_id gnl|my_center|LOCUS_17680 88102 85637 gene locus_tag LOCUS_17690 gene nirB 88102 85637 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_17690 88354 89115 gene locus_tag LOCUS_17700 88354 89115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 89112 89810 gene locus_tag LOCUS_17710 gene anr 89112 89810 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_17710 90727 90092 gene locus_tag LOCUS_17720 90727 90092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 91555 90854 gene locus_tag LOCUS_17730 91555 90854 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_17730 92930 91545 gene locus_tag LOCUS_17740 92930 91545 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766006.1 protein_id gnl|my_center|LOCUS_17740 94168 92933 gene locus_tag LOCUS_17750 gene wcaI 94168 92933 CDS product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699650.1 protein_id gnl|my_center|LOCUS_17750 94753 94178 gene locus_tag LOCUS_17760 94753 94178 CDS product putative colanic acid biosynthesis acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_17760 95636 94731 gene locus_tag LOCUS_17770 95636 94731 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938171.1 protein_id gnl|my_center|LOCUS_17770 96796 95633 gene locus_tag LOCUS_17780 96796 95633 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296321.1 protein_id gnl|my_center|LOCUS_17780 97590 96805 gene locus_tag LOCUS_17790 97590 96805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 98213 97590 gene locus_tag LOCUS_17800 98213 97590 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022159.1 protein_id gnl|my_center|LOCUS_17800 99117 98191 gene locus_tag LOCUS_17810 99117 98191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 100350 99121 gene locus_tag LOCUS_17820 100350 99121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 101479 100340 gene locus_tag LOCUS_17830 101479 100340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 103035 101479 gene locus_tag LOCUS_17840 103035 101479 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_17840 104146 103049 gene locus_tag LOCUS_17850 gene gmd 104146 103049 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706703.1 protein_id gnl|my_center|LOCUS_17850 105477 104143 gene locus_tag LOCUS_17860 105477 104143 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_17860 106442 105489 gene locus_tag LOCUS_17870 106442 105489 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410273.1 protein_id gnl|my_center|LOCUS_17870 107495 106455 gene locus_tag LOCUS_17880 107495 106455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 108009 107488 gene locus_tag LOCUS_17890 108009 107488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 110504 108159 gene locus_tag LOCUS_17900 110504 108159 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107358.1 protein_id gnl|my_center|LOCUS_17900 111407 110580 gene locus_tag LOCUS_17910 111407 110580 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_17910 112166 111534 gene locus_tag LOCUS_17920 112166 111534 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964183.1 protein_id gnl|my_center|LOCUS_17920 112534 113610 gene locus_tag LOCUS_17930 112534 113610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 113646 114020 gene locus_tag LOCUS_17940 113646 114020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 115462 114017 gene locus_tag LOCUS_17950 115462 114017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 116371 115580 gene locus_tag LOCUS_17960 116371 115580 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_17960 116527 118566 gene locus_tag LOCUS_17970 116527 118566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 118986 118642 gene locus_tag LOCUS_17980 118986 118642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 120176 118986 gene locus_tag LOCUS_17990 gene hflX 120176 118986 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_17990 120278 122287 gene locus_tag LOCUS_18000 120278 122287 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964457.1 protein_id gnl|my_center|LOCUS_18000 122354 123139 gene locus_tag LOCUS_18010 gene paaG 122354 123139 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705609.1 protein_id gnl|my_center|LOCUS_18010 124236 123547 gene locus_tag LOCUS_18020 124236 123547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 124487 127450 gene locus_tag LOCUS_18030 124487 127450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 129138 127447 gene locus_tag LOCUS_18040 129138 127447 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_18040 130175 129135 gene locus_tag LOCUS_18050 130175 129135 CDS product two-component system sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963798.1 protein_id gnl|my_center|LOCUS_18050 131468 130281 gene locus_tag LOCUS_18060 131468 130281 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_18060 132042 131479 gene locus_tag LOCUS_18070 132042 131479 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963800.1 protein_id gnl|my_center|LOCUS_18070 134115 132055 gene locus_tag LOCUS_18080 gene kdpB 134115 132055 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763738.1 protein_id gnl|my_center|LOCUS_18080 135840 134125 gene locus_tag LOCUS_18090 gene kdpA 135840 134125 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963802.1 protein_id gnl|my_center|LOCUS_18090 136362 136027 gene locus_tag LOCUS_18100 136362 136027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 137862 136525 gene locus_tag LOCUS_18110 137862 136525 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_18110 138509 137943 gene locus_tag LOCUS_18120 138509 137943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 141184 138566 gene locus_tag LOCUS_18130 gene ligD 141184 138566 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395526.1 protein_id gnl|my_center|LOCUS_18130 141954 141181 gene locus_tag LOCUS_18140 141954 141181 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958550.1 protein_id gnl|my_center|LOCUS_18140 142181 142549 gene locus_tag LOCUS_18150 142181 142549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 143620 142583 gene locus_tag LOCUS_18160 143620 142583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 144398 143595 gene locus_tag LOCUS_18170 144398 143595 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_18170 145161 144529 gene locus_tag LOCUS_18180 145161 144529 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313899.1 protein_id gnl|my_center|LOCUS_18180 145587 145180 gene locus_tag LOCUS_18190 145587 145180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 145872 147284 gene locus_tag LOCUS_18200 145872 147284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 147324 148772 gene locus_tag LOCUS_18210 147324 148772 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929287.1 protein_id gnl|my_center|LOCUS_18210 149636 148779 gene locus_tag LOCUS_18220 149636 148779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 149930 149778 gene locus_tag LOCUS_18230 149930 149778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 150168 150629 gene locus_tag LOCUS_18240 150168 150629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 151107 150922 gene locus_tag LOCUS_18250 151107 150922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 151351 151773 gene locus_tag LOCUS_18260 151351 151773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 151807 153276 gene locus_tag LOCUS_18270 151807 153276 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_18270 153287 153742 gene locus_tag LOCUS_18280 153287 153742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 154232 153744 gene locus_tag LOCUS_18290 154232 153744 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_18290 155502 154336 gene locus_tag LOCUS_18300 155502 154336 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 protein_id gnl|my_center|LOCUS_18300 156888 155548 gene locus_tag LOCUS_18310 156888 155548 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791486.1 protein_id gnl|my_center|LOCUS_18310 157989 156928 gene locus_tag LOCUS_18320 gene ansB 157989 156928 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262105.1 protein_id gnl|my_center|LOCUS_18320 159436 158003 gene locus_tag LOCUS_18330 159436 158003 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084144.1 protein_id gnl|my_center|LOCUS_18330 159546 160859 gene locus_tag LOCUS_18340 159546 160859 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_18340 160856 161491 gene locus_tag LOCUS_18350 160856 161491 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 protein_id gnl|my_center|LOCUS_18350 161973 161488 gene locus_tag LOCUS_18360 161973 161488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 162711 163604 gene locus_tag LOCUS_18370 162711 163604 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704703.1 protein_id gnl|my_center|LOCUS_18370 163610 163996 gene locus_tag LOCUS_18380 163610 163996 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_18380 165402 163993 gene locus_tag LOCUS_18390 165402 163993 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_18390 166229 165726 gene locus_tag LOCUS_18400 166229 165726 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_18400 168264 166417 gene locus_tag LOCUS_18410 168264 166417 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_18410 169811 168450 gene locus_tag LOCUS_18420 169811 168450 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_18420 173445 169963 gene locus_tag LOCUS_18430 173445 169963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 174760 173513 gene locus_tag LOCUS_18440 gene nusA 174760 173513 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_18440 175238 174774 gene locus_tag LOCUS_18450 175238 174774 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_18450 175424 175708 gene locus_tag LOCUS_18460 175424 175708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 175701 176066 gene locus_tag LOCUS_18470 175701 176066 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403069.1 protein_id gnl|my_center|LOCUS_18470 176117 176392 gene locus_tag LOCUS_18480 176117 176392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 177019 176396 gene locus_tag LOCUS_18490 177019 176396 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_18490 177149 177224 gene locus_tag LOCUS_t00210 177149 177224 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 177466 178524 gene locus_tag LOCUS_18500 177466 178524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 178837 178652 gene locus_tag LOCUS_18510 178837 178652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 179185 179628 gene locus_tag LOCUS_18520 179185 179628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 180072 179662 gene locus_tag LOCUS_18530 180072 179662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 181579 180173 gene locus_tag LOCUS_18540 gene lpdA 181579 180173 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_18540 183548 181770 gene locus_tag LOCUS_18550 183548 181770 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_18550 186980 183567 gene locus_tag LOCUS_18560 186980 183567 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801316.1 protein_id gnl|my_center|LOCUS_18560 188443 187343 gene locus_tag LOCUS_18570 188443 187343 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_18570 189126 188524 gene locus_tag LOCUS_18580 189126 188524 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_18580 190762 189302 gene locus_tag LOCUS_18590 190762 189302 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_18590 192559 190778 gene locus_tag LOCUS_18600 192559 190778 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789279.1 protein_id gnl|my_center|LOCUS_18600 195951 192577 gene locus_tag LOCUS_18610 195951 192577 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303190.1 protein_id gnl|my_center|LOCUS_18610 196063 195884 gene locus_tag LOCUS_18620 196063 195884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 197317 196199 gene locus_tag LOCUS_18630 197317 196199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 197952 197383 gene locus_tag LOCUS_18640 197952 197383 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764449.1 protein_id gnl|my_center|LOCUS_18640 200318 198063 gene locus_tag LOCUS_18650 200318 198063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 202138 200378 gene locus_tag LOCUS_18660 202138 200378 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764315.1 protein_id gnl|my_center|LOCUS_18660 205198 202145 gene locus_tag LOCUS_18670 205198 202145 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760974.1 protein_id gnl|my_center|LOCUS_18670 206836 205220 gene locus_tag LOCUS_18680 206836 205220 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_18680 209638 206885 gene locus_tag LOCUS_18690 209638 206885 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764316.1 protein_id gnl|my_center|LOCUS_18690 210045 210872 gene locus_tag LOCUS_18700 gene purU 210045 210872 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705222.1 protein_id gnl|my_center|LOCUS_18700 212048 211350 gene locus_tag LOCUS_18710 212048 211350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 212141 213169 gene locus_tag LOCUS_18720 gene pheS 212141 213169 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_18720 213245 214102 gene locus_tag LOCUS_18730 213245 214102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 214099 215127 gene locus_tag LOCUS_18740 214099 215127 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_18740 215835 215137 gene locus_tag LOCUS_18750 215835 215137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 216788 215847 gene locus_tag LOCUS_18760 216788 215847 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_18760 217834 217181 gene locus_tag LOCUS_18770 217834 217181 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_18770 217958 218545 gene locus_tag LOCUS_18780 217958 218545 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_18780 218610 219485 gene locus_tag LOCUS_18790 218610 219485 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_18790 219494 219991 gene locus_tag LOCUS_18800 219494 219991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 219995 221011 gene locus_tag LOCUS_18810 219995 221011 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_18810 221115 221798 gene locus_tag LOCUS_18820 221115 221798 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_18820 221922 222788 gene locus_tag LOCUS_18830 221922 222788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 222838 223581 gene locus_tag LOCUS_18840 222838 223581 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_18840 224340 223576 gene locus_tag LOCUS_18850 224340 223576 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_18850 226247 224361 gene locus_tag LOCUS_18860 226247 224361 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_18860 227108 226401 gene locus_tag LOCUS_18870 227108 226401 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_18870 227200 227898 gene locus_tag LOCUS_18880 227200 227898 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_18880 228207 227959 gene locus_tag LOCUS_18890 228207 227959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 228921 228265 gene locus_tag LOCUS_18900 228921 228265 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_18900 229852 228986 gene locus_tag LOCUS_18910 229852 228986 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_18910 230120 229890 gene locus_tag LOCUS_18920 230120 229890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 231048 230125 gene locus_tag LOCUS_18930 231048 230125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 231129 232199 gene locus_tag LOCUS_18940 gene dusB 231129 232199 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_18940 232233 232802 gene locus_tag LOCUS_18950 232233 232802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 232940 233740 gene locus_tag LOCUS_18960 gene proC 232940 233740 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_18960 237057 233863 gene locus_tag LOCUS_18970 237057 233863 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_18970 238161 237088 gene locus_tag LOCUS_18980 238161 237088 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_18980 239498 238161 gene locus_tag LOCUS_18990 239498 238161 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761968.1 protein_id gnl|my_center|LOCUS_18990 240153 239545 gene locus_tag LOCUS_19000 240153 239545 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_19000 240763 240155 gene locus_tag LOCUS_19010 240763 240155 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545597.1 protein_id gnl|my_center|LOCUS_19010 241574 241771 gene locus_tag LOCUS_19020 241574 241771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 242987 241728 gene locus_tag LOCUS_19030 242987 241728 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411730.1 protein_id gnl|my_center|LOCUS_19030 243276 244394 gene locus_tag LOCUS_19040 gene dnaN 243276 244394 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_19040 244692 245531 gene locus_tag LOCUS_19050 244692 245531 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_19050 245566 245820 gene locus_tag LOCUS_19060 245566 245820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 246640 246155 gene locus_tag LOCUS_19070 246640 246155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 247166 246678 gene locus_tag LOCUS_19080 247166 246678 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_19080 247381 247695 gene locus_tag LOCUS_19090 247381 247695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 247806 249617 gene locus_tag LOCUS_19100 gene thiC 247806 249617 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962597.1 protein_id gnl|my_center|LOCUS_19100 249614 250246 gene locus_tag LOCUS_19110 249614 250246 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_19110 250296 251057 gene locus_tag LOCUS_19120 250296 251057 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962599.1 protein_id gnl|my_center|LOCUS_19120 251068 251676 gene locus_tag LOCUS_19130 251068 251676 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768961.1 protein_id gnl|my_center|LOCUS_19130 251661 252455 gene locus_tag LOCUS_19140 251661 252455 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962601.1 protein_id gnl|my_center|LOCUS_19140 252456 253577 gene locus_tag LOCUS_19150 gene thiH 252456 253577 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_19150 253647 254861 gene locus_tag LOCUS_19160 253647 254861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769619.1 protein_id gnl|my_center|LOCUS_19160 257398 254858 gene locus_tag LOCUS_19170 257398 254858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 258015 257509 gene locus_tag LOCUS_19180 258015 257509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 265999 258020 gene locus_tag LOCUS_19190 265999 258020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 266815 266027 gene locus_tag LOCUS_19200 266815 266027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 267500 266976 gene locus_tag LOCUS_19210 267500 266976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 268125 267748 gene locus_tag LOCUS_19220 268125 267748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 268667 268170 gene locus_tag LOCUS_19230 268667 268170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 269823 268747 gene locus_tag LOCUS_19240 269823 268747 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_19240 270584 269847 gene locus_tag LOCUS_19250 gene kdsB 270584 269847 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963128.1 protein_id gnl|my_center|LOCUS_19250 271793 270600 gene locus_tag LOCUS_19260 271793 270600 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_19260 272016 272444 gene locus_tag LOCUS_19270 272016 272444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 272455 274029 gene locus_tag LOCUS_19280 272455 274029 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_19280 274383 274030 gene locus_tag LOCUS_19290 274383 274030 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_19290 275734 274451 gene locus_tag LOCUS_19300 275734 274451 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_19300 276977 275739 gene locus_tag LOCUS_19310 276977 275739 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_19310 278275 277058 gene locus_tag LOCUS_19320 278275 277058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 278410 279534 gene locus_tag LOCUS_19330 gene mqnC 278410 279534 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545015.1 protein_id gnl|my_center|LOCUS_19330 280079 280732 gene locus_tag LOCUS_19340 280079 280732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 280839 281390 gene locus_tag LOCUS_19350 280839 281390 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_19350 282242 281397 gene locus_tag LOCUS_19360 282242 281397 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_19360 282513 282815 gene locus_tag LOCUS_19370 282513 282815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 protein_id gnl|my_center|LOCUS_19370 283200 282802 gene locus_tag LOCUS_19380 283200 282802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129903.1 protein_id gnl|my_center|LOCUS_19380 285961 283241 gene locus_tag LOCUS_19390 285961 283241 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_19390 286842 285994 gene locus_tag LOCUS_19400 286842 285994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 286962 288461 gene locus_tag LOCUS_19410 286962 288461 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_19410 288458 289153 gene locus_tag LOCUS_19420 288458 289153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_19420 292877 289146 gene locus_tag LOCUS_19430 292877 289146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 293153 293599 gene locus_tag LOCUS_19440 293153 293599 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_19440 294405 293680 gene locus_tag LOCUS_19450 294405 293680 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_19450 294889 294416 gene locus_tag LOCUS_19460 294889 294416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 296063 294975 gene locus_tag LOCUS_19470 gene gcvT 296063 294975 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_19470 296126 297853 gene locus_tag LOCUS_19480 296126 297853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 297876 298259 gene locus_tag LOCUS_19490 297876 298259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 298319 299005 gene locus_tag LOCUS_19500 298319 299005 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_19500 299492 299773 gene locus_tag LOCUS_19510 299492 299773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 300031 300423 gene locus_tag LOCUS_19520 300031 300423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 300427 300909 gene locus_tag LOCUS_19530 300427 300909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 301016 301360 gene locus_tag LOCUS_19540 301016 301360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 301353 301826 gene locus_tag LOCUS_19550 301353 301826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 301873 303033 gene locus_tag LOCUS_19560 301873 303033 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695909.1 protein_id gnl|my_center|LOCUS_19560 304601 303900 gene locus_tag LOCUS_19570 304601 303900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 305252 304653 gene locus_tag LOCUS_19580 305252 304653 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683580.1 protein_id gnl|my_center|LOCUS_19580 305807 305262 gene locus_tag LOCUS_19590 305807 305262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 306393 306806 gene locus_tag LOCUS_19600 306393 306806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 307066 307572 gene locus_tag LOCUS_19610 307066 307572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 307825 307574 gene locus_tag LOCUS_19620 307825 307574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 308599 307835 gene locus_tag LOCUS_19630 308599 307835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 308721 309746 gene locus_tag LOCUS_19640 308721 309746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 310112 309747 gene locus_tag LOCUS_19650 310112 309747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 310540 310130 gene locus_tag LOCUS_19660 310540 310130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 310876 310568 gene locus_tag LOCUS_19670 310876 310568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 310975 312054 gene locus_tag LOCUS_19680 310975 312054 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107805.1 protein_id gnl|my_center|LOCUS_19680 312647 312063 gene locus_tag LOCUS_19690 gene nadD 312647 312063 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_19690 313145 312660 gene locus_tag LOCUS_19700 gene paaJ 313145 312660 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177939.1 protein_id gnl|my_center|LOCUS_19700 313919 313155 gene locus_tag LOCUS_19710 gene paaC 313919 313155 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_19710 314286 313906 gene locus_tag LOCUS_19720 314286 313906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 315304 314306 gene locus_tag LOCUS_19730 gene paaA 315304 314306 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_19730 315425 316051 gene locus_tag LOCUS_19740 315425 316051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 316165 317601 gene locus_tag LOCUS_19750 316165 317601 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_19750 318567 317677 gene locus_tag LOCUS_19760 318567 317677 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_19760 320817 318691 gene locus_tag LOCUS_19770 gene feoB 320817 318691 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_19770 322778 320988 gene locus_tag LOCUS_19780 322778 320988 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_19780 323155 322817 gene locus_tag LOCUS_19790 323155 322817 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_19790 323518 323814 gene locus_tag LOCUS_19800 323518 323814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 324073 325719 gene locus_tag LOCUS_19810 324073 325719 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_19810 325735 326406 gene locus_tag LOCUS_19820 325735 326406 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_19820 327566 326475 gene locus_tag LOCUS_19830 327566 326475 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_19830 328544 327570 gene locus_tag LOCUS_19840 328544 327570 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_19840 328719 330920 gene locus_tag LOCUS_19850 gene recQ 328719 330920 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_19850 330910 331677 gene locus_tag LOCUS_19860 330910 331677 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_19860 331740 331813 gene locus_tag LOCUS_t00220 331740 331813 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 332441 332806 gene locus_tag LOCUS_19870 332441 332806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 333021 333773 gene locus_tag LOCUS_19880 333021 333773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 335868 335068 gene locus_tag LOCUS_19890 335868 335068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 337334 335892 gene locus_tag LOCUS_19900 337334 335892 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_19900 340339 337346 gene locus_tag LOCUS_19910 340339 337346 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404908.1 protein_id gnl|my_center|LOCUS_19910 340791 341648 gene locus_tag LOCUS_19920 340791 341648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 341653 343029 gene locus_tag LOCUS_19930 341653 343029 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_19930 343035 343790 gene locus_tag LOCUS_19940 343035 343790 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_19940 343812 345221 gene locus_tag LOCUS_19950 343812 345221 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_19950 345416 347341 gene locus_tag LOCUS_19960 345416 347341 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168196249.1 protein_id gnl|my_center|LOCUS_19960 347467 347826 gene locus_tag LOCUS_19970 347467 347826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 347867 348937 gene locus_tag LOCUS_19980 347867 348937 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_19980 349114 348944 gene locus_tag LOCUS_19990 349114 348944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 349194 350495 gene locus_tag LOCUS_20000 349194 350495 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395916.1 protein_id gnl|my_center|LOCUS_20000 350632 351447 gene locus_tag LOCUS_20010 350632 351447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 351470 352000 gene locus_tag LOCUS_20020 351470 352000 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_20020 353399 352005 gene locus_tag LOCUS_20030 353399 352005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 353749 353396 gene locus_tag LOCUS_20040 353749 353396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 356217 354349 gene locus_tag LOCUS_20050 gene mnmG 356217 354349 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_20050 357136 357300 gene locus_tag LOCUS_20060 357136 357300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 360050 359619 gene locus_tag LOCUS_20070 gene ybeY 360050 359619 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_20070 360183 360413 gene locus_tag LOCUS_20080 360183 360413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 363403 362396 gene locus_tag LOCUS_20090 gene nadA 363403 362396 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_20090 364169 366283 gene locus_tag LOCUS_20100 364169 366283 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_20100 366388 366891 gene locus_tag LOCUS_20110 366388 366891 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_20110 367921 366893 gene locus_tag LOCUS_20120 gene corA 367921 366893 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_20120 368304 368104 gene locus_tag LOCUS_20130 368304 368104 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_20130 368726 368301 gene locus_tag LOCUS_20140 368726 368301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 370121 368868 gene locus_tag LOCUS_20150 370121 368868 CDS product DUF3472 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121875.1 protein_id gnl|my_center|LOCUS_20150 370686 370207 gene locus_tag LOCUS_20160 370686 370207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 371165 370794 gene locus_tag LOCUS_20170 371165 370794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 371671 371174 gene locus_tag LOCUS_20180 371671 371174 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_20180 371757 372830 gene locus_tag LOCUS_20190 371757 372830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 373375 372812 gene locus_tag LOCUS_20200 373375 372812 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948952.1 protein_id gnl|my_center|LOCUS_20200 374217 373372 gene locus_tag LOCUS_20210 374217 373372 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_20210 374861 374370 gene locus_tag LOCUS_20220 374861 374370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 377124 375649 gene locus_tag LOCUS_20230 377124 375649 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480842.1 protein_id gnl|my_center|LOCUS_20230 381560 377157 gene locus_tag LOCUS_20240 gene gltB 381560 377157 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227769.1 protein_id gnl|my_center|LOCUS_20240 383575 381977 gene locus_tag LOCUS_20250 383575 381977 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098999755.1 protein_id gnl|my_center|LOCUS_20250 383656 384624 gene locus_tag LOCUS_20260 383656 384624 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_20260 385278 384826 gene locus_tag LOCUS_20270 385278 384826 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_20270 385374 385955 gene locus_tag LOCUS_20280 385374 385955 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_20280 386316 387989 gene locus_tag LOCUS_20290 386316 387989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 388035 388658 gene locus_tag LOCUS_20300 gene pnuC 388035 388658 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_20300 388655 389176 gene locus_tag LOCUS_20310 388655 389176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 389955 389326 gene locus_tag LOCUS_20320 gene mtgA 389955 389326 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210144.1 protein_id gnl|my_center|LOCUS_20320 390145 390762 gene locus_tag LOCUS_20330 390145 390762 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_20330 391977 390844 gene locus_tag LOCUS_20340 391977 390844 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_20340 392552 392067 gene locus_tag LOCUS_20350 392552 392067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 395568 392749 gene locus_tag LOCUS_20360 gene polA 395568 392749 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108723.1 protein_id gnl|my_center|LOCUS_20360 395612 395962 gene locus_tag LOCUS_20370 395612 395962 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_20370 397095 395995 gene locus_tag LOCUS_20380 397095 395995 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_20380 397443 397691 gene locus_tag LOCUS_20390 397443 397691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 397972 399111 gene locus_tag LOCUS_20400 397972 399111 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_20400 399147 400040 gene locus_tag LOCUS_20410 399147 400040 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_20410 400060 400941 gene locus_tag LOCUS_20420 400060 400941 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_20420 401941 401009 gene locus_tag LOCUS_20430 401941 401009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 402154 403116 gene locus_tag LOCUS_20440 402154 403116 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_20440 403238 404575 gene locus_tag LOCUS_20450 403238 404575 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_20450 404934 406196 gene locus_tag LOCUS_20460 gene dacB 404934 406196 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_20460 408412 406271 gene locus_tag LOCUS_20470 408412 406271 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_20470 408555 409028 gene locus_tag LOCUS_20480 408555 409028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 409045 409497 gene locus_tag LOCUS_20490 409045 409497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 410926 409568 gene locus_tag LOCUS_20500 410926 409568 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_20500 411222 412865 gene locus_tag LOCUS_20510 411222 412865 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146628.1 protein_id gnl|my_center|LOCUS_20510 413616 412936 gene locus_tag LOCUS_20520 413616 412936 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839853.1 protein_id gnl|my_center|LOCUS_20520 415355 413622 gene locus_tag LOCUS_20530 415355 413622 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_20530 415460 416944 gene locus_tag LOCUS_20540 gene gntK 415460 416944 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 protein_id gnl|my_center|LOCUS_20540 419202 417334 gene locus_tag LOCUS_20550 gene mutL 419202 417334 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_20550 419377 419937 gene locus_tag LOCUS_20560 gene msrB 419377 419937 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926800.1 protein_id gnl|my_center|LOCUS_20560 420093 420599 gene locus_tag LOCUS_20570 420093 420599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 421292 421011 gene locus_tag LOCUS_20580 421292 421011 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262427.1 protein_id gnl|my_center|LOCUS_20580 421509 423179 gene locus_tag LOCUS_20590 421509 423179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 423270 423920 gene locus_tag LOCUS_20600 423270 423920 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801226.1 protein_id gnl|my_center|LOCUS_20600 423922 425112 gene locus_tag LOCUS_20610 423922 425112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795935.1 protein_id gnl|my_center|LOCUS_20610 425122 426753 gene locus_tag LOCUS_20620 425122 426753 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_20620 427298 426789 gene locus_tag LOCUS_20630 427298 426789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 428549 427461 gene locus_tag LOCUS_20640 428549 427461 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_20640 429791 428553 gene locus_tag LOCUS_20650 429791 428553 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_20650 429856 430170 gene locus_tag LOCUS_20660 429856 430170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 432098 430239 gene locus_tag LOCUS_20670 gene typA 432098 430239 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_20670 434511 432262 gene locus_tag LOCUS_20680 434511 432262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 435595 434558 gene locus_tag LOCUS_20690 435595 434558 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_20690 435703 436314 gene locus_tag LOCUS_20700 435703 436314 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_20700 436328 437815 gene locus_tag LOCUS_20710 gene rpoN 436328 437815 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_20710 437812 438489 gene locus_tag LOCUS_20720 437812 438489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763602.1 protein_id gnl|my_center|LOCUS_20720 438718 439731 gene locus_tag LOCUS_20730 gene recA 438718 439731 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_20730 439977 440585 gene locus_tag LOCUS_20740 439977 440585 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967613.1 protein_id gnl|my_center|LOCUS_20740 441468 440875 gene locus_tag LOCUS_20750 441468 440875 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_20750 441915 442682 gene locus_tag LOCUS_20760 441915 442682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 442755 442681 gene locus_tag LOCUS_t00230 442755 442681 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 443959 442817 gene locus_tag LOCUS_20770 gene obgE 443959 442817 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_20770 444641 444024 gene locus_tag LOCUS_20780 444641 444024 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_20780 444972 447956 gene locus_tag LOCUS_20790 444972 447956 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_20790 448560 448093 gene locus_tag LOCUS_20800 448560 448093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 450740 448962 gene locus_tag LOCUS_20810 450740 448962 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_20810 450878 450753 gene locus_tag LOCUS_20820 450878 450753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 451662 450910 gene locus_tag LOCUS_20830 451662 450910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 451821 452459 gene locus_tag LOCUS_20840 451821 452459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 453071 452463 gene locus_tag LOCUS_20850 453071 452463 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_20850 454516 453080 gene locus_tag LOCUS_20860 gene cysS 454516 453080 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_20860 455784 454663 gene locus_tag LOCUS_20870 455784 454663 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_20870 456925 455906 gene locus_tag LOCUS_20880 456925 455906 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_20880 457952 457008 gene locus_tag LOCUS_20890 457952 457008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 458817 457996 gene locus_tag LOCUS_20900 458817 457996 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_20900 460284 458878 gene locus_tag LOCUS_20910 gene rlmD 460284 458878 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_20910 460327 461730 gene locus_tag LOCUS_20920 460327 461730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 461855 462526 gene locus_tag LOCUS_20930 461855 462526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 462608 463222 gene locus_tag LOCUS_20940 462608 463222 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765529.1 protein_id gnl|my_center|LOCUS_20940 463554 464240 gene locus_tag LOCUS_20950 463554 464240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 465388 464435 gene locus_tag LOCUS_20960 gene metF 465388 464435 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_20960 465540 466307 gene locus_tag LOCUS_20970 gene lptB 465540 466307 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_20970 466384 467862 gene locus_tag LOCUS_20980 466384 467862 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_20980 467926 468675 gene locus_tag LOCUS_20990 gene fabG 467926 468675 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_20990 469126 470652 gene locus_tag LOCUS_21000 469126 470652 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_21000 471525 470647 gene locus_tag LOCUS_21010 471525 470647 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_21010 471583 472635 gene locus_tag LOCUS_21020 471583 472635 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_21020 474099 472639 gene locus_tag LOCUS_21030 474099 472639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 475762 474167 gene locus_tag LOCUS_21040 gene ricT 475762 474167 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766922.1 protein_id gnl|my_center|LOCUS_21040 477154 476018 gene locus_tag LOCUS_21050 477154 476018 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_21050 477703 477176 gene locus_tag LOCUS_21060 477703 477176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 478231 477710 gene locus_tag LOCUS_21070 478231 477710 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963538.1 protein_id gnl|my_center|LOCUS_21070 478931 478308 gene locus_tag LOCUS_21080 gene recR 478931 478308 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_21080 480435 478954 gene locus_tag LOCUS_21090 480435 478954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 483645 480490 gene locus_tag LOCUS_21100 483645 480490 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120701253.1 protein_id gnl|my_center|LOCUS_21100 484769 483642 gene locus_tag LOCUS_21110 484769 483642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 485954 484839 gene locus_tag LOCUS_21120 485954 484839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 486055 486702 gene locus_tag LOCUS_21130 gene pdxH 486055 486702 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_21130 487301 487032 gene locus_tag LOCUS_21140 gene hupB 487301 487032 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_21140 487900 487598 gene locus_tag LOCUS_21150 487900 487598 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_21150 488667 487897 gene locus_tag LOCUS_21160 488667 487897 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_21160 489054 488830 gene locus_tag LOCUS_21170 489054 488830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 489407 489126 gene locus_tag LOCUS_21180 489407 489126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 489840 491741 gene locus_tag LOCUS_21190 489840 491741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 492241 492906 gene locus_tag LOCUS_21200 492241 492906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 496449 495736 gene locus_tag LOCUS_21210 gene pyrH 496449 495736 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_21210 497407 496583 gene locus_tag LOCUS_21220 gene tsf 497407 496583 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_21220 498577 497534 gene locus_tag LOCUS_21230 498577 497534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 498970 498581 gene locus_tag LOCUS_21240 gene rpsI 498970 498581 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_21240 499427 498984 gene locus_tag LOCUS_21250 gene rplM 499427 498984 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_21250 500346 499672 gene locus_tag LOCUS_21260 500346 499672 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_21260 500898 502265 gene locus_tag LOCUS_21270 gene radA 500898 502265 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_21270 502306 502989 gene locus_tag LOCUS_21280 502306 502989 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_21280 503329 503144 gene locus_tag LOCUS_21290 503329 503144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 503785 504801 gene locus_tag LOCUS_21300 503785 504801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21300 504820 507519 gene locus_tag LOCUS_21310 gene metH 504820 507519 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194931144.1 protein_id gnl|my_center|LOCUS_21310 508141 507578 gene locus_tag LOCUS_21320 508141 507578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 510385 508448 gene locus_tag LOCUS_21330 510385 508448 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_21330 510631 511497 gene locus_tag LOCUS_21340 510631 511497 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_21340 512855 512019 gene locus_tag LOCUS_21350 512855 512019 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248045.1 protein_id gnl|my_center|LOCUS_21350 513642 512884 gene locus_tag LOCUS_21360 513642 512884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 514655 513639 gene locus_tag LOCUS_21370 514655 513639 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_21370 515555 514791 gene locus_tag LOCUS_21380 gene blaOXA 515555 514791 CDS product OXA-61 family class D beta-lactamase OXA-193 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002783228.1 protein_id gnl|my_center|LOCUS_21380 517152 515950 gene locus_tag LOCUS_21390 gene kbl 517152 515950 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_21390 517533 518018 gene locus_tag LOCUS_21400 517533 518018 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_21400 518044 519096 gene locus_tag LOCUS_21410 518044 519096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 519130 520065 gene locus_tag LOCUS_21420 519130 520065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 520188 520526 gene locus_tag LOCUS_21430 520188 520526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 520623 523553 gene locus_tag LOCUS_21440 520623 523553 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_21440 523664 524218 gene locus_tag LOCUS_21450 523664 524218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 526211 524298 gene locus_tag LOCUS_21460 gene acs 526211 524298 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_21460 527519 526377 gene locus_tag LOCUS_21470 527519 526377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 529988 527568 gene locus_tag LOCUS_21480 529988 527568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 530387 530103 gene locus_tag LOCUS_21490 530387 530103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 530728 530486 gene locus_tag LOCUS_21500 530728 530486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 530851 531429 gene locus_tag LOCUS_21510 530851 531429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 531697 532101 gene locus_tag LOCUS_21520 531697 532101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 532273 535089 gene locus_tag LOCUS_21530 gene carB 532273 535089 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_21530 535413 537233 gene locus_tag LOCUS_21540 535413 537233 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_21540 537246 538763 gene locus_tag LOCUS_21550 gene purH 537246 538763 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_21550 539173 539718 gene locus_tag LOCUS_21560 539173 539718 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_21560 539719 541116 gene locus_tag LOCUS_21570 539719 541116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 542710 541331 gene locus_tag LOCUS_21580 542710 541331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 543381 542803 gene locus_tag LOCUS_21590 543381 542803 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_21590 543982 543389 gene locus_tag LOCUS_21600 543982 543389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 545313 543979 gene locus_tag LOCUS_21610 545313 543979 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_21610 545952 545473 gene locus_tag LOCUS_21620 gene ssb 545952 545473 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137264126.1 protein_id gnl|my_center|LOCUS_21620 547177 546119 gene locus_tag LOCUS_21630 gene mutY 547177 546119 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_21630 547418 547690 gene locus_tag LOCUS_21640 547418 547690 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_21640 547733 548563 gene locus_tag LOCUS_21650 547733 548563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 549009 550556 gene locus_tag LOCUS_21660 549009 550556 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_21660 550672 552291 gene locus_tag LOCUS_21670 550672 552291 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992395.1 protein_id gnl|my_center|LOCUS_21670 553056 552292 gene locus_tag LOCUS_21680 553056 552292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 553181 553588 gene locus_tag LOCUS_21690 553181 553588 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_21690 553595 554251 gene locus_tag LOCUS_21700 553595 554251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 554260 554937 gene locus_tag LOCUS_21710 gene tsaB 554260 554937 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_21710 555243 555602 gene locus_tag LOCUS_21720 555243 555602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 555778 557181 gene locus_tag LOCUS_21730 555778 557181 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_21730 557277 558548 gene locus_tag LOCUS_21740 557277 558548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 558775 559248 gene locus_tag LOCUS_21750 558775 559248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 559288 559662 gene locus_tag LOCUS_21760 559288 559662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 560598 559717 gene locus_tag LOCUS_21770 560598 559717 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_21770 562224 560617 gene locus_tag LOCUS_21780 gene nadB 562224 560617 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_21780 563516 562851 gene locus_tag LOCUS_21790 563516 562851 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_21790 564881 563550 gene locus_tag LOCUS_21800 564881 563550 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_21800 566229 564883 gene locus_tag LOCUS_21810 566229 564883 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_21810 566544 567791 gene locus_tag LOCUS_21820 566544 567791 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_21820 567831 568520 gene locus_tag LOCUS_21830 567831 568520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_21830 568797 571163 gene locus_tag LOCUS_21840 568797 571163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_21840 571189 573603 gene locus_tag LOCUS_21850 571189 573603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_21850 573634 574296 gene locus_tag LOCUS_21860 573634 574296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_21860 574335 575900 gene locus_tag LOCUS_21870 574335 575900 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_21870 575931 577328 gene locus_tag LOCUS_21880 575931 577328 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_21880 577467 578486 gene locus_tag LOCUS_21890 577467 578486 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962320.1 protein_id gnl|my_center|LOCUS_21890 579514 578483 gene locus_tag LOCUS_21900 gene hemW 579514 578483 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_21900 579768 580721 gene locus_tag LOCUS_21910 579768 580721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 580760 581536 gene locus_tag LOCUS_21920 580760 581536 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_21920 582059 584101 gene locus_tag LOCUS_21930 582059 584101 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_21930 584688 585791 gene locus_tag LOCUS_21940 gene gldK 584688 585791 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_21940 585908 586648 gene locus_tag LOCUS_21950 gene gldL 585908 586648 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_21950 586705 588243 gene locus_tag LOCUS_21960 gene gldM 586705 588243 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_21960 588265 589293 gene locus_tag LOCUS_21970 588265 589293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 589375 589947 gene locus_tag LOCUS_21980 589375 589947 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_21980 590019 590645 gene locus_tag LOCUS_21990 590019 590645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 592803 590980 gene locus_tag LOCUS_22000 gene uvrC 592803 590980 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_22000 593387 592800 gene locus_tag LOCUS_22010 593387 592800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 595160 593640 gene locus_tag LOCUS_22020 gene gpmI 595160 593640 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_22020 595403 595798 gene locus_tag LOCUS_22030 595403 595798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 595888 596748 gene locus_tag LOCUS_22040 gene nadC 595888 596748 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_22040 596759 597649 gene locus_tag LOCUS_22050 596759 597649 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_22050 597662 597994 gene locus_tag LOCUS_22060 597662 597994 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_22060 599053 598070 gene locus_tag LOCUS_22070 599053 598070 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207884.1 protein_id gnl|my_center|LOCUS_22070 600108 599368 gene locus_tag LOCUS_22080 600108 599368 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_22080 600273 600668 gene locus_tag LOCUS_22090 600273 600668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 600739 602784 gene locus_tag LOCUS_22100 gene ftsH 600739 602784 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_22100 602791 603426 gene locus_tag LOCUS_22110 602791 603426 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256718.1 protein_id gnl|my_center|LOCUS_22110 603510 604280 gene locus_tag LOCUS_22120 603510 604280 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_22120 605011 604277 gene locus_tag LOCUS_22130 gene recO 605011 604277 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_22130 607107 605029 gene locus_tag LOCUS_22140 607107 605029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 607389 609713 gene locus_tag LOCUS_22150 607389 609713 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_22150 609958 610656 gene locus_tag LOCUS_22160 609958 610656 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680749.1 protein_id gnl|my_center|LOCUS_22160 611264 614386 gene locus_tag LOCUS_22170 611264 614386 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_22170 614411 615838 gene locus_tag LOCUS_22180 614411 615838 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_22180 616089 618938 gene locus_tag LOCUS_22190 616089 618938 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_22190 618956 620353 gene locus_tag LOCUS_22200 618956 620353 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107166.1 protein_id gnl|my_center|LOCUS_22200 620796 623882 gene locus_tag LOCUS_22210 620796 623882 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_22210 623966 625357 gene locus_tag LOCUS_22220 623966 625357 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796344.1 protein_id gnl|my_center|LOCUS_22220 626604 625456 gene locus_tag LOCUS_22230 626604 625456 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_22230 628274 626817 gene locus_tag LOCUS_22240 gene gatB 628274 626817 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_22240 628365 629738 gene locus_tag LOCUS_22250 628365 629738 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_22250 629840 630064 gene locus_tag LOCUS_22260 629840 630064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 630074 630487 gene locus_tag LOCUS_22270 630074 630487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 631520 630555 gene locus_tag LOCUS_22280 631520 630555 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100313469.1 protein_id gnl|my_center|LOCUS_22280 634565 631953 gene locus_tag LOCUS_22290 gene alaS 634565 631953 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_22290 634892 635863 gene locus_tag LOCUS_22300 634892 635863 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_22300 635959 636492 gene locus_tag LOCUS_22310 635959 636492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 636504 636992 gene locus_tag LOCUS_22320 636504 636992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 638390 637302 gene locus_tag LOCUS_22330 638390 637302 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880493.1 protein_id gnl|my_center|LOCUS_22330 639569 638403 gene locus_tag LOCUS_22340 639569 638403 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_22340 639705 640781 gene locus_tag LOCUS_22350 gene prfA 639705 640781 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_22350 640912 641481 gene locus_tag LOCUS_22360 640912 641481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 641695 642300 gene locus_tag LOCUS_22370 641695 642300 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838096.1 protein_id gnl|my_center|LOCUS_22370 643617 642436 gene locus_tag LOCUS_22380 643617 642436 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_22380 643691 644173 gene locus_tag LOCUS_22390 643691 644173 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_22390 645489 644539 gene locus_tag LOCUS_22400 gene rsgA 645489 644539 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_22400 646507 645497 gene locus_tag LOCUS_22410 646507 645497 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_22410 647520 646516 gene locus_tag LOCUS_22420 647520 646516 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_22420 648415 647549 gene locus_tag LOCUS_22430 648415 647549 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_22430 649437 648436 gene locus_tag LOCUS_22440 649437 648436 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_22440 649698 650042 gene locus_tag LOCUS_22450 649698 650042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_22450 650123 650788 gene locus_tag LOCUS_22460 650123 650788 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_22460 650876 651256 gene locus_tag LOCUS_22470 gene gcvH 650876 651256 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_22470 651261 651683 gene locus_tag LOCUS_22480 651261 651683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 651919 652338 gene locus_tag LOCUS_22490 651919 652338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 654836 652329 gene locus_tag LOCUS_22500 654836 652329 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_22500 655061 655756 gene locus_tag LOCUS_22510 655061 655756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303162.1 protein_id gnl|my_center|LOCUS_22510 655769 656065 gene locus_tag LOCUS_22520 655769 656065 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_22520 656065 656421 gene locus_tag LOCUS_22530 656065 656421 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037225450.1 protein_id gnl|my_center|LOCUS_22530 659767 656474 gene locus_tag LOCUS_22540 659767 656474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 659911 660573 gene locus_tag LOCUS_22550 659911 660573 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_22550 662043 660556 gene locus_tag LOCUS_22560 662043 660556 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_22560 662480 662076 gene locus_tag LOCUS_22570 gene arfB 662480 662076 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_22570 662533 662985 gene locus_tag LOCUS_22580 gene dtd 662533 662985 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_22580 662986 663315 gene locus_tag LOCUS_22590 662986 663315 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_22590 663374 664813 gene locus_tag LOCUS_22600 663374 664813 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_22600 665956 665231 gene locus_tag LOCUS_22610 665956 665231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 666217 669588 gene locus_tag LOCUS_22620 gene mfd 666217 669588 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_22620 669762 670463 gene locus_tag LOCUS_22630 669762 670463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 671207 670686 gene locus_tag LOCUS_22640 671207 670686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 673367 671388 gene locus_tag LOCUS_22650 gene gyrB 673367 671388 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_22650 675160 673490 gene locus_tag LOCUS_22660 675160 673490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 675277 676206 gene locus_tag LOCUS_22670 675277 676206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 677314 676847 gene locus_tag LOCUS_22680 677314 676847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 677542 680871 gene locus_tag LOCUS_22690 gene ileS 677542 680871 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_22690 680876 681949 gene locus_tag LOCUS_22700 680876 681949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 683032 682037 gene locus_tag LOCUS_22710 gene rhuM 683032 682037 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_22710 685069 683528 gene locus_tag LOCUS_22720 685069 683528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 685241 685609 gene locus_tag LOCUS_22730 gene rbfA 685241 685609 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918248.1 protein_id gnl|my_center|LOCUS_22730 685627 686862 gene locus_tag LOCUS_22740 685627 686862 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_22740 688128 687292 gene locus_tag LOCUS_22750 688128 687292 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_22750 688282 689445 gene locus_tag LOCUS_22760 688282 689445 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_22760 689541 690104 gene locus_tag LOCUS_22770 gene frr 689541 690104 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_22770 691004 690153 gene locus_tag LOCUS_22780 691004 690153 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_22780 691085 691858 gene locus_tag LOCUS_22790 691085 691858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 691914 692288 gene locus_tag LOCUS_22800 gene mscL 691914 692288 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 protein_id gnl|my_center|LOCUS_22800 692368 693315 gene locus_tag LOCUS_22810 692368 693315 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_22810 693382 694170 gene locus_tag LOCUS_22820 693382 694170 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_22820 694176 695078 gene locus_tag LOCUS_22830 694176 695078 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_22830 695214 696092 gene locus_tag LOCUS_22840 695214 696092 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_22840 696150 696677 gene locus_tag LOCUS_22850 696150 696677 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_22850 696703 697332 gene locus_tag LOCUS_22860 696703 697332 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_22860 697450 697860 gene locus_tag LOCUS_22870 697450 697860 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338337.1 protein_id gnl|my_center|LOCUS_22870 698019 698732 gene locus_tag LOCUS_22880 698019 698732 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_22880 698908 699285 gene locus_tag LOCUS_22890 698908 699285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 700845 699298 gene locus_tag LOCUS_22900 700845 699298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 701941 700886 gene locus_tag LOCUS_22910 701941 700886 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_22910 703928 702000 gene locus_tag LOCUS_22920 gene dxs 703928 702000 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_22920 704394 705320 gene locus_tag LOCUS_22930 704394 705320 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_22930 705344 706072 gene locus_tag LOCUS_22940 705344 706072 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_22940 707385 706624 gene locus_tag LOCUS_22950 707385 706624 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_22950 707656 710985 gene locus_tag LOCUS_22960 707656 710985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 711335 711105 gene locus_tag LOCUS_22970 711335 711105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 712921 712151 gene locus_tag LOCUS_22980 712921 712151 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_22980 712980 714347 gene locus_tag LOCUS_22990 712980 714347 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_22990 714515 715012 gene locus_tag LOCUS_23000 714515 715012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 715030 715530 gene locus_tag LOCUS_23010 715030 715530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 715962 715531 gene locus_tag LOCUS_23020 715962 715531 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331629.1 protein_id gnl|my_center|LOCUS_23020 716918 715986 gene locus_tag LOCUS_23030 716918 715986 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187293929.1 protein_id gnl|my_center|LOCUS_23030 717024 717776 gene locus_tag LOCUS_23040 717024 717776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 719172 717847 gene locus_tag LOCUS_23050 719172 717847 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838343.1 protein_id gnl|my_center|LOCUS_23050 722316 719185 gene locus_tag LOCUS_23060 722316 719185 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119656495.1 protein_id gnl|my_center|LOCUS_23060 723441 722365 gene locus_tag LOCUS_23070 723441 722365 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_23070 723981 724253 gene locus_tag LOCUS_23080 723981 724253 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_23080 724277 725530 gene locus_tag LOCUS_23090 gene fabF 724277 725530 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_23090 725586 726263 gene locus_tag LOCUS_23100 gene rnc 725586 726263 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291361.1 protein_id gnl|my_center|LOCUS_23100 726879 726277 gene locus_tag LOCUS_23110 726879 726277 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989890.1 protein_id gnl|my_center|LOCUS_23110 727882 726926 gene locus_tag LOCUS_23120 727882 726926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 729195 728161 gene locus_tag LOCUS_23130 gene cydB 729195 728161 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_23130 730600 729206 gene locus_tag LOCUS_23140 730600 729206 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_23140 731169 733229 gene locus_tag LOCUS_23150 731169 733229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 733992 733243 gene locus_tag LOCUS_23160 733992 733243 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765986.1 protein_id gnl|my_center|LOCUS_23160 734482 733997 gene locus_tag LOCUS_23170 734482 733997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 735744 734482 gene locus_tag LOCUS_23180 735744 734482 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_23180 736006 735788 gene locus_tag LOCUS_23190 736006 735788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 736545 736219 gene locus_tag LOCUS_23200 736545 736219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 737231 739531 gene locus_tag LOCUS_23210 gene metE 737231 739531 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764814.1 protein_id gnl|my_center|LOCUS_23210 740241 739669 gene locus_tag LOCUS_23220 740241 739669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 741048 740341 gene locus_tag LOCUS_23230 741048 740341 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_23230 741771 741115 gene locus_tag LOCUS_23240 741771 741115 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_23240 743476 741758 gene locus_tag LOCUS_23250 743476 741758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 743963 744892 gene locus_tag LOCUS_23260 743963 744892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 745641 746111 gene locus_tag LOCUS_23270 745641 746111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 747029 746136 gene locus_tag LOCUS_23280 747029 746136 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_23280 748376 747132 gene locus_tag LOCUS_23290 748376 747132 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_23290 749390 748386 gene locus_tag LOCUS_23300 749390 748386 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_23300 750967 749387 gene locus_tag LOCUS_23310 750967 749387 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920632.1 protein_id gnl|my_center|LOCUS_23310 751883 750954 gene locus_tag LOCUS_23320 751883 750954 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_23320 752070 753746 gene locus_tag LOCUS_23330 752070 753746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459431.1 protein_id gnl|my_center|LOCUS_23330 753855 754571 gene locus_tag LOCUS_23340 753855 754571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 754635 754994 gene locus_tag LOCUS_23350 754635 754994 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_23350 755964 755044 gene locus_tag LOCUS_23360 gene spxH 755964 755044 CDS product protease adaptor protein SpxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245184.1 protein_id gnl|my_center|LOCUS_23360 756180 756668 gene locus_tag LOCUS_23370 756180 756668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 756850 757443 gene locus_tag LOCUS_23380 756850 757443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 757833 757444 gene locus_tag LOCUS_23390 757833 757444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 758356 757850 gene locus_tag LOCUS_23400 758356 757850 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107703.1 protein_id gnl|my_center|LOCUS_23400 758756 758992 gene locus_tag LOCUS_23410 758756 758992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 758965 759330 gene locus_tag LOCUS_23420 758965 759330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 760005 759340 gene locus_tag LOCUS_23430 760005 759340 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242338.1 protein_id gnl|my_center|LOCUS_23430 760679 760095 gene locus_tag LOCUS_23440 760679 760095 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 protein_id gnl|my_center|LOCUS_23440 760901 762154 gene locus_tag LOCUS_23450 760901 762154 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_23450 762318 763475 gene locus_tag LOCUS_23460 762318 763475 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226157.1 protein_id gnl|my_center|LOCUS_23460 763537 764403 gene locus_tag LOCUS_23470 763537 764403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 764870 764511 gene locus_tag LOCUS_23480 764870 764511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 765354 764854 gene locus_tag LOCUS_23490 765354 764854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 765782 765378 gene locus_tag LOCUS_23500 765782 765378 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_23500 766445 765867 gene locus_tag LOCUS_23510 766445 765867 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_23510 767959 766577 gene locus_tag LOCUS_23520 767959 766577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 768218 771418 gene locus_tag LOCUS_23530 768218 771418 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202665.1 protein_id gnl|my_center|LOCUS_23530 771688 771479 gene locus_tag LOCUS_23540 771688 771479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 772486 771722 gene locus_tag LOCUS_23550 772486 771722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 772984 773634 gene locus_tag LOCUS_23560 772984 773634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 773898 774416 gene locus_tag LOCUS_23570 773898 774416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 774400 775020 gene locus_tag LOCUS_23580 774400 775020 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_23580 775214 775414 gene locus_tag LOCUS_23590 775214 775414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 775532 775798 gene locus_tag LOCUS_23600 775532 775798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 775802 777073 gene locus_tag LOCUS_23610 775802 777073 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815839.1 protein_id gnl|my_center|LOCUS_23610 777108 777368 gene locus_tag LOCUS_23620 777108 777368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 777483 777713 gene locus_tag LOCUS_23630 777483 777713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 778954 778118 gene locus_tag LOCUS_23640 778954 778118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 779671 780663 gene locus_tag LOCUS_23650 779671 780663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 780650 781402 gene locus_tag LOCUS_23660 780650 781402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence13 1748 1119 gene locus_tag LOCUS_23670 1748 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2667 1816 gene locus_tag LOCUS_23680 2667 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 3518 2664 gene locus_tag LOCUS_23690 3518 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 6444 3694 gene locus_tag LOCUS_23700 6444 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 6609 6941 gene locus_tag LOCUS_23710 6609 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 7053 7062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7738 7310 gene locus_tag LOCUS_23720 7738 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 <16342 7719 gene locus_tag LOCUS_23730 <16342 7719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964397.1:lamin tail domain-containing protein >Feature sequence14 469 182 gene locus_tag LOCUS_23740 469 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1377 469 gene locus_tag LOCUS_23750 1377 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence15 1018 119 gene locus_tag LOCUS_23760 1018 119 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_23760 1389 1015 gene locus_tag LOCUS_23770 1389 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence16 83 1132 gene locus_tag LOCUS_23780 83 1132 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017213233.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence17 2474 261 gene locus_tag LOCUS_23790 2474 261 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930065.1 protein_id gnl|my_center|LOCUS_23790 4078 2576 gene locus_tag LOCUS_23800 4078 2576 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_23800 4511 4107 gene locus_tag LOCUS_23810 4511 4107 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_23810 5733 4528 gene locus_tag LOCUS_23820 5733 4528 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_23820 7493 5853 gene locus_tag LOCUS_23830 7493 5853 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_23830 8719 7490 gene locus_tag LOCUS_23840 8719 7490 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876247.1 protein_id gnl|my_center|LOCUS_23840 9508 8735 gene locus_tag LOCUS_23850 9508 8735 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_23850 9764 10633 gene locus_tag LOCUS_23860 9764 10633 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434154.1 protein_id gnl|my_center|LOCUS_23860 11168 12046 gene locus_tag LOCUS_23870 11168 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 12049 13515 gene locus_tag LOCUS_23880 12049 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 13867 13595 gene locus_tag LOCUS_23890 13867 13595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 13957 14976 gene locus_tag LOCUS_23900 13957 14976 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_23900 15075 16211 gene locus_tag LOCUS_23910 15075 16211 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_23910 16215 17783 gene locus_tag LOCUS_23920 16215 17783 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114966.1 protein_id gnl|my_center|LOCUS_23920 17826 18620 gene locus_tag LOCUS_23930 17826 18620 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_23930 18626 20233 gene locus_tag LOCUS_23940 18626 20233 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_23940 20260 21483 gene locus_tag LOCUS_23950 20260 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_23950 21493 22350 gene locus_tag LOCUS_23960 21493 22350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 22372 23670 gene locus_tag LOCUS_23970 gene fucP 22372 23670 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767090.1 protein_id gnl|my_center|LOCUS_23970 24660 23665 gene locus_tag LOCUS_23980 24660 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 26666 24888 gene locus_tag LOCUS_23990 26666 24888 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_23990 29734 26684 gene locus_tag LOCUS_24000 29734 26684 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_24000 32444 29871 gene locus_tag LOCUS_24010 32444 29871 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_24010 33245 32838 gene locus_tag LOCUS_24020 33245 32838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 34146 33316 gene locus_tag LOCUS_24030 34146 33316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 34274 34543 gene locus_tag LOCUS_24040 34274 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 34933 34556 gene locus_tag LOCUS_24050 34933 34556 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_24050 39609 35005 gene locus_tag LOCUS_24060 39609 35005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 39795 43052 gene locus_tag LOCUS_24070 39795 43052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 43056 44912 gene locus_tag LOCUS_24080 43056 44912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 44921 45928 gene locus_tag LOCUS_24090 44921 45928 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_24090 45909 47075 gene locus_tag LOCUS_24100 45909 47075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 47079 49382 gene locus_tag LOCUS_24110 47079 49382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 51345 49384 gene locus_tag LOCUS_24120 51345 49384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 53012 51618 gene locus_tag LOCUS_24130 53012 51618 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_24130 56487 53023 gene locus_tag LOCUS_24140 56487 53023 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_24140 56877 58409 gene locus_tag LOCUS_24150 56877 58409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 58406 59608 gene locus_tag LOCUS_24160 58406 59608 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_24160 59998 60930 gene locus_tag LOCUS_24170 59998 60930 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24170 62120 61074 gene locus_tag LOCUS_24180 62120 61074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 62611 62213 gene locus_tag LOCUS_24190 62611 62213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 63112 62735 gene locus_tag LOCUS_24200 63112 62735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 64142 63696 gene locus_tag LOCUS_24210 64142 63696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 64755 64156 gene locus_tag LOCUS_24220 64755 64156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 65041 65373 gene locus_tag LOCUS_24230 65041 65373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 66207 65662 gene locus_tag LOCUS_24240 66207 65662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 67422 66643 gene locus_tag LOCUS_24250 67422 66643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 68351 67413 gene locus_tag LOCUS_24260 68351 67413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 69407 68571 gene locus_tag LOCUS_24270 69407 68571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 71107 69503 gene locus_tag LOCUS_24280 71107 69503 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765358.1 protein_id gnl|my_center|LOCUS_24280 72130 71117 gene locus_tag LOCUS_24290 72130 71117 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763044.1 protein_id gnl|my_center|LOCUS_24290 73517 72201 gene locus_tag LOCUS_24300 73517 72201 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765009.1 protein_id gnl|my_center|LOCUS_24300 74021 73575 gene locus_tag LOCUS_24310 74021 73575 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765008.1 protein_id gnl|my_center|LOCUS_24310 74538 77585 gene locus_tag LOCUS_24320 74538 77585 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_24320 77597 79237 gene locus_tag LOCUS_24330 77597 79237 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100991023.1 protein_id gnl|my_center|LOCUS_24330 80199 79321 gene locus_tag LOCUS_24340 80199 79321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 82763 80193 gene locus_tag LOCUS_24350 82763 80193 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_24350 83811 82876 gene locus_tag LOCUS_24360 83811 82876 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802446.1 protein_id gnl|my_center|LOCUS_24360 84440 83868 gene locus_tag LOCUS_24370 84440 83868 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706006.1 protein_id gnl|my_center|LOCUS_24370 84535 86439 gene locus_tag LOCUS_24380 84535 86439 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_24380 86545 86991 gene locus_tag LOCUS_24390 86545 86991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545772.1 protein_id gnl|my_center|LOCUS_24390 86981 87742 gene locus_tag LOCUS_24400 86981 87742 CDS product DUF1828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546132.1 protein_id gnl|my_center|LOCUS_24400 89934 87943 gene locus_tag LOCUS_24410 gene pqqU 89934 87943 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 protein_id gnl|my_center|LOCUS_24410 90023 92218 gene locus_tag LOCUS_24420 90023 92218 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_24420 93546 92221 gene locus_tag LOCUS_24430 93546 92221 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_24430 93866 95821 gene locus_tag LOCUS_24440 93866 95821 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_24440 96547 95918 gene locus_tag LOCUS_24450 96547 95918 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_24450 97662 96835 gene locus_tag LOCUS_24460 97662 96835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 98694 97717 gene locus_tag LOCUS_24470 98694 97717 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_24470 98803 99255 gene locus_tag LOCUS_24480 98803 99255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 99297 100835 gene locus_tag LOCUS_24490 99297 100835 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_24490 101027 102388 gene locus_tag LOCUS_24500 101027 102388 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963053.1 protein_id gnl|my_center|LOCUS_24500 102392 103942 gene locus_tag LOCUS_24510 102392 103942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963052.1 protein_id gnl|my_center|LOCUS_24510 104054 104926 gene locus_tag LOCUS_24520 104054 104926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 104970 106070 gene locus_tag LOCUS_24530 104970 106070 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_24530 106132 107154 gene locus_tag LOCUS_24540 gene bioB 106132 107154 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_24540 109066 107909 gene locus_tag LOCUS_24550 109066 107909 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_24550 110512 109094 gene locus_tag LOCUS_24560 110512 109094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 111367 110525 gene locus_tag LOCUS_24570 111367 110525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 112810 111380 gene locus_tag LOCUS_24580 112810 111380 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108730.1 protein_id gnl|my_center|LOCUS_24580 116313 112852 gene locus_tag LOCUS_24590 116313 112852 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303104.1 protein_id gnl|my_center|LOCUS_24590 117480 116458 gene locus_tag LOCUS_24600 117480 116458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 118165 117560 gene locus_tag LOCUS_24610 118165 117560 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762480.1 protein_id gnl|my_center|LOCUS_24610 118705 118286 gene locus_tag LOCUS_24620 gene aroQ 118705 118286 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_24620 119284 118724 gene locus_tag LOCUS_24630 119284 118724 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_24630 119700 119368 gene locus_tag LOCUS_24640 gene ytxJ 119700 119368 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_24640 120018 121391 gene locus_tag LOCUS_24650 120018 121391 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_24650 121394 122170 gene locus_tag LOCUS_24660 121394 122170 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_24660 122242 122967 gene locus_tag LOCUS_24670 122242 122967 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_24670 122977 123861 gene locus_tag LOCUS_24680 122977 123861 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_24680 123970 126798 gene locus_tag LOCUS_24690 123970 126798 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_24690 127245 127892 gene locus_tag LOCUS_24700 127245 127892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 127979 128446 gene locus_tag LOCUS_24710 127979 128446 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_24710 128443 129066 gene locus_tag LOCUS_24720 128443 129066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 129786 129067 gene locus_tag LOCUS_24730 129786 129067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 130036 130365 gene locus_tag LOCUS_24740 130036 130365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 131842 130487 gene locus_tag LOCUS_24750 131842 130487 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_24750 133102 131855 gene locus_tag LOCUS_24760 133102 131855 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_24760 133533 133099 gene locus_tag LOCUS_24770 133533 133099 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_24770 134055 133648 gene locus_tag LOCUS_24780 134055 133648 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_24780 134405 137473 gene locus_tag LOCUS_24790 134405 137473 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_24790 137482 139107 gene locus_tag LOCUS_24800 137482 139107 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_24800 139143 140063 gene locus_tag LOCUS_24810 139143 140063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 140349 141626 gene locus_tag LOCUS_24820 140349 141626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 142964 142062 gene locus_tag LOCUS_24830 gene rfbD 142964 142062 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_24830 145185 143032 gene locus_tag LOCUS_24840 145185 143032 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_24840 145467 146447 gene locus_tag LOCUS_24850 gene pfkA 145467 146447 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_24850 146458 147948 gene locus_tag LOCUS_24860 gene pyk 146458 147948 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_24860 149482 148295 gene locus_tag LOCUS_24870 149482 148295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963881.1 protein_id gnl|my_center|LOCUS_24870 149558 150913 gene locus_tag LOCUS_24880 149558 150913 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_24880 151311 152072 gene locus_tag LOCUS_24890 151311 152072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 152072 152872 gene locus_tag LOCUS_24900 152072 152872 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963745.1 protein_id gnl|my_center|LOCUS_24900 154035 152818 gene locus_tag LOCUS_24910 154035 152818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 154160 155668 gene locus_tag LOCUS_24920 154160 155668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 155655 155918 gene locus_tag LOCUS_24930 155655 155918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 156114 156539 gene locus_tag LOCUS_24940 156114 156539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 157559 156540 gene locus_tag LOCUS_24950 157559 156540 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_24950 159991 157607 gene locus_tag LOCUS_24960 159991 157607 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108155.1 protein_id gnl|my_center|LOCUS_24960 160185 161099 gene locus_tag LOCUS_24970 160185 161099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 163085 161166 gene locus_tag LOCUS_24980 gene dnaK 163085 161166 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_24980 163275 164651 gene locus_tag LOCUS_24990 163275 164651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 164766 165353 gene locus_tag LOCUS_25000 164766 165353 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_25000 165459 167390 gene locus_tag LOCUS_25010 gene argS 165459 167390 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_25010 168392 167448 gene locus_tag LOCUS_25020 168392 167448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 168977 168489 gene locus_tag LOCUS_25030 gene cdd 168977 168489 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_25030 170247 169084 gene locus_tag LOCUS_25040 gene lepB 170247 169084 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_25040 170414 171313 gene locus_tag LOCUS_25050 170414 171313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 172204 171548 gene locus_tag LOCUS_25060 172204 171548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_25060 173575 172391 gene locus_tag LOCUS_25070 173575 172391 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_25070 173673 174560 gene locus_tag LOCUS_25080 173673 174560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 174566 175450 gene locus_tag LOCUS_25090 gene cysM 174566 175450 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_25090 176794 175811 gene locus_tag LOCUS_25100 176794 175811 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_25100 178051 176879 gene locus_tag LOCUS_25110 178051 176879 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_25110 178172 180172 gene locus_tag LOCUS_25120 gene dnaG 178172 180172 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_25120 180678 180187 gene locus_tag LOCUS_25130 gene folA 180678 180187 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_25130 181469 180675 gene locus_tag LOCUS_25140 181469 180675 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_25140 182127 185090 gene locus_tag LOCUS_25150 182127 185090 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695755.1 protein_id gnl|my_center|LOCUS_25150 185116 186402 gene locus_tag LOCUS_25160 185116 186402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 187802 186624 gene locus_tag LOCUS_25170 187802 186624 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_25170 188007 188780 gene locus_tag LOCUS_25180 188007 188780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 189224 188889 gene locus_tag LOCUS_25190 189224 188889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 190265 189282 gene locus_tag LOCUS_25200 190265 189282 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_25200 192580 190421 gene locus_tag LOCUS_25210 gene recQ 192580 190421 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_25210 192770 193153 gene locus_tag LOCUS_25220 192770 193153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 194240 194932 gene locus_tag LOCUS_25230 194240 194932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 195464 194988 gene locus_tag LOCUS_25240 195464 194988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 196332 195631 gene locus_tag LOCUS_25250 196332 195631 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_25250 197552 196350 gene locus_tag LOCUS_25260 197552 196350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 199069 197549 gene locus_tag LOCUS_25270 199069 197549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 199143 200057 gene locus_tag LOCUS_25280 199143 200057 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_25280 200054 201100 gene locus_tag LOCUS_25290 200054 201100 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_25290 202287 201193 gene locus_tag LOCUS_25300 202287 201193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 203772 202336 gene locus_tag LOCUS_25310 203772 202336 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_25310 206916 203800 gene locus_tag LOCUS_25320 206916 203800 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_25320 208661 207165 gene locus_tag LOCUS_25330 208661 207165 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389097.1 protein_id gnl|my_center|LOCUS_25330 209955 208672 gene locus_tag LOCUS_25340 gene hemL 209955 208672 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_25340 211195 209969 gene locus_tag LOCUS_25350 211195 209969 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_25350 211986 211213 gene locus_tag LOCUS_25360 211986 211213 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969404.1 protein_id gnl|my_center|LOCUS_25360 213601 212183 gene locus_tag LOCUS_25370 213601 212183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 215110 213674 gene locus_tag LOCUS_25380 gene araE 215110 213674 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_25380 215195 216067 gene locus_tag LOCUS_25390 215195 216067 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_25390 218738 216273 gene locus_tag LOCUS_25400 218738 216273 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964026.1 protein_id gnl|my_center|LOCUS_25400 221070 218938 gene locus_tag LOCUS_25410 gene katE 221070 218938 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105396.1 protein_id gnl|my_center|LOCUS_25410 221293 221493 gene locus_tag LOCUS_25420 221293 221493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 222877 221633 gene locus_tag LOCUS_25430 222877 221633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 223117 223998 gene locus_tag LOCUS_25440 223117 223998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 224132 226021 gene locus_tag LOCUS_25450 224132 226021 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_25450 226098 226562 gene locus_tag LOCUS_25460 226098 226562 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833877.1 protein_id gnl|my_center|LOCUS_25460 226571 227086 gene locus_tag LOCUS_25470 226571 227086 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833874.1 protein_id gnl|my_center|LOCUS_25470 227104 227397 gene locus_tag LOCUS_25480 gene trxA 227104 227397 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_25480 227450 228337 gene locus_tag LOCUS_25490 227450 228337 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_25490 229330 228341 gene locus_tag LOCUS_25500 229330 228341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530808.1 protein_id gnl|my_center|LOCUS_25500 229968 235265 gene locus_tag LOCUS_25510 229968 235265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 236185 235376 gene locus_tag LOCUS_25520 236185 235376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 236360 236998 gene locus_tag LOCUS_25530 236360 236998 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_25530 237082 237921 gene locus_tag LOCUS_25540 237082 237921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 238018 238791 gene locus_tag LOCUS_25550 238018 238791 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107775.1 protein_id gnl|my_center|LOCUS_25550 238855 239727 gene locus_tag LOCUS_25560 238855 239727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 239775 240347 gene locus_tag LOCUS_25570 239775 240347 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_25570 240828 240400 gene locus_tag LOCUS_25580 240828 240400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 242164 241025 gene locus_tag LOCUS_25590 242164 241025 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_25590 244404 242161 gene locus_tag LOCUS_25600 244404 242161 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_25600 245496 244417 gene locus_tag LOCUS_25610 245496 244417 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_25610 247015 245510 gene locus_tag LOCUS_25620 247015 245510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 248327 247020 gene locus_tag LOCUS_25630 248327 247020 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109014.1 protein_id gnl|my_center|LOCUS_25630 248618 249385 gene locus_tag LOCUS_25640 248618 249385 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240990.1 protein_id gnl|my_center|LOCUS_25640 250281 249424 gene locus_tag LOCUS_25650 250281 249424 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_25650 250349 250690 gene locus_tag LOCUS_25660 250349 250690 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_25660 252060 250762 gene locus_tag LOCUS_25670 252060 250762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 252411 253595 gene locus_tag LOCUS_25680 252411 253595 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_25680 255466 253730 gene locus_tag LOCUS_25690 255466 253730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 255792 255463 gene locus_tag LOCUS_25700 255792 255463 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_25700 256349 255933 gene locus_tag LOCUS_25710 256349 255933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 258898 256439 gene locus_tag LOCUS_25720 258898 256439 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530098.1 protein_id gnl|my_center|LOCUS_25720 260099 259335 gene locus_tag LOCUS_25730 260099 259335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 260738 260369 gene locus_tag LOCUS_tm00010 260738 260369 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 262123 260777 gene locus_tag LOCUS_25740 gene rseP 262123 260777 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_25740 263330 262167 gene locus_tag LOCUS_25750 263330 262167 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_25750 264946 263447 gene locus_tag LOCUS_25760 264946 263447 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_25760 265267 265569 gene locus_tag LOCUS_25770 265267 265569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 265598 265876 gene locus_tag LOCUS_25780 gene rpmA 265598 265876 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_25780 265960 266297 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagaaagctgctcctaaaaa 266410 268110 gene locus_tag LOCUS_25790 266410 268110 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839088.1 protein_id gnl|my_center|LOCUS_25790 268112 268837 gene locus_tag LOCUS_25800 268112 268837 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_25800 270763 269849 gene locus_tag LOCUS_25810 270763 269849 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_25810 284332 270782 gene locus_tag LOCUS_25820 284332 270782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 284807 286135 gene locus_tag LOCUS_25830 gene ahcY 284807 286135 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_25830 286286 287017 gene locus_tag LOCUS_25840 286286 287017 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_25840 289096 287390 gene locus_tag LOCUS_25850 289096 287390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 289880 289110 gene locus_tag LOCUS_25860 289880 289110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_25860 290941 289916 gene locus_tag LOCUS_25870 gene porQ 290941 289916 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714810.1 protein_id gnl|my_center|LOCUS_25870 293550 291148 gene locus_tag LOCUS_25880 gene lon 293550 291148 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_25880 294371 293757 gene locus_tag LOCUS_25890 294371 293757 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_25890 295521 294520 gene locus_tag LOCUS_25900 295521 294520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 296768 295533 gene locus_tag LOCUS_25910 296768 295533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 297061 297747 gene locus_tag LOCUS_25920 297061 297747 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_25920 297791 298612 gene locus_tag LOCUS_25930 297791 298612 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_25930 298596 299504 gene locus_tag LOCUS_25940 298596 299504 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_25940 299602 300162 gene locus_tag LOCUS_25950 299602 300162 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_25950 300188 300904 gene locus_tag LOCUS_25960 gene dapB 300188 300904 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_25960 300986 301402 gene locus_tag LOCUS_25970 300986 301402 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_25970 302262 302948 gene locus_tag LOCUS_25980 302262 302948 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_25980 302970 303875 gene locus_tag LOCUS_25990 gene cysD 302970 303875 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_25990 303903 305150 gene locus_tag LOCUS_26000 303903 305150 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_26000 306843 305230 gene locus_tag LOCUS_26010 306843 305230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 307900 306944 gene locus_tag LOCUS_26020 307900 306944 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_26020 308119 308940 gene locus_tag LOCUS_26030 gene kdsA 308119 308940 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_26030 309079 309474 gene locus_tag LOCUS_26040 309079 309474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 310500 309691 gene locus_tag LOCUS_26050 310500 309691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 310844 310623 gene locus_tag LOCUS_26060 310844 310623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 310986 313256 gene locus_tag LOCUS_26070 310986 313256 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_26070 313373 313972 gene locus_tag LOCUS_26080 313373 313972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_26080 314980 313967 gene locus_tag LOCUS_26090 314980 313967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 315536 315048 gene locus_tag LOCUS_26100 315536 315048 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_26100 316552 315554 gene locus_tag LOCUS_26110 gene hutG 316552 315554 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704354.1 protein_id gnl|my_center|LOCUS_26110 317800 316598 gene locus_tag LOCUS_26120 gene hutI 317800 316598 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887560.1 protein_id gnl|my_center|LOCUS_26120 319493 317820 gene locus_tag LOCUS_26130 gene hutU 319493 317820 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243634.1 protein_id gnl|my_center|LOCUS_26130 321089 319521 gene locus_tag LOCUS_26140 gene hutH 321089 319521 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838340.1 protein_id gnl|my_center|LOCUS_26140 321592 321086 gene locus_tag LOCUS_26150 321592 321086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 322058 321669 gene locus_tag LOCUS_26160 322058 321669 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_26160 322148 323029 gene locus_tag LOCUS_26170 322148 323029 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_26170 323060 324436 gene locus_tag LOCUS_26180 gene mgtE 323060 324436 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_26180 324985 324443 gene locus_tag LOCUS_26190 324985 324443 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_26190 325068 327434 gene locus_tag LOCUS_26200 325068 327434 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_26200 327485 331066 gene locus_tag LOCUS_26210 327485 331066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 332390 331158 gene locus_tag LOCUS_26220 332390 331158 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117973.1 protein_id gnl|my_center|LOCUS_26220 332787 332446 gene locus_tag LOCUS_26230 332787 332446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 333310 332831 gene locus_tag LOCUS_26240 333310 332831 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_26240 333528 335432 gene locus_tag LOCUS_26250 gene glmS 333528 335432 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_26250 335440 337608 gene locus_tag LOCUS_26260 335440 337608 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682106.1 protein_id gnl|my_center|LOCUS_26260 337596 338168 gene locus_tag LOCUS_26270 337596 338168 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_26270 338699 338295 gene locus_tag LOCUS_26280 338699 338295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 339868 338825 gene locus_tag LOCUS_26290 339868 338825 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_26290 340578 339865 gene locus_tag LOCUS_26300 340578 339865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 341950 340697 gene locus_tag LOCUS_26310 gene fucP 341950 340697 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_26310 342770 341988 gene locus_tag LOCUS_26320 342770 341988 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_26320 343615 342785 gene locus_tag LOCUS_26330 343615 342785 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_26330 343977 343648 gene locus_tag LOCUS_26340 343977 343648 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039139.1 protein_id gnl|my_center|LOCUS_26340 344836 343982 gene locus_tag LOCUS_26350 344836 343982 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_26350 345586 344846 gene locus_tag LOCUS_26360 345586 344846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 346372 345590 gene locus_tag LOCUS_26370 346372 345590 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083078.1 protein_id gnl|my_center|LOCUS_26370 346488 347162 gene locus_tag LOCUS_26380 346488 347162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 347197 348030 gene locus_tag LOCUS_26390 347197 348030 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_26390 350126 348435 gene locus_tag LOCUS_26400 350126 348435 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_26400 353065 350147 gene locus_tag LOCUS_26410 353065 350147 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_26410 355111 353663 gene locus_tag LOCUS_26420 355111 353663 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_26420 358111 355130 gene locus_tag LOCUS_26430 358111 355130 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202099.1 protein_id gnl|my_center|LOCUS_26430 360205 358700 gene locus_tag LOCUS_26440 360205 358700 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_26440 361304 360225 gene locus_tag LOCUS_26450 gene leuB 361304 360225 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_26450 361912 361313 gene locus_tag LOCUS_26460 gene leuD 361912 361313 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_26460 363367 361934 gene locus_tag LOCUS_26470 gene leuC 363367 361934 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_26470 363577 365130 gene locus_tag LOCUS_26480 363577 365130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_26480 366858 365194 gene locus_tag LOCUS_26490 366858 365194 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_26490 370317 366883 gene locus_tag LOCUS_26500 370317 366883 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_26500 371562 370498 gene locus_tag LOCUS_26510 371562 370498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 372211 371651 gene locus_tag LOCUS_26520 372211 371651 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_26520 373089 374060 gene locus_tag LOCUS_26530 373089 374060 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_26530 374123 376492 gene locus_tag LOCUS_26540 374123 376492 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_26540 376709 377311 gene locus_tag LOCUS_26550 376709 377311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 377693 378955 gene locus_tag LOCUS_26560 377693 378955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 380323 379274 gene locus_tag LOCUS_26570 380323 379274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 380857 380390 gene locus_tag LOCUS_26580 380857 380390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 381447 380854 gene locus_tag LOCUS_26590 gene trmH 381447 380854 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_26590 381544 384255 gene locus_tag LOCUS_26600 381544 384255 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_26600 384304 384708 gene locus_tag LOCUS_26610 384304 384708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 385618 384713 gene locus_tag LOCUS_26620 385618 384713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 385717 386427 gene locus_tag LOCUS_26630 385717 386427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 387545 386646 gene locus_tag LOCUS_26640 gene lipA 387545 386646 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_26640 388414 387575 gene locus_tag LOCUS_26650 388414 387575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 388565 388972 gene locus_tag LOCUS_26660 388565 388972 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_26660 390371 389022 gene locus_tag LOCUS_26670 390371 389022 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_26670 390821 391999 gene locus_tag LOCUS_26680 390821 391999 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_26680 392002 393186 gene locus_tag LOCUS_26690 392002 393186 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547725.1 protein_id gnl|my_center|LOCUS_26690 393356 394177 gene locus_tag LOCUS_26700 393356 394177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 395226 394420 gene locus_tag LOCUS_26710 395226 394420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 395923 395354 gene locus_tag LOCUS_26720 395923 395354 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_26720 396866 395925 gene locus_tag LOCUS_26730 396866 395925 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_26730 397457 396894 gene locus_tag LOCUS_26740 397457 396894 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_26740 398247 397486 gene locus_tag LOCUS_26750 398247 397486 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_26750 398458 400809 gene locus_tag LOCUS_26760 gene topA 398458 400809 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_26760 400854 401723 gene locus_tag LOCUS_26770 400854 401723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 402643 401801 gene locus_tag LOCUS_26780 402643 401801 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_26780 403382 402738 gene locus_tag LOCUS_26790 gene plsY 403382 402738 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_26790 404322 403501 gene locus_tag LOCUS_26800 gene prmA 404322 403501 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_26800 404425 405000 gene locus_tag LOCUS_26810 404425 405000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 407441 405087 gene locus_tag LOCUS_26820 gene pnp 407441 405087 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_26820 407800 407528 gene locus_tag LOCUS_26830 gene rpsO 407800 407528 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_26830 408606 407914 gene locus_tag LOCUS_26840 408606 407914 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_26840 408871 409242 gene locus_tag LOCUS_26850 408871 409242 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813773.1 protein_id gnl|my_center|LOCUS_26850 409239 410546 gene locus_tag LOCUS_26860 409239 410546 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_26860 411615 411854 gene locus_tag LOCUS_26870 411615 411854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 413326 412118 gene locus_tag LOCUS_26880 413326 412118 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_26880 413393 414325 gene locus_tag LOCUS_26890 413393 414325 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_26890 415312 414314 gene locus_tag LOCUS_26900 gene holA 415312 414314 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_26900 416059 415334 gene locus_tag LOCUS_26910 416059 415334 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_26910 416167 417129 gene locus_tag LOCUS_26920 416167 417129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 417331 417792 gene locus_tag LOCUS_26930 417331 417792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 419527 417887 gene locus_tag LOCUS_26940 419527 417887 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_26940 419666 420232 gene locus_tag LOCUS_26950 419666 420232 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223369.1 protein_id gnl|my_center|LOCUS_26950 422372 420318 gene locus_tag LOCUS_26960 422372 420318 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_26960 423908 422520 gene locus_tag LOCUS_26970 423908 422520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 424891 424148 gene locus_tag LOCUS_26980 424891 424148 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_26980 426894 424921 gene locus_tag LOCUS_26990 426894 424921 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_26990 427592 426906 gene locus_tag LOCUS_27000 427592 426906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 428260 427697 gene locus_tag LOCUS_27010 428260 427697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 429134 428283 gene locus_tag LOCUS_27020 gene murQ 429134 428283 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_27020 429954 429100 gene locus_tag LOCUS_27030 429954 429100 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_27030 430069 431676 gene locus_tag LOCUS_27040 430069 431676 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_27040 432495 432097 gene locus_tag LOCUS_27050 432495 432097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 433119 432577 gene locus_tag LOCUS_27060 433119 432577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 433450 433226 gene locus_tag LOCUS_27070 433450 433226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 433774 433568 gene locus_tag LOCUS_27080 433774 433568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 435168 433855 gene locus_tag LOCUS_27090 gene der 435168 433855 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_27090 436067 435195 gene locus_tag LOCUS_27100 gene era 436067 435195 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_27100 436341 436269 gene locus_tag LOCUS_t00240 436341 436269 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 437470 437398 gene locus_tag LOCUS_t00250 437470 437398 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 437777 437705 gene locus_tag LOCUS_t00260 437777 437705 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 438575 438156 gene locus_tag LOCUS_27110 438575 438156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 438927 441335 gene locus_tag LOCUS_27120 438927 441335 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_27120 442396 441389 gene locus_tag LOCUS_27130 442396 441389 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918523.1 protein_id gnl|my_center|LOCUS_27130 442541 442915 gene locus_tag LOCUS_27140 442541 442915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 444317 442986 gene locus_tag LOCUS_27150 gene argH 444317 442986 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_27150 444909 444331 gene locus_tag LOCUS_27160 444909 444331 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402586.1 protein_id gnl|my_center|LOCUS_27160 445988 444915 gene locus_tag LOCUS_27170 445988 444915 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_27170 446790 445993 gene locus_tag LOCUS_27180 gene argB 446790 445993 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_27180 447743 446790 gene locus_tag LOCUS_27190 447743 446790 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_27190 448879 447743 gene locus_tag LOCUS_27200 448879 447743 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_27200 449873 448899 gene locus_tag LOCUS_27210 gene argC 449873 448899 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_27210 451074 449878 gene locus_tag LOCUS_27220 451074 449878 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_27220 451906 451124 gene locus_tag LOCUS_27230 451906 451124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 454330 452303 gene locus_tag LOCUS_27240 454330 452303 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100235.1 protein_id gnl|my_center|LOCUS_27240 454594 455949 gene locus_tag LOCUS_27250 454594 455949 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_27250 456328 459243 gene locus_tag LOCUS_27260 456328 459243 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_27260 459265 460584 gene locus_tag LOCUS_27270 459265 460584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 460672 466104 gene locus_tag LOCUS_27280 460672 466104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 466150 467250 gene locus_tag LOCUS_27290 gene porV 466150 467250 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_27290 468487 467321 gene locus_tag LOCUS_27300 gene galK 468487 467321 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_27300 470163 468853 gene locus_tag LOCUS_27310 470163 468853 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_27310 470369 471997 gene locus_tag LOCUS_27320 470369 471997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963720.1 protein_id gnl|my_center|LOCUS_27320 471969 472934 gene locus_tag LOCUS_27330 471969 472934 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_27330 472958 474001 gene locus_tag LOCUS_27340 472958 474001 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_27340 474080 474838 gene locus_tag LOCUS_27350 474080 474838 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_27350 475088 475933 gene locus_tag LOCUS_27360 475088 475933 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784150.1 protein_id gnl|my_center|LOCUS_27360 476076 476768 gene locus_tag LOCUS_27370 476076 476768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 476960 479887 gene locus_tag LOCUS_27380 476960 479887 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_27380 479925 480878 gene locus_tag LOCUS_27390 479925 480878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 480885 483182 gene locus_tag LOCUS_27400 480885 483182 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_27400 483725 483315 gene locus_tag LOCUS_27410 483725 483315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 483980 485905 gene locus_tag LOCUS_27420 483980 485905 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_27420 486029 487402 gene locus_tag LOCUS_27430 486029 487402 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_27430 487417 487899 gene locus_tag LOCUS_27440 487417 487899 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003091.1 protein_id gnl|my_center|LOCUS_27440 487907 488584 gene locus_tag LOCUS_27450 487907 488584 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_27450 488588 489559 gene locus_tag LOCUS_27460 488588 489559 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_27460 490574 489552 gene locus_tag LOCUS_27470 gene murB 490574 489552 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770641.1 protein_id gnl|my_center|LOCUS_27470 490626 491270 gene locus_tag LOCUS_27480 490626 491270 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_27480 493718 491274 gene locus_tag LOCUS_27490 gene priA 493718 491274 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963958.1 protein_id gnl|my_center|LOCUS_27490 494479 493715 gene locus_tag LOCUS_27500 494479 493715 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_27500 494673 495875 gene locus_tag LOCUS_27510 gene mtaB 494673 495875 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_27510 497462 495894 gene locus_tag LOCUS_27520 497462 495894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 499074 497581 gene locus_tag LOCUS_27530 499074 497581 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_27530 502500 499102 gene locus_tag LOCUS_27540 502500 499102 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_27540 503849 502716 gene locus_tag LOCUS_27550 503849 502716 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_27550 504510 503941 gene locus_tag LOCUS_27560 504510 503941 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_27560 504752 504827 gene locus_tag LOCUS_t00270 504752 504827 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 505092 505868 gene locus_tag LOCUS_27570 505092 505868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 507135 506470 gene locus_tag LOCUS_27580 507135 506470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 507762 507837 gene locus_tag LOCUS_t00280 507762 507837 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 507904 508245 gene locus_tag LOCUS_27590 507904 508245 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809460.1 protein_id gnl|my_center|LOCUS_27590 508475 511498 gene locus_tag LOCUS_27600 508475 511498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 513732 511570 gene locus_tag LOCUS_27610 513732 511570 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926991.1 protein_id gnl|my_center|LOCUS_27610 513866 514171 gene locus_tag LOCUS_27620 513866 514171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 514172 514819 gene locus_tag LOCUS_27630 gene aat 514172 514819 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546338.1 protein_id gnl|my_center|LOCUS_27630 515737 514826 gene locus_tag LOCUS_27640 515737 514826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 515848 516507 gene locus_tag LOCUS_27650 515848 516507 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_27650 516517 518397 gene locus_tag LOCUS_27660 516517 518397 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962257.1 protein_id gnl|my_center|LOCUS_27660 518413 518814 gene locus_tag LOCUS_27670 518413 518814 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228335.1 protein_id gnl|my_center|LOCUS_27670 519561 518830 gene locus_tag LOCUS_27680 519561 518830 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_27680 520603 519536 gene locus_tag LOCUS_27690 520603 519536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 520976 520623 gene locus_tag LOCUS_27700 520976 520623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 521779 521060 gene locus_tag LOCUS_27710 521779 521060 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_27710 522587 521904 gene locus_tag LOCUS_27720 522587 521904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 522684 523949 gene locus_tag LOCUS_27730 gene icd 522684 523949 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 protein_id gnl|my_center|LOCUS_27730 524124 525356 gene locus_tag LOCUS_27740 524124 525356 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963977.1 protein_id gnl|my_center|LOCUS_27740 526189 525485 gene locus_tag LOCUS_27750 526189 525485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 527407 526208 gene locus_tag LOCUS_27760 527407 526208 CDS product DUF5000 domain-containing lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767203.1 protein_id gnl|my_center|LOCUS_27760 529342 527444 gene locus_tag LOCUS_27770 529342 527444 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767188.1 protein_id gnl|my_center|LOCUS_27770 532487 529362 gene locus_tag LOCUS_27780 532487 529362 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765284.1 protein_id gnl|my_center|LOCUS_27780 532883 533764 gene locus_tag LOCUS_27790 532883 533764 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_27790 533868 534983 gene locus_tag LOCUS_27800 533868 534983 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_27800 535847 535077 gene locus_tag LOCUS_27810 535847 535077 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_27810 536869 535844 gene locus_tag LOCUS_27820 536869 535844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 539221 536888 gene locus_tag LOCUS_27830 539221 536888 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_27830 540969 539311 gene locus_tag LOCUS_27840 540969 539311 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_27840 542572 541196 gene locus_tag LOCUS_27850 542572 541196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088844313.1 protein_id gnl|my_center|LOCUS_27850 542832 543551 gene locus_tag LOCUS_27860 542832 543551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 543941 543558 gene locus_tag LOCUS_27870 543941 543558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 543849 545996 gene locus_tag LOCUS_27880 543849 545996 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_27880 546086 546238 gene locus_tag LOCUS_27890 546086 546238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 546251 548377 gene locus_tag LOCUS_27900 gene ccoN 546251 548377 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_27900 548383 548562 gene locus_tag LOCUS_27910 548383 548562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 548543 549649 gene locus_tag LOCUS_27920 548543 549649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 549666 551051 gene locus_tag LOCUS_27930 gene ccoG 549666 551051 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_27930 551065 551502 gene locus_tag LOCUS_27940 551065 551502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 551499 552200 gene locus_tag LOCUS_27950 551499 552200 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_27950 552207 553565 gene locus_tag LOCUS_27960 gene hemN 552207 553565 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_27960 554135 553566 gene locus_tag LOCUS_27970 554135 553566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 555003 554137 gene locus_tag LOCUS_27980 555003 554137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 555609 555013 gene locus_tag LOCUS_27990 555609 555013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 556023 555637 gene locus_tag LOCUS_28000 556023 555637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 558070 556058 gene locus_tag LOCUS_28010 558070 556058 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_28010 558886 558074 gene locus_tag LOCUS_28020 558886 558074 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_28020 559003 560217 gene locus_tag LOCUS_28030 gene sucC 559003 560217 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_28030 560451 560227 gene locus_tag LOCUS_28040 560451 560227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 560500 561504 gene locus_tag LOCUS_28050 560500 561504 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_28050 561555 561965 gene locus_tag LOCUS_28060 561555 561965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 562525 563436 gene locus_tag LOCUS_28070 562525 563436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 564462 563827 gene locus_tag LOCUS_28080 564462 563827 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_28080 564864 564466 gene locus_tag LOCUS_28090 564864 564466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 565084 564854 gene locus_tag LOCUS_28100 565084 564854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 565496 565044 gene locus_tag LOCUS_28110 565496 565044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 565945 565550 gene locus_tag LOCUS_28120 565945 565550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 566185 569148 gene locus_tag LOCUS_28130 566185 569148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 569250 571685 gene locus_tag LOCUS_28140 569250 571685 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_28140 572699 571776 gene locus_tag LOCUS_28150 572699 571776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 574600 572759 gene locus_tag LOCUS_28160 gene yidC 574600 572759 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964004.1 protein_id gnl|my_center|LOCUS_28160 576375 574720 gene locus_tag LOCUS_28170 576375 574720 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_28170 576677 577189 gene locus_tag LOCUS_28180 576677 577189 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_28180 577284 577901 gene locus_tag LOCUS_28190 577284 577901 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510899.1 protein_id gnl|my_center|LOCUS_28190 578540 577956 gene locus_tag LOCUS_28200 578540 577956 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_28200 579334 578558 gene locus_tag LOCUS_28210 gene cobA 579334 578558 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_28210 581482 579365 gene locus_tag LOCUS_28220 581482 579365 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_28220 582332 582541 gene locus_tag LOCUS_28230 582332 582541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 582631 583290 gene locus_tag LOCUS_28240 gene hxpB 582631 583290 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_28240 583724 583326 gene locus_tag LOCUS_28250 583724 583326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 584154 583693 gene locus_tag LOCUS_28260 584154 583693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 586751 584355 gene locus_tag LOCUS_28270 586751 584355 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_28270 588613 587072 gene locus_tag LOCUS_28280 588613 587072 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_28280 591802 588623 gene locus_tag LOCUS_28290 591802 588623 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106605886.1 protein_id gnl|my_center|LOCUS_28290 594742 592844 gene locus_tag LOCUS_28300 gene rpsA 594742 592844 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_28300 594928 595827 gene locus_tag LOCUS_28310 594928 595827 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_28310 595900 597588 gene locus_tag LOCUS_28320 595900 597588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 597867 599093 gene locus_tag LOCUS_28330 597867 599093 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_28330 600110 599349 gene locus_tag LOCUS_28340 600110 599349 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_28340 602028 600127 gene locus_tag LOCUS_28350 602028 600127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 603339 602650 gene locus_tag LOCUS_28360 gene cmk 603339 602650 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_28360 605020 603428 gene locus_tag LOCUS_28370 605020 603428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 606644 605034 gene locus_tag LOCUS_28380 606644 605034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 608512 606710 gene locus_tag LOCUS_28390 608512 606710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 611322 608791 gene locus_tag LOCUS_28400 611322 608791 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_28400 611559 611954 gene locus_tag LOCUS_28410 611559 611954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 611972 612880 gene locus_tag LOCUS_28420 611972 612880 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_28420 612953 613813 gene locus_tag LOCUS_28430 612953 613813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 615229 614348 gene locus_tag LOCUS_28440 gene dapA 615229 614348 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_28440 616275 615322 gene locus_tag LOCUS_28450 616275 615322 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_28450 617047 616424 gene locus_tag LOCUS_28460 617047 616424 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_28460 618306 617044 gene locus_tag LOCUS_28470 gene kynU 618306 617044 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_28470 619509 618337 gene locus_tag LOCUS_28480 619509 618337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 620512 619703 gene locus_tag LOCUS_28490 620512 619703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 621180 620617 gene locus_tag LOCUS_28500 621180 620617 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_28500 621831 622574 gene locus_tag LOCUS_28510 gene ric 621831 622574 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941513.1 protein_id gnl|my_center|LOCUS_28510 622899 623399 gene locus_tag LOCUS_28520 622899 623399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 623429 625408 gene locus_tag LOCUS_28530 gene nosZ 623429 625408 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_28530 625468 626055 gene locus_tag LOCUS_28540 625468 626055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_28540 626052 626465 gene locus_tag LOCUS_28550 626052 626465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 626462 627688 gene locus_tag LOCUS_28560 626462 627688 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_28560 627676 628413 gene locus_tag LOCUS_28570 627676 628413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 628382 629149 gene locus_tag LOCUS_28580 628382 629149 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083150.1 protein_id gnl|my_center|LOCUS_28580 629658 629158 gene locus_tag LOCUS_28590 629658 629158 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_28590 630064 629639 gene locus_tag LOCUS_28600 630064 629639 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_28600 630210 631994 gene locus_tag LOCUS_28610 630210 631994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 632204 632728 gene locus_tag LOCUS_28620 632204 632728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 633691 632822 gene locus_tag LOCUS_28630 633691 632822 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_28630 635549 633921 gene locus_tag LOCUS_28640 635549 633921 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_28640 636473 635583 gene locus_tag LOCUS_28650 636473 635583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 636593 637621 gene locus_tag LOCUS_28660 636593 637621 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_28660 637702 637881 gene locus_tag LOCUS_28670 637702 637881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 638830 638078 gene locus_tag LOCUS_28680 638830 638078 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_28680 640755 638842 gene locus_tag LOCUS_28690 640755 638842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 641037 641882 gene locus_tag LOCUS_28700 641037 641882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 641888 644560 gene locus_tag LOCUS_28710 641888 644560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 645079 644762 gene locus_tag LOCUS_28720 645079 644762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 646276 645515 gene locus_tag LOCUS_28730 646276 645515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 646632 648053 gene locus_tag LOCUS_28740 646632 648053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 648905 648192 gene locus_tag LOCUS_28750 648905 648192 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762597.1 protein_id gnl|my_center|LOCUS_28750 649610 648912 gene locus_tag LOCUS_28760 649610 648912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 650819 649743 gene locus_tag LOCUS_28770 650819 649743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 651694 650939 gene locus_tag LOCUS_28780 651694 650939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence18 812 1681 gene locus_tag LOCUS_28790 812 1681 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_28790 1686 2126 gene locus_tag LOCUS_28800 1686 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098264.1 protein_id gnl|my_center|LOCUS_28800 2238 6335 gene locus_tag LOCUS_28810 2238 6335 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_28810 6428 7843 gene locus_tag LOCUS_28820 6428 7843 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797085.1 protein_id gnl|my_center|LOCUS_28820 9450 7897 gene locus_tag LOCUS_28830 9450 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 9977 9549 gene locus_tag LOCUS_28840 9977 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 10296 11117 gene locus_tag LOCUS_28850 10296 11117 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 protein_id gnl|my_center|LOCUS_28850 12786 11206 gene locus_tag LOCUS_28860 12786 11206 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_28860 15858 12805 gene locus_tag LOCUS_28870 15858 12805 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789829.1 protein_id gnl|my_center|LOCUS_28870 16336 17100 gene locus_tag LOCUS_28880 16336 17100 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256693.1 protein_id gnl|my_center|LOCUS_28880 17136 17615 gene locus_tag LOCUS_28890 17136 17615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 18214 18705 gene locus_tag LOCUS_28900 18214 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 20360 19248 gene locus_tag LOCUS_28910 20360 19248 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_28910 20833 20360 gene locus_tag LOCUS_28920 20833 20360 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_28920 21322 20843 gene locus_tag LOCUS_28930 21322 20843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 21496 22797 gene locus_tag LOCUS_28940 21496 22797 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_28940 23157 24686 gene locus_tag LOCUS_28950 23157 24686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 24739 25176 gene locus_tag LOCUS_28960 24739 25176 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622221.1 protein_id gnl|my_center|LOCUS_28960 25766 25233 gene locus_tag LOCUS_28970 25766 25233 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896302.1 protein_id gnl|my_center|LOCUS_28970 27660 25915 gene locus_tag LOCUS_28980 27660 25915 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764315.1 protein_id gnl|my_center|LOCUS_28980 30749 27675 gene locus_tag LOCUS_28990 30749 27675 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760974.1 protein_id gnl|my_center|LOCUS_28990 32471 30768 gene locus_tag LOCUS_29000 32471 30768 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_29000 35437 32471 gene locus_tag LOCUS_29010 35437 32471 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764316.1 protein_id gnl|my_center|LOCUS_29010 36054 36944 gene locus_tag LOCUS_29020 36054 36944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 37693 37178 gene locus_tag LOCUS_29030 gene ftnA 37693 37178 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693978.1 protein_id gnl|my_center|LOCUS_29030 38574 37747 gene locus_tag LOCUS_29040 gene murI 38574 37747 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108947.1 protein_id gnl|my_center|LOCUS_29040 39998 38583 gene locus_tag LOCUS_29050 39998 38583 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361309.1 protein_id gnl|my_center|LOCUS_29050 41148 39988 gene locus_tag LOCUS_29060 41148 39988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263436.1 protein_id gnl|my_center|LOCUS_29060 42307 41123 gene locus_tag LOCUS_29070 42307 41123 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107545.1 protein_id gnl|my_center|LOCUS_29070 43293 42304 gene locus_tag LOCUS_29080 gene hlyD 43293 42304 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976400.1 protein_id gnl|my_center|LOCUS_29080 44711 43290 gene locus_tag LOCUS_29090 44711 43290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 44855 45280 gene locus_tag LOCUS_29100 44855 45280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 48602 45681 gene locus_tag LOCUS_29110 48602 45681 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_29110 49605 48700 gene locus_tag LOCUS_29120 49605 48700 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_29120 50150 49638 gene locus_tag LOCUS_29130 50150 49638 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284980.1 protein_id gnl|my_center|LOCUS_29130 50279 50755 gene locus_tag LOCUS_29140 50279 50755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 50886 52307 gene locus_tag LOCUS_29150 gene glgA 50886 52307 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697284.1 protein_id gnl|my_center|LOCUS_29150 52319 53590 gene locus_tag LOCUS_29160 52319 53590 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_29160 53623 55086 gene locus_tag LOCUS_29170 53623 55086 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_29170 56132 55083 gene locus_tag LOCUS_29180 56132 55083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 58406 56133 gene locus_tag LOCUS_29190 58406 56133 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_29190 58606 60219 gene locus_tag LOCUS_29200 gene bshC 58606 60219 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_29200 62455 60224 gene locus_tag LOCUS_29210 62455 60224 CDS product FUSC family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534567.1 protein_id gnl|my_center|LOCUS_29210 62832 66362 gene locus_tag LOCUS_29220 gene smc 62832 66362 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092731919.1 protein_id gnl|my_center|LOCUS_29220 66463 67953 gene locus_tag LOCUS_29230 66463 67953 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_29230 68468 70756 gene locus_tag LOCUS_29240 68468 70756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 71483 70761 gene locus_tag LOCUS_29250 71483 70761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 71622 72257 gene locus_tag LOCUS_29260 71622 72257 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_29260 72803 72258 gene locus_tag LOCUS_29270 72803 72258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 74072 72891 gene locus_tag LOCUS_29280 gene mqnE 74072 72891 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_29280 76186 74069 gene locus_tag LOCUS_29290 76186 74069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 77954 76320 gene locus_tag LOCUS_29300 77954 76320 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_29300 78089 80776 gene locus_tag LOCUS_29310 78089 80776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 81167 80850 gene locus_tag LOCUS_29320 gene trxA 81167 80850 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932522.1 protein_id gnl|my_center|LOCUS_29320 84928 81290 gene locus_tag LOCUS_29330 gene dnaE 84928 81290 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_29330 85095 85697 gene locus_tag LOCUS_29340 85095 85697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 86493 85690 gene locus_tag LOCUS_29350 86493 85690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 86658 87512 gene locus_tag LOCUS_29360 86658 87512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 88985 87501 gene locus_tag LOCUS_29370 88985 87501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 89106 91781 gene locus_tag LOCUS_29380 89106 91781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 91831 92667 gene locus_tag LOCUS_29390 91831 92667 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122211.1 protein_id gnl|my_center|LOCUS_29390 92674 93495 gene locus_tag LOCUS_29400 92674 93495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 93488 94648 gene locus_tag LOCUS_29410 93488 94648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 94650 95561 gene locus_tag LOCUS_29420 94650 95561 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_29420 98173 95687 gene locus_tag LOCUS_29430 98173 95687 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_29430 98316 98519 gene locus_tag LOCUS_29440 98316 98519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 98516 99310 gene locus_tag LOCUS_29450 98516 99310 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_29450 99321 99770 gene locus_tag LOCUS_29460 99321 99770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 100705 99767 gene locus_tag LOCUS_29470 100705 99767 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_29470 101529 100750 gene locus_tag LOCUS_29480 gene dapF 101529 100750 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_29480 102438 101563 gene locus_tag LOCUS_29490 102438 101563 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947145.1 protein_id gnl|my_center|LOCUS_29490 102544 102615 gene locus_tag LOCUS_t00290 102544 102615 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 103656 104156 gene locus_tag LOCUS_29500 103656 104156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 104302 104215 gene locus_tag LOCUS_t00300 104302 104215 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 104527 104450 gene locus_tag LOCUS_t00310 104527 104450 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 105363 104833 gene locus_tag LOCUS_29510 105363 104833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 106893 105367 gene locus_tag LOCUS_29520 106893 105367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 110060 106905 gene locus_tag LOCUS_29530 110060 106905 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202056.1 protein_id gnl|my_center|LOCUS_29530 111623 110466 gene locus_tag LOCUS_29540 111623 110466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 112269 111694 gene locus_tag LOCUS_29550 112269 111694 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_29550 113094 112354 gene locus_tag LOCUS_29560 113094 112354 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_29560 114386 113100 gene locus_tag LOCUS_29570 114386 113100 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_29570 115948 114446 gene locus_tag LOCUS_29580 115948 114446 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_29580 117047 115953 gene locus_tag LOCUS_29590 117047 115953 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_29590 117203 118045 gene locus_tag LOCUS_29600 117203 118045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 118749 119294 gene locus_tag LOCUS_29610 118749 119294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 119435 119866 gene locus_tag LOCUS_29620 119435 119866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 123162 119932 gene locus_tag LOCUS_29630 123162 119932 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_29630 123558 123259 gene locus_tag LOCUS_29640 123558 123259 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404552.1 protein_id gnl|my_center|LOCUS_29640 124379 123555 gene locus_tag LOCUS_29650 124379 123555 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_29650 125305 124502 gene locus_tag LOCUS_29660 125305 124502 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_29660 126766 125624 gene locus_tag LOCUS_29670 126766 125624 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_29670 131156 126795 gene locus_tag LOCUS_29680 131156 126795 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_29680 132853 131621 gene locus_tag LOCUS_29690 132853 131621 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230612.1 protein_id gnl|my_center|LOCUS_29690 133199 132846 gene locus_tag LOCUS_29700 133199 132846 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_29700 134964 137936 gene locus_tag LOCUS_29710 134964 137936 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766187.1 protein_id gnl|my_center|LOCUS_29710 137936 139438 gene locus_tag LOCUS_29720 137936 139438 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766186.1 protein_id gnl|my_center|LOCUS_29720 139450 141072 gene locus_tag LOCUS_29730 139450 141072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 141084 142145 gene locus_tag LOCUS_29740 141084 142145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 142202 145411 gene locus_tag LOCUS_29750 142202 145411 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766183.1 protein_id gnl|my_center|LOCUS_29750 145430 146926 gene locus_tag LOCUS_29760 145430 146926 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766182.1 protein_id gnl|my_center|LOCUS_29760 146967 147650 gene locus_tag LOCUS_29770 146967 147650 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766181.1 protein_id gnl|my_center|LOCUS_29770 147643 149271 gene locus_tag LOCUS_29780 147643 149271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 150620 149319 gene locus_tag LOCUS_29790 150620 149319 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_29790 151194 150787 gene locus_tag LOCUS_29800 151194 150787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974119.1 protein_id gnl|my_center|LOCUS_29800 151559 151206 gene locus_tag LOCUS_29810 151559 151206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 151735 152403 gene locus_tag LOCUS_29820 151735 152403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 152807 155197 gene locus_tag LOCUS_29830 152807 155197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 155288 156565 gene locus_tag LOCUS_29840 155288 156565 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_29840 156907 156545 gene locus_tag LOCUS_29850 156907 156545 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097074.1 protein_id gnl|my_center|LOCUS_29850 157914 156991 gene locus_tag LOCUS_29860 157914 156991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 158515 157919 gene locus_tag LOCUS_29870 gene cobC 158515 157919 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_29870 159923 158508 gene locus_tag LOCUS_29880 159923 158508 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393138.1 protein_id gnl|my_center|LOCUS_29880 161394 159949 gene locus_tag LOCUS_29890 161394 159949 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399436.1 protein_id gnl|my_center|LOCUS_29890 162394 161387 gene locus_tag LOCUS_29900 162394 161387 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967372.1 protein_id gnl|my_center|LOCUS_29900 163652 162396 gene locus_tag LOCUS_29910 163652 162396 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991765.1 protein_id gnl|my_center|LOCUS_29910 163880 164644 gene locus_tag LOCUS_29920 163880 164644 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532952.1 protein_id gnl|my_center|LOCUS_29920 164908 166893 gene locus_tag LOCUS_29930 164908 166893 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_29930 166989 168944 gene locus_tag LOCUS_29940 166989 168944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 168951 170936 gene locus_tag LOCUS_29950 168951 170936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 171453 174440 gene locus_tag LOCUS_29960 171453 174440 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_29960 174452 176182 gene locus_tag LOCUS_29970 174452 176182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 176393 178114 gene locus_tag LOCUS_29980 176393 178114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_29980 178164 178478 gene locus_tag LOCUS_29990 178164 178478 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_29990 179533 179003 gene locus_tag LOCUS_30000 179533 179003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 179613 180047 gene locus_tag LOCUS_30010 179613 180047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 181089 180052 gene locus_tag LOCUS_30020 gene dusB 181089 180052 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_30020 181844 181113 gene locus_tag LOCUS_30030 181844 181113 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_30030 182437 181862 gene locus_tag LOCUS_30040 182437 181862 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963990.1 protein_id gnl|my_center|LOCUS_30040 183250 182456 gene locus_tag LOCUS_30050 183250 182456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 183399 184940 gene locus_tag LOCUS_30060 183399 184940 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_30060 185146 187572 gene locus_tag LOCUS_30070 185146 187572 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_30070 187615 190275 gene locus_tag LOCUS_30080 187615 190275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 192101 190362 gene locus_tag LOCUS_30090 192101 190362 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_30090 192255 192671 gene locus_tag LOCUS_30100 192255 192671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 192989 193600 gene locus_tag LOCUS_30110 192989 193600 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_30110 193638 194786 gene locus_tag LOCUS_30120 193638 194786 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_30120 195028 198414 gene locus_tag LOCUS_30130 195028 198414 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765284.1 protein_id gnl|my_center|LOCUS_30130 198442 200352 gene locus_tag LOCUS_30140 198442 200352 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767188.1 protein_id gnl|my_center|LOCUS_30140 200383 201588 gene locus_tag LOCUS_30150 200383 201588 CDS product DUF5000 domain-containing lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767203.1 protein_id gnl|my_center|LOCUS_30150 201618 202694 gene locus_tag LOCUS_30160 201618 202694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 203093 204112 gene locus_tag LOCUS_30170 203093 204112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 204248 204523 gene locus_tag LOCUS_30180 204248 204523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 204527 206620 gene locus_tag LOCUS_30190 204527 206620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 207411 206584 gene locus_tag LOCUS_30200 207411 206584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 208001 207411 gene locus_tag LOCUS_30210 208001 207411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 209070 207934 gene locus_tag LOCUS_30220 209070 207934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 209433 209146 gene locus_tag LOCUS_30230 209433 209146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 212120 209622 gene locus_tag LOCUS_30240 212120 209622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 213590 212139 gene locus_tag LOCUS_30250 213590 212139 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_30250 216917 213594 gene locus_tag LOCUS_30260 216917 213594 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202212.1 protein_id gnl|my_center|LOCUS_30260 217244 217783 gene locus_tag LOCUS_30270 217244 217783 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_30270 217834 218919 gene locus_tag LOCUS_30280 217834 218919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 219243 221006 gene locus_tag LOCUS_30290 219243 221006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 221055 223001 gene locus_tag LOCUS_30300 221055 223001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_30300 223302 224312 gene locus_tag LOCUS_30310 223302 224312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 224467 226194 gene locus_tag LOCUS_30320 224467 226194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 227228 226308 gene locus_tag LOCUS_30330 227228 226308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 228309 227293 gene locus_tag LOCUS_30340 228309 227293 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_30340 228434 229048 gene locus_tag LOCUS_30350 228434 229048 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788923.1 protein_id gnl|my_center|LOCUS_30350 229096 230250 gene locus_tag LOCUS_30360 229096 230250 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_30360 230569 233925 gene locus_tag LOCUS_30370 230569 233925 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_30370 233946 235490 gene locus_tag LOCUS_30380 233946 235490 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_30380 235515 236357 gene locus_tag LOCUS_30390 235515 236357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 236408 237262 gene locus_tag LOCUS_30400 236408 237262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 237259 238692 gene locus_tag LOCUS_30410 237259 238692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 240863 238773 gene locus_tag LOCUS_30420 240863 238773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30420 242171 241608 gene locus_tag LOCUS_30430 242171 241608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 242321 243967 gene locus_tag LOCUS_30440 242321 243967 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_30440 244388 244912 gene locus_tag LOCUS_30450 244388 244912 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_30450 246859 245003 gene locus_tag LOCUS_30460 246859 245003 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066403458.1 protein_id gnl|my_center|LOCUS_30460 248254 247001 gene locus_tag LOCUS_30470 248254 247001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 249578 248256 gene locus_tag LOCUS_30480 249578 248256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 250785 249601 gene locus_tag LOCUS_30490 250785 249601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 250991 252889 gene locus_tag LOCUS_30500 250991 252889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 252907 253296 gene locus_tag LOCUS_30510 252907 253296 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704453.1 protein_id gnl|my_center|LOCUS_30510 254727 253303 gene locus_tag LOCUS_30520 254727 253303 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_30520 256652 254841 gene locus_tag LOCUS_30530 256652 254841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 259720 256673 gene locus_tag LOCUS_30540 259720 256673 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767846.1 protein_id gnl|my_center|LOCUS_30540 260052 261062 gene locus_tag LOCUS_30550 260052 261062 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_30550 261076 261789 gene locus_tag LOCUS_30560 261076 261789 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 protein_id gnl|my_center|LOCUS_30560 261813 262370 gene locus_tag LOCUS_30570 261813 262370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 262789 262376 gene locus_tag LOCUS_30580 262789 262376 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225462.1 protein_id gnl|my_center|LOCUS_30580 263372 263953 gene locus_tag LOCUS_30590 263372 263953 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_30590 264738 264439 gene locus_tag LOCUS_30600 264738 264439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 265108 264860 gene locus_tag LOCUS_30610 265108 264860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 265300 267435 gene locus_tag LOCUS_30620 265300 267435 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_30620 267538 268512 gene locus_tag LOCUS_30630 267538 268512 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_30630 269427 268552 gene locus_tag LOCUS_30640 269427 268552 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267088.1 protein_id gnl|my_center|LOCUS_30640 270532 269474 gene locus_tag LOCUS_30650 270532 269474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 271858 270611 gene locus_tag LOCUS_30660 271858 270611 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933139.1 protein_id gnl|my_center|LOCUS_30660 272959 271871 gene locus_tag LOCUS_30670 gene proB 272959 271871 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693251.1 protein_id gnl|my_center|LOCUS_30670 273410 273135 gene locus_tag LOCUS_30680 273410 273135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 273606 274073 gene locus_tag LOCUS_30690 gene umuD 273606 274073 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403083.1 protein_id gnl|my_center|LOCUS_30690 274078 274740 gene locus_tag LOCUS_30700 274078 274740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 275096 274878 gene locus_tag LOCUS_30710 275096 274878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 276096 275149 gene locus_tag LOCUS_30720 276096 275149 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904003.1 protein_id gnl|my_center|LOCUS_30720 276470 276688 gene locus_tag LOCUS_30730 276470 276688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 277024 278100 gene locus_tag LOCUS_30740 277024 278100 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766479.1 protein_id gnl|my_center|LOCUS_30740 278110 278850 gene locus_tag LOCUS_30750 278110 278850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 278876 279097 gene locus_tag LOCUS_30760 278876 279097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 279242 279553 gene locus_tag LOCUS_30770 279242 279553 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_30770 279585 280031 gene locus_tag LOCUS_30780 279585 280031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 280634 280101 gene locus_tag LOCUS_30790 280634 280101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 281869 280676 gene locus_tag LOCUS_30800 281869 280676 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_30800 283025 281880 gene locus_tag LOCUS_30810 283025 281880 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946754.1 protein_id gnl|my_center|LOCUS_30810 284271 283003 gene locus_tag LOCUS_30820 284271 283003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 286156 284222 gene locus_tag LOCUS_30830 286156 284222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 287448 286153 gene locus_tag LOCUS_30840 287448 286153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 287798 287463 gene locus_tag LOCUS_30850 287798 287463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 288245 287871 gene locus_tag LOCUS_30860 288245 287871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 289179 288313 gene locus_tag LOCUS_30870 289179 288313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 289622 290296 gene locus_tag LOCUS_30880 289622 290296 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151672826.1 protein_id gnl|my_center|LOCUS_30880 291272 290298 gene locus_tag LOCUS_30890 291272 290298 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_30890 292086 291556 gene locus_tag LOCUS_30900 gene dinB 292086 291556 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234141.1 protein_id gnl|my_center|LOCUS_30900 292243 292758 gene locus_tag LOCUS_30910 292243 292758 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_30910 293482 292841 gene locus_tag LOCUS_30920 293482 292841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 294896 294258 gene locus_tag LOCUS_30930 294896 294258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 294995 296113 gene locus_tag LOCUS_30940 294995 296113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 296193 296993 gene locus_tag LOCUS_30950 296193 296993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_30950 297003 297779 gene locus_tag LOCUS_30960 297003 297779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_30960 297783 298829 gene locus_tag LOCUS_30970 297783 298829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 299753 298893 gene locus_tag LOCUS_30980 299753 298893 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 protein_id gnl|my_center|LOCUS_30980 301061 300069 gene locus_tag LOCUS_30990 301061 300069 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_30990 301171 301413 gene locus_tag LOCUS_31000 301171 301413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 301425 301856 gene locus_tag LOCUS_31010 301425 301856 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_31010 302069 303115 gene locus_tag LOCUS_31020 302069 303115 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_31020 303262 304542 gene locus_tag LOCUS_31030 303262 304542 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_31030 304562 304972 gene locus_tag LOCUS_31040 304562 304972 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_31040 310262 304974 gene locus_tag LOCUS_31050 310262 304974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 312206 310578 gene locus_tag LOCUS_31060 312206 310578 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705053.1 protein_id gnl|my_center|LOCUS_31060 313858 312224 gene locus_tag LOCUS_31070 313858 312224 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_31070 315337 313865 gene locus_tag LOCUS_31080 315337 313865 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_31080 318409 315356 gene locus_tag LOCUS_31090 318409 315356 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_31090 319205 318825 gene locus_tag LOCUS_31100 319205 318825 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_31100 319638 319222 gene locus_tag LOCUS_31110 319638 319222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 320600 319701 gene locus_tag LOCUS_31120 320600 319701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 321038 320616 gene locus_tag LOCUS_31130 321038 320616 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_31130 321826 321089 gene locus_tag LOCUS_31140 321826 321089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 323306 322476 gene locus_tag LOCUS_31150 323306 322476 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_31150 323951 323370 gene locus_tag LOCUS_31160 323951 323370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 324329 323955 gene locus_tag LOCUS_31170 324329 323955 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245808.1 protein_id gnl|my_center|LOCUS_31170 324481 325359 gene locus_tag LOCUS_31180 324481 325359 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976361.1 protein_id gnl|my_center|LOCUS_31180 325860 328271 gene locus_tag LOCUS_31190 325860 328271 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_31190 328515 329000 gene locus_tag LOCUS_31200 328515 329000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 329491 329009 gene locus_tag LOCUS_31210 329491 329009 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528038.1 protein_id gnl|my_center|LOCUS_31210 329709 330437 gene locus_tag LOCUS_31220 329709 330437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 330644 331093 gene locus_tag LOCUS_31230 330644 331093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 331415 331098 gene locus_tag LOCUS_31240 331415 331098 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_31240 331788 333647 gene locus_tag LOCUS_31250 331788 333647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 334054 333650 gene locus_tag LOCUS_31260 334054 333650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 335207 334134 gene locus_tag LOCUS_31270 gene leuB 335207 334134 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328413.1 protein_id gnl|my_center|LOCUS_31270 336749 335226 gene locus_tag LOCUS_31280 336749 335226 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_31280 337346 336750 gene locus_tag LOCUS_31290 gene leuD 337346 336750 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_31290 338784 337378 gene locus_tag LOCUS_31300 gene leuC 338784 337378 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_31300 339146 339454 gene locus_tag LOCUS_31310 339146 339454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 342139 339776 gene locus_tag LOCUS_31320 342139 339776 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_31320 345443 342279 gene locus_tag LOCUS_31330 345443 342279 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 protein_id gnl|my_center|LOCUS_31330 346336 345437 gene locus_tag LOCUS_31340 346336 345437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_31340 346532 348028 gene locus_tag LOCUS_31350 346532 348028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 348025 348756 gene locus_tag LOCUS_31360 348025 348756 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_31360 348857 349048 gene locus_tag LOCUS_31370 348857 349048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 349070 349441 gene locus_tag LOCUS_31380 349070 349441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 354770 349593 gene locus_tag LOCUS_31390 354770 349593 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463281.1 protein_id gnl|my_center|LOCUS_31390 354956 357124 gene locus_tag LOCUS_31400 354956 357124 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_31400 357138 357758 gene locus_tag LOCUS_31410 357138 357758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 357807 358007 gene locus_tag LOCUS_31420 357807 358007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 358171 359019 gene locus_tag LOCUS_31430 358171 359019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 359030 359785 gene locus_tag LOCUS_31440 359030 359785 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_31440 361559 359787 gene locus_tag LOCUS_31450 361559 359787 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_31450 362233 361640 gene locus_tag LOCUS_31460 362233 361640 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266644.1 protein_id gnl|my_center|LOCUS_31460 362961 362230 gene locus_tag LOCUS_31470 362961 362230 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 protein_id gnl|my_center|LOCUS_31470 364330 362984 gene locus_tag LOCUS_31480 364330 362984 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_31480 365127 364330 gene locus_tag LOCUS_31490 365127 364330 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_31490 365383 366951 gene locus_tag LOCUS_31500 365383 366951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 366998 367903 gene locus_tag LOCUS_31510 gene yedA 366998 367903 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 protein_id gnl|my_center|LOCUS_31510 368578 367904 gene locus_tag LOCUS_31520 368578 367904 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942574.1 protein_id gnl|my_center|LOCUS_31520 368839 368585 gene locus_tag LOCUS_31530 368839 368585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 368919 369851 gene locus_tag LOCUS_31540 368919 369851 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_31540 371231 369891 gene locus_tag LOCUS_31550 371231 369891 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265603.1 protein_id gnl|my_center|LOCUS_31550 371327 373123 gene locus_tag LOCUS_31560 371327 373123 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_31560 373288 373725 gene locus_tag LOCUS_31570 373288 373725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 375978 374350 gene locus_tag LOCUS_31580 gene pgi 375978 374350 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261112.1 protein_id gnl|my_center|LOCUS_31580 376853 376044 gene locus_tag LOCUS_31590 376853 376044 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_31590 377087 378079 gene locus_tag LOCUS_31600 gene prfB 377087 378079 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_31600 378129 379760 gene locus_tag LOCUS_31610 gene pruA 378129 379760 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_31610 380801 380289 gene locus_tag LOCUS_31620 380801 380289 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_31620 380907 381437 gene locus_tag LOCUS_31630 gene pyrR 380907 381437 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_31630 381461 382387 gene locus_tag LOCUS_31640 381461 382387 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_31640 382462 382791 gene locus_tag LOCUS_31650 382462 382791 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940209.1 protein_id gnl|my_center|LOCUS_31650 382805 383905 gene locus_tag LOCUS_31660 382805 383905 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204630977.1 protein_id gnl|my_center|LOCUS_31660 383970 386483 gene locus_tag LOCUS_31670 383970 386483 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_31670 386486 386653 gene locus_tag LOCUS_31680 386486 386653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 386765 388468 gene locus_tag LOCUS_31690 386765 388468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 389383 388541 gene locus_tag LOCUS_31700 389383 388541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 390081 389422 gene locus_tag LOCUS_31710 390081 389422 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_31710 390895 390101 gene locus_tag LOCUS_31720 390895 390101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 391512 390892 gene locus_tag LOCUS_31730 391512 390892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 391984 391577 gene locus_tag LOCUS_31740 391984 391577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 392463 393299 gene locus_tag LOCUS_31750 392463 393299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 394403 393483 gene locus_tag LOCUS_31760 gene xerD 394403 393483 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_31760 394637 398089 gene locus_tag LOCUS_31770 gene pyc 394637 398089 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164080.1 protein_id gnl|my_center|LOCUS_31770 398425 399567 gene locus_tag LOCUS_31780 398425 399567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 399808 401106 gene locus_tag LOCUS_31790 399808 401106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 401363 402646 gene locus_tag LOCUS_31800 401363 402646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 403414 402899 gene locus_tag LOCUS_31810 403414 402899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 404153 403737 gene locus_tag LOCUS_31820 404153 403737 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_31820 404336 405340 gene locus_tag LOCUS_31830 404336 405340 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_31830 405401 406285 gene locus_tag LOCUS_31840 405401 406285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 406377 407024 gene locus_tag LOCUS_31850 406377 407024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 407958 407560 gene locus_tag LOCUS_31860 407958 407560 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_31860 409298 407958 gene locus_tag LOCUS_31870 gene purB 409298 407958 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_31870 409482 410129 gene locus_tag LOCUS_31880 409482 410129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31880 410175 410828 gene locus_tag LOCUS_31890 410175 410828 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_31890 412038 410830 gene locus_tag LOCUS_31900 412038 410830 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983670.1 protein_id gnl|my_center|LOCUS_31900 412193 412354 gene locus_tag LOCUS_31910 412193 412354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 413442 412351 gene locus_tag LOCUS_31920 gene recF 413442 412351 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_31920 413566 414576 gene locus_tag LOCUS_31930 gene pdhA 413566 414576 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_31930 414608 415321 gene locus_tag LOCUS_31940 414608 415321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 415330 415833 gene locus_tag LOCUS_31950 gene ribH 415330 415833 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764452.1 protein_id gnl|my_center|LOCUS_31950 415912 416631 gene locus_tag LOCUS_31960 415912 416631 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_31960 416655 417062 gene locus_tag LOCUS_31970 416655 417062 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_31970 417105 417788 gene locus_tag LOCUS_31980 417105 417788 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_31980 419638 418313 gene locus_tag LOCUS_31990 419638 418313 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_31990 419972 422593 gene locus_tag LOCUS_32000 gene gyrA 419972 422593 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765727.1 protein_id gnl|my_center|LOCUS_32000 422636 423886 gene locus_tag LOCUS_32010 422636 423886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 424196 424513 gene locus_tag LOCUS_32020 424196 424513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 424613 425563 gene locus_tag LOCUS_32030 424613 425563 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223358.1 protein_id gnl|my_center|LOCUS_32030 426072 425623 gene locus_tag LOCUS_32040 426072 425623 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202858.1 protein_id gnl|my_center|LOCUS_32040 426303 427085 gene locus_tag LOCUS_32050 426303 427085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 427085 427735 gene locus_tag LOCUS_32060 427085 427735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 427711 428517 gene locus_tag LOCUS_32070 427711 428517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 428507 429160 gene locus_tag LOCUS_32080 428507 429160 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_32080 429753 429358 gene locus_tag LOCUS_32090 429753 429358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 430907 430356 gene locus_tag LOCUS_32100 430907 430356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 432889 431747 gene locus_tag LOCUS_32110 432889 431747 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108035.1 protein_id gnl|my_center|LOCUS_32110 434035 432902 gene locus_tag LOCUS_32120 434035 432902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 435673 434066 gene locus_tag LOCUS_32130 435673 434066 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_32130 439103 435687 gene locus_tag LOCUS_32140 439103 435687 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_32140 440255 439218 gene locus_tag LOCUS_32150 440255 439218 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761426.1 protein_id gnl|my_center|LOCUS_32150 441768 441139 gene locus_tag LOCUS_32160 441768 441139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 442641 441949 gene locus_tag LOCUS_32170 442641 441949 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_32170 444484 442865 gene locus_tag LOCUS_32180 444484 442865 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_32180 444607 446232 gene locus_tag LOCUS_32190 444607 446232 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_32190 446243 446794 gene locus_tag LOCUS_32200 446243 446794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 449061 446773 gene locus_tag LOCUS_32210 449061 446773 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964773.1 protein_id gnl|my_center|LOCUS_32210 449452 449084 gene locus_tag LOCUS_32220 449452 449084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 451319 449550 gene locus_tag LOCUS_32230 451319 449550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 454520 451326 gene locus_tag LOCUS_32240 454520 451326 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108905.1 protein_id gnl|my_center|LOCUS_32240 456607 455396 gene locus_tag LOCUS_32250 456607 455396 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_32250 457493 456717 gene locus_tag LOCUS_32260 457493 456717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 459009 457687 gene locus_tag LOCUS_32270 459009 457687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 459756 459067 gene locus_tag LOCUS_32280 459756 459067 CDS product DUF3823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764129.1 protein_id gnl|my_center|LOCUS_32280 461667 459775 gene locus_tag LOCUS_32290 461667 459775 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_32290 464819 461679 gene locus_tag LOCUS_32300 464819 461679 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764127.1 protein_id gnl|my_center|LOCUS_32300 467156 464970 gene locus_tag LOCUS_32310 467156 464970 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108997.1 protein_id gnl|my_center|LOCUS_32310 467536 469971 gene locus_tag LOCUS_32320 467536 469971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107969.1 protein_id gnl|my_center|LOCUS_32320 470071 470457 gene locus_tag LOCUS_32330 470071 470457 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976191.1 protein_id gnl|my_center|LOCUS_32330 475881 470815 gene locus_tag LOCUS_32340 475881 470815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 476261 476022 gene locus_tag LOCUS_32350 476261 476022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 476453 476791 gene locus_tag LOCUS_32360 476453 476791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 477619 476882 gene locus_tag LOCUS_32370 477619 476882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 478454 478972 gene locus_tag LOCUS_32380 478454 478972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 479280 479095 gene locus_tag LOCUS_32390 479280 479095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 480912 479470 gene locus_tag LOCUS_32400 480912 479470 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_32400 481008 481583 gene locus_tag LOCUS_32410 481008 481583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 481615 482178 gene locus_tag LOCUS_32420 481615 482178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 482318 483130 gene locus_tag LOCUS_32430 482318 483130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 483261 483497 gene locus_tag LOCUS_32440 483261 483497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 483538 483783 gene locus_tag LOCUS_32450 483538 483783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 484601 483882 gene locus_tag LOCUS_32460 484601 483882 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530111.1 protein_id gnl|my_center|LOCUS_32460 485267 484683 gene locus_tag LOCUS_32470 485267 484683 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528771.1 protein_id gnl|my_center|LOCUS_32470 487754 485328 gene locus_tag LOCUS_32480 487754 485328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 487812 488615 gene locus_tag LOCUS_32490 487812 488615 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922574.1 protein_id gnl|my_center|LOCUS_32490 489924 488620 gene locus_tag LOCUS_32500 489924 488620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 492431 489933 gene locus_tag LOCUS_32510 492431 489933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 493954 492581 gene locus_tag LOCUS_32520 493954 492581 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_32520 494585 494049 gene locus_tag LOCUS_32530 494585 494049 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907311.1 protein_id gnl|my_center|LOCUS_32530 494658 495650 gene locus_tag LOCUS_32540 494658 495650 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878413.1 protein_id gnl|my_center|LOCUS_32540 495742 495815 gene locus_tag LOCUS_t00320 495742 495815 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 498122 496023 gene locus_tag LOCUS_32550 498122 496023 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093407568.1 protein_id gnl|my_center|LOCUS_32550 498371 498126 gene locus_tag LOCUS_32560 498371 498126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 498511 499143 gene locus_tag LOCUS_32570 498511 499143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 500662 501021 gene locus_tag LOCUS_32580 500662 501021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 501169 502338 gene locus_tag LOCUS_32590 501169 502338 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_32590 502530 502958 gene locus_tag LOCUS_32600 502530 502958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 503610 502969 gene locus_tag LOCUS_32610 503610 502969 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110886.1 protein_id gnl|my_center|LOCUS_32610 504126 503776 gene locus_tag LOCUS_32620 504126 503776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 504721 504197 gene locus_tag LOCUS_32630 504721 504197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 504888 505919 gene locus_tag LOCUS_32640 504888 505919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 506605 506985 gene locus_tag LOCUS_32650 506605 506985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 507029 508270 gene locus_tag LOCUS_32660 507029 508270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 508267 508902 gene locus_tag LOCUS_32670 508267 508902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 508902 510152 gene locus_tag LOCUS_32680 508902 510152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 510156 512942 gene locus_tag LOCUS_32690 510156 512942 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_32690 512953 514236 gene locus_tag LOCUS_32700 512953 514236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 514233 514862 gene locus_tag LOCUS_32710 514233 514862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 514890 515906 gene locus_tag LOCUS_32720 514890 515906 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_32720 515923 516801 gene locus_tag LOCUS_32730 gene hpnK 515923 516801 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_32730 516798 517571 gene locus_tag LOCUS_32740 516798 517571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 517762 518259 gene locus_tag LOCUS_32750 517762 518259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 519421 518234 gene locus_tag LOCUS_32760 519421 518234 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_32760 520877 519411 gene locus_tag LOCUS_32770 520877 519411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 522181 521123 gene locus_tag LOCUS_32780 522181 521123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 522367 523125 gene locus_tag LOCUS_32790 522367 523125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 524374 523127 gene locus_tag LOCUS_32800 524374 523127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 525182 524607 gene locus_tag LOCUS_32810 525182 524607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 525651 526112 gene locus_tag LOCUS_32820 525651 526112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 526839 526099 gene locus_tag LOCUS_32830 gene bla2 526839 526099 CDS product BcII family subclass B1 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016124981.1 protein_id gnl|my_center|LOCUS_32830 527855 526983 gene locus_tag LOCUS_32840 527855 526983 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385340.1 protein_id gnl|my_center|LOCUS_32840 529683 527923 gene locus_tag LOCUS_32850 529683 527923 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_32850 532862 529719 gene locus_tag LOCUS_32860 532862 529719 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202219.1 protein_id gnl|my_center|LOCUS_32860 534285 532963 gene locus_tag LOCUS_32870 534285 532963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 534924 534343 gene locus_tag LOCUS_32880 534924 534343 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_32880 535239 535601 gene locus_tag LOCUS_32890 535239 535601 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_32890 536314 535604 gene locus_tag LOCUS_32900 536314 535604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 536939 536451 gene locus_tag LOCUS_32910 536939 536451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 537064 538740 gene locus_tag LOCUS_32920 537064 538740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 539225 538842 gene locus_tag LOCUS_32930 539225 538842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 540322 539543 gene locus_tag LOCUS_32940 540322 539543 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_32940 541388 540303 gene locus_tag LOCUS_32950 541388 540303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 541649 542872 gene locus_tag LOCUS_32960 541649 542872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 543567 543001 gene locus_tag LOCUS_32970 543567 543001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 543854 544453 gene locus_tag LOCUS_32980 543854 544453 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075854075.1 protein_id gnl|my_center|LOCUS_32980 544466 544807 gene locus_tag LOCUS_32990 544466 544807 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145104183.1 protein_id gnl|my_center|LOCUS_32990 544809 546056 gene locus_tag LOCUS_33000 544809 546056 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_33000 546117 547259 gene locus_tag LOCUS_33010 546117 547259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 547372 547995 gene locus_tag LOCUS_33020 547372 547995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 548992 548048 gene locus_tag LOCUS_33030 548992 548048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 549843 549106 gene locus_tag LOCUS_33040 549843 549106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 550062 551957 gene locus_tag LOCUS_33050 550062 551957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 552782 551976 gene locus_tag LOCUS_33060 552782 551976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 553133 554248 gene locus_tag LOCUS_33070 553133 554248 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_33070 555079 554330 gene locus_tag LOCUS_33080 555079 554330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 555246 557645 gene locus_tag LOCUS_33090 555246 557645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_33090 559942 557705 gene locus_tag LOCUS_33100 559942 557705 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055269995.1 protein_id gnl|my_center|LOCUS_33100 560337 559939 gene locus_tag LOCUS_33110 560337 559939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 560743 560399 gene locus_tag LOCUS_33120 560743 560399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 562499 560841 gene locus_tag LOCUS_33130 562499 560841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 562870 562499 gene locus_tag LOCUS_33140 562870 562499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 563409 562951 gene locus_tag LOCUS_33150 563409 562951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 563999 563406 gene locus_tag LOCUS_33160 563999 563406 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_33160 564192 564992 gene locus_tag LOCUS_33170 564192 564992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 565543 564977 gene locus_tag LOCUS_33180 565543 564977 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035327.1 protein_id gnl|my_center|LOCUS_33180 566162 565719 gene locus_tag LOCUS_33190 566162 565719 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_33190 566536 566267 gene locus_tag LOCUS_33200 566536 566267 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761179.1 protein_id gnl|my_center|LOCUS_33200 566797 567861 gene locus_tag LOCUS_33210 566797 567861 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_33210 568389 567865 gene locus_tag LOCUS_33220 568389 567865 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618765.1 protein_id gnl|my_center|LOCUS_33220 568462 569286 gene locus_tag LOCUS_33230 568462 569286 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066484172.1 protein_id gnl|my_center|LOCUS_33230 569317 570006 gene locus_tag LOCUS_33240 569317 570006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 570182 571522 gene locus_tag LOCUS_33250 570182 571522 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163911759.1 protein_id gnl|my_center|LOCUS_33250 >Feature sequence19 682 314 gene locus_tag LOCUS_33260 682 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 1166 840 gene locus_tag LOCUS_33270 1166 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 1496 2608 gene locus_tag LOCUS_33280 1496 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 2998 3774 gene locus_tag LOCUS_33290 2998 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 4184 5599 gene locus_tag LOCUS_33300 4184 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 5785 6495 gene locus_tag LOCUS_33310 5785 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 7257 6568 gene locus_tag LOCUS_33320 7257 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 7445 7888 gene locus_tag LOCUS_33330 7445 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 8300 7890 gene locus_tag LOCUS_33340 8300 7890 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109280.1 protein_id gnl|my_center|LOCUS_33340 8492 9283 gene locus_tag LOCUS_33350 8492 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 9813 9292 gene locus_tag LOCUS_33360 9813 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 10339 9971 gene locus_tag LOCUS_33370 10339 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 10496 10792 gene locus_tag LOCUS_33380 10496 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 11229 10789 gene locus_tag LOCUS_33390 11229 10789 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_33390 11919 11254 gene locus_tag LOCUS_33400 11919 11254 CDS product DUF4272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141321.1 protein_id gnl|my_center|LOCUS_33400 11981 12325 gene locus_tag LOCUS_33410 11981 12325 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_33410 12835 12368 gene locus_tag LOCUS_33420 12835 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 13004 13693 gene locus_tag LOCUS_33430 13004 13693 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113610.1 protein_id gnl|my_center|LOCUS_33430 13860 15335 gene locus_tag LOCUS_33440 13860 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 16092 15400 gene locus_tag LOCUS_33450 16092 15400 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_33450 16949 16107 gene locus_tag LOCUS_33460 16949 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 17503 16943 gene locus_tag LOCUS_33470 17503 16943 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329713.1 protein_id gnl|my_center|LOCUS_33470 19030 17516 gene locus_tag LOCUS_33480 19030 17516 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072073.1 protein_id gnl|my_center|LOCUS_33480 19710 19033 gene locus_tag LOCUS_33490 19710 19033 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_33490 20021 20872 gene locus_tag LOCUS_33500 20021 20872 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_33500 20883 21911 gene locus_tag LOCUS_33510 20883 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 21908 23053 gene locus_tag LOCUS_33520 21908 23053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 24443 23112 gene locus_tag LOCUS_33530 24443 23112 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_33530 25078 24452 gene locus_tag LOCUS_33540 25078 24452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 25294 25671 gene locus_tag LOCUS_33550 25294 25671 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078608513.1 protein_id gnl|my_center|LOCUS_33550 26998 25727 gene locus_tag LOCUS_33560 26998 25727 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083543.1 protein_id gnl|my_center|LOCUS_33560 27282 27037 gene locus_tag LOCUS_33570 27282 27037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 27860 27309 gene locus_tag LOCUS_33580 27860 27309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 28741 28475 gene locus_tag LOCUS_33590 28741 28475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 28952 30133 gene locus_tag LOCUS_33600 28952 30133 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_33600 30176 30670 gene locus_tag LOCUS_33610 30176 30670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 30752 32170 gene locus_tag LOCUS_33620 30752 32170 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_33620 32210 32566 gene locus_tag LOCUS_33630 32210 32566 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_33630 32581 34071 gene locus_tag LOCUS_33640 gene glpK 32581 34071 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_33640 34319 35866 gene locus_tag LOCUS_33650 34319 35866 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_33650 36448 35873 gene locus_tag LOCUS_33660 36448 35873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 36885 36445 gene locus_tag LOCUS_33670 36885 36445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 37459 36872 gene locus_tag LOCUS_33680 37459 36872 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_33680 37965 37468 gene locus_tag LOCUS_33690 37965 37468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 38092 39201 gene locus_tag LOCUS_33700 38092 39201 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832304.1 protein_id gnl|my_center|LOCUS_33700 39458 39754 gene locus_tag LOCUS_33710 39458 39754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_33710 39892 40272 gene locus_tag LOCUS_33720 gene rpsL 39892 40272 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_33720 40304 40771 gene locus_tag LOCUS_33730 gene rpsG 40304 40771 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_33730 40965 41171 gene locus_tag LOCUS_33740 40965 41171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 44955 41332 gene locus_tag LOCUS_33750 44955 41332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 45416 44961 gene locus_tag LOCUS_33760 45416 44961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 46613 45456 gene locus_tag LOCUS_33770 gene porV 46613 45456 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_33770 47100 46630 gene locus_tag LOCUS_33780 47100 46630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 50952 47635 gene locus_tag LOCUS_33790 50952 47635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 51410 50958 gene locus_tag LOCUS_33800 51410 50958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 52606 51449 gene locus_tag LOCUS_33810 gene porV 52606 51449 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_33810 53129 52623 gene locus_tag LOCUS_33820 53129 52623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 53545 55689 gene locus_tag LOCUS_33830 gene fusA 53545 55689 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_33830 56521 57111 gene locus_tag LOCUS_33840 56521 57111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 58224 57112 gene locus_tag LOCUS_33850 58224 57112 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_33850 58418 59020 gene locus_tag LOCUS_33860 58418 59020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 59861 59115 gene locus_tag LOCUS_33870 59861 59115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 60083 60388 gene locus_tag LOCUS_33880 gene rpsJ 60083 60388 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_33880 60559 61182 gene locus_tag LOCUS_33890 gene rplC 60559 61182 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_33890 61184 61828 gene locus_tag LOCUS_33900 gene rplD 61184 61828 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_33900 61884 62183 gene locus_tag LOCUS_33910 gene rplW 61884 62183 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_33910 62278 63111 gene locus_tag LOCUS_33920 gene rplB 62278 63111 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_33920 63175 63441 gene locus_tag LOCUS_33930 gene rpsS 63175 63441 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_33930 63564 63920 gene locus_tag LOCUS_33940 gene rplV 63564 63920 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_33940 63972 64766 gene locus_tag LOCUS_33950 gene rpsC 63972 64766 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963464.1 protein_id gnl|my_center|LOCUS_33950 64817 65236 gene locus_tag LOCUS_33960 gene rplP 64817 65236 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_33960 65298 65498 gene locus_tag LOCUS_33970 65298 65498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 65558 65818 gene locus_tag LOCUS_33980 gene rpsQ 65558 65818 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_33980 65894 66262 gene locus_tag LOCUS_33990 gene rplN 65894 66262 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_33990 66458 66802 gene locus_tag LOCUS_34000 gene rplX 66458 66802 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_34000 66802 67377 gene locus_tag LOCUS_34010 gene rplE 66802 67377 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_34010 67384 67653 gene locus_tag LOCUS_34020 gene rpsN 67384 67653 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_34020 67741 68139 gene locus_tag LOCUS_34030 gene rpsH 67741 68139 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_34030 68252 68806 gene locus_tag LOCUS_34040 gene rplF 68252 68806 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_34040 68956 69309 gene locus_tag LOCUS_34050 gene rplR 68956 69309 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_34050 69343 69861 gene locus_tag LOCUS_34060 gene rpsE 69343 69861 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_34060 69943 70128 gene locus_tag LOCUS_34070 gene rpmD 69943 70128 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_34070 70226 70672 gene locus_tag LOCUS_34080 gene rplO 70226 70672 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_34080 70751 72091 gene locus_tag LOCUS_34090 gene secY 70751 72091 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_34090 72195 73001 gene locus_tag LOCUS_34100 gene map 72195 73001 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_34100 73182 73400 gene locus_tag LOCUS_34110 gene infA 73182 73400 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_34110 73599 73979 gene locus_tag LOCUS_34120 gene rpsM 73599 73979 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963448.1 protein_id gnl|my_center|LOCUS_34120 74091 74489 gene locus_tag LOCUS_34130 gene rpsK 74091 74489 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_34130 74661 75266 gene locus_tag LOCUS_34140 gene rpsD 74661 75266 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_34140 75345 76340 gene locus_tag LOCUS_34150 75345 76340 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_34150 76450 76935 gene locus_tag LOCUS_34160 gene rplQ 76450 76935 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963444.1 protein_id gnl|my_center|LOCUS_34160 77175 77984 gene locus_tag LOCUS_34170 77175 77984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 78079 79197 gene locus_tag LOCUS_34180 gene carA 78079 79197 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_34180 81182 79989 gene locus_tag LOCUS_34190 81182 79989 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107809.1 protein_id gnl|my_center|LOCUS_34190 81700 81296 gene locus_tag LOCUS_34200 81700 81296 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_34200 81894 84293 gene locus_tag LOCUS_34210 81894 84293 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_34210 84489 85418 gene locus_tag LOCUS_34220 84489 85418 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_34220 85440 85784 gene locus_tag LOCUS_34230 85440 85784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 86377 86538 gene locus_tag LOCUS_34240 86377 86538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 87229 88086 gene locus_tag LOCUS_34250 87229 88086 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_34250 88870 88160 gene locus_tag LOCUS_34260 88870 88160 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_34260 90470 89016 gene locus_tag LOCUS_34270 90470 89016 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962400.1 protein_id gnl|my_center|LOCUS_34270 90674 92092 gene locus_tag LOCUS_34280 gene gltP 90674 92092 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835799.1 protein_id gnl|my_center|LOCUS_34280 92177 92890 gene locus_tag LOCUS_34290 92177 92890 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964128.1 protein_id gnl|my_center|LOCUS_34290 92976 94223 gene locus_tag LOCUS_34300 92976 94223 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_34300 94701 94237 gene locus_tag LOCUS_34310 94701 94237 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_34310 95354 94776 gene locus_tag LOCUS_34320 95354 94776 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_34320 96439 95501 gene locus_tag LOCUS_34330 gene mdh 96439 95501 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_34330 97076 96558 gene locus_tag LOCUS_34340 97076 96558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 97239 97802 gene locus_tag LOCUS_34350 gene efp 97239 97802 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_34350 97872 98360 gene locus_tag LOCUS_34360 gene accB 97872 98360 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_34360 98442 99779 gene locus_tag LOCUS_34370 gene accC 98442 99779 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_34370 100738 100376 gene locus_tag LOCUS_34380 100738 100376 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384930.1 protein_id gnl|my_center|LOCUS_34380 101588 100902 gene locus_tag LOCUS_34390 101588 100902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 103140 101647 gene locus_tag LOCUS_34400 103140 101647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 105465 103270 gene locus_tag LOCUS_34410 105465 103270 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_34410 105723 107945 gene locus_tag LOCUS_34420 gene purL 105723 107945 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_34420 108224 109285 gene locus_tag LOCUS_34430 108224 109285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 109476 110057 gene locus_tag LOCUS_34440 109476 110057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 111119 110043 gene locus_tag LOCUS_34450 111119 110043 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269198.1 protein_id gnl|my_center|LOCUS_34450 113446 111119 gene locus_tag LOCUS_34460 113446 111119 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144873981.1 protein_id gnl|my_center|LOCUS_34460 115496 114255 gene locus_tag LOCUS_34470 115496 114255 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_34470 115635 117311 gene locus_tag LOCUS_34480 115635 117311 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_34480 117424 118197 gene locus_tag LOCUS_34490 117424 118197 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_34490 118265 118927 gene locus_tag LOCUS_34500 118265 118927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 119712 119323 gene locus_tag LOCUS_34510 119712 119323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 119881 121311 gene locus_tag LOCUS_34520 119881 121311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 121508 122272 gene locus_tag LOCUS_34530 121508 122272 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_34530 122345 123067 gene locus_tag LOCUS_34540 122345 123067 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_34540 123507 123154 gene locus_tag LOCUS_34550 123507 123154 CDS product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619585.1 protein_id gnl|my_center|LOCUS_34550 123628 124578 gene locus_tag LOCUS_34560 123628 124578 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_34560 125394 124594 gene locus_tag LOCUS_34570 125394 124594 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_34570 125536 126195 gene locus_tag LOCUS_34580 125536 126195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 126510 127160 gene locus_tag LOCUS_34590 gene fsa 126510 127160 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_34590 127335 128831 gene locus_tag LOCUS_34600 gene glpK 127335 128831 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_34600 128870 129577 gene locus_tag LOCUS_34610 128870 129577 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_34610 129874 131181 gene locus_tag LOCUS_34620 129874 131181 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_34620 132564 131314 gene locus_tag LOCUS_34630 132564 131314 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_34630 132651 133874 gene locus_tag LOCUS_34640 132651 133874 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_34640 134604 133867 gene locus_tag LOCUS_34650 134604 133867 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_34650 134751 137120 gene locus_tag LOCUS_34660 134751 137120 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_34660 137800 137108 gene locus_tag LOCUS_34670 gene truB 137800 137108 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_34670 138974 137820 gene locus_tag LOCUS_34680 138974 137820 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_34680 139960 138971 gene locus_tag LOCUS_34690 139960 138971 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_34690 140541 139957 gene locus_tag LOCUS_34700 140541 139957 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_34700 140690 140887 gene locus_tag LOCUS_34710 140690 140887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 140968 141930 gene locus_tag LOCUS_34720 gene xerC 140968 141930 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765425.1 protein_id gnl|my_center|LOCUS_34720 142166 142483 gene locus_tag LOCUS_34730 gene raiA 142166 142483 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_34730 142716 142790 gene locus_tag LOCUS_t00330 142716 142790 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 142807 142890 gene locus_tag LOCUS_t00340 142807 142890 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 142953 143026 gene locus_tag LOCUS_t00350 142953 143026 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 143043 143115 gene locus_tag LOCUS_t00360 143043 143115 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 143342 144529 gene locus_tag LOCUS_34740 gene tuf 143342 144529 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_34740 144646 144717 gene locus_tag LOCUS_t00370 144646 144717 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 144851 145045 gene locus_tag LOCUS_34750 gene secE 144851 145045 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_34750 145045 145611 gene locus_tag LOCUS_34760 gene nusG 145045 145611 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_34760 146624 146079 gene locus_tag LOCUS_34770 146624 146079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 147781 146711 gene locus_tag LOCUS_34780 147781 146711 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_34780 148192 148635 gene locus_tag LOCUS_34790 gene rplK 148192 148635 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_34790 148681 149370 gene locus_tag LOCUS_34800 gene rplA 148681 149370 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_34800 149440 149979 gene locus_tag LOCUS_34810 gene rplJ 149440 149979 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_34810 150056 150427 gene locus_tag LOCUS_34820 gene rplL 150056 150427 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_34820 150639 154448 gene locus_tag LOCUS_34830 gene rpoB 150639 154448 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_34830 154618 158916 gene locus_tag LOCUS_34840 gene rpoC 154618 158916 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_34840 159165 160166 gene locus_tag LOCUS_34850 159165 160166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 160350 160949 gene locus_tag LOCUS_34860 160350 160949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 161024 162454 gene locus_tag LOCUS_34870 161024 162454 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_34870 162900 163511 gene locus_tag LOCUS_34880 162900 163511 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_34880 163489 164502 gene locus_tag LOCUS_34890 163489 164502 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_34890 164609 164680 gene locus_tag LOCUS_t00380 164609 164680 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 165545 166324 gene locus_tag LOCUS_34900 165545 166324 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_34900 166873 166325 gene locus_tag LOCUS_34910 166873 166325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 168329 167217 gene locus_tag LOCUS_34920 168329 167217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 168919 168365 gene locus_tag LOCUS_34930 168919 168365 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_34930 169167 172661 gene locus_tag LOCUS_34940 169167 172661 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_34940 172673 174016 gene locus_tag LOCUS_34950 172673 174016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 174038 174496 gene locus_tag LOCUS_34960 174038 174496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 174936 174553 gene locus_tag LOCUS_34970 174936 174553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 175401 174961 gene locus_tag LOCUS_34980 175401 174961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 176362 175499 gene locus_tag LOCUS_34990 176362 175499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 177288 176551 gene locus_tag LOCUS_35000 177288 176551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 177649 178917 gene locus_tag LOCUS_35010 177649 178917 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_35010 179946 178993 gene locus_tag LOCUS_35020 179946 178993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 181698 180313 gene locus_tag LOCUS_35030 181698 180313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 182857 181754 gene locus_tag LOCUS_35040 182857 181754 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970504.1 protein_id gnl|my_center|LOCUS_35040 182981 183052 gene locus_tag LOCUS_t00390 182981 183052 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 183982 183179 gene locus_tag LOCUS_35050 183982 183179 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_35050 184693 184115 gene locus_tag LOCUS_35060 gene rclC 184693 184115 CDS product reactive chlorine resistance membrane protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707216.1 protein_id gnl|my_center|LOCUS_35060 185636 184758 gene locus_tag LOCUS_35070 185636 184758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 185779 186969 gene locus_tag LOCUS_35080 185779 186969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 188304 189257 gene locus_tag LOCUS_35090 188304 189257 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975719.1 protein_id gnl|my_center|LOCUS_35090 189275 189898 gene locus_tag LOCUS_35100 189275 189898 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_35100 190582 189959 gene locus_tag LOCUS_35110 190582 189959 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_35110 191271 190579 gene locus_tag LOCUS_35120 191271 190579 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_35120 192612 191299 gene locus_tag LOCUS_35130 192612 191299 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_35130 193322 192651 gene locus_tag LOCUS_35140 193322 192651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 194239 193346 gene locus_tag LOCUS_35150 194239 193346 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967096.1 protein_id gnl|my_center|LOCUS_35150 195549 194320 gene locus_tag LOCUS_35160 195549 194320 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_35160 195737 197584 gene locus_tag LOCUS_35170 195737 197584 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303185.1 protein_id gnl|my_center|LOCUS_35170 197594 198268 gene locus_tag LOCUS_35180 197594 198268 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_35180 198322 199170 gene locus_tag LOCUS_35190 198322 199170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 201154 199244 gene locus_tag LOCUS_35200 201154 199244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 201181 201363 gene locus_tag LOCUS_35210 201181 201363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 201287 201754 gene locus_tag LOCUS_35220 201287 201754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 202444 201755 gene locus_tag LOCUS_35230 202444 201755 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_35230 203447 202413 gene locus_tag LOCUS_35240 203447 202413 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_35240 204109 205254 gene locus_tag LOCUS_35250 204109 205254 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091593875.1 protein_id gnl|my_center|LOCUS_35250 205517 206371 gene locus_tag LOCUS_35260 gene hisG 205517 206371 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_35260 206382 207683 gene locus_tag LOCUS_35270 gene hisD 206382 207683 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_35270 207690 208739 gene locus_tag LOCUS_35280 gene hisC 207690 208739 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_35280 208740 209873 gene locus_tag LOCUS_35290 gene hisB 208740 209873 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_35290 210086 211498 gene locus_tag LOCUS_35300 210086 211498 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_35300 211501 212070 gene locus_tag LOCUS_35310 211501 212070 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_35310 212108 213097 gene locus_tag LOCUS_35320 gene trpD 212108 213097 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_35320 213094 213885 gene locus_tag LOCUS_35330 gene trpC 213094 213885 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_35330 213882 214502 gene locus_tag LOCUS_35340 213882 214502 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_35340 214509 215714 gene locus_tag LOCUS_35350 gene trpB 214509 215714 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_35350 215721 216491 gene locus_tag LOCUS_35360 gene trpA 215721 216491 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_35360 216494 217087 gene locus_tag LOCUS_35370 gene hisH 216494 217087 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_35370 217084 218226 gene locus_tag LOCUS_35380 217084 218226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 218229 218984 gene locus_tag LOCUS_35390 gene hisF 218229 218984 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_35390 219024 219623 gene locus_tag LOCUS_35400 gene hisIE 219024 219623 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963101.1 protein_id gnl|my_center|LOCUS_35400 219620 220705 gene locus_tag LOCUS_35410 219620 220705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 220780 221928 gene locus_tag LOCUS_35420 220780 221928 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_35420 222332 223474 gene locus_tag LOCUS_35430 222332 223474 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 protein_id gnl|my_center|LOCUS_35430 223495 223851 gene locus_tag LOCUS_35440 223495 223851 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764156.1 protein_id gnl|my_center|LOCUS_35440 223876 225783 gene locus_tag LOCUS_35450 223876 225783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 226935 225859 gene locus_tag LOCUS_35460 226935 225859 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_35460 227000 228364 gene locus_tag LOCUS_35470 227000 228364 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_35470 229657 228434 gene locus_tag LOCUS_35480 229657 228434 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_35480 230955 229657 gene locus_tag LOCUS_35490 230955 229657 CDS product DUF4270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107977.1 protein_id gnl|my_center|LOCUS_35490 231215 232237 gene locus_tag LOCUS_35500 231215 232237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 232230 232532 gene locus_tag LOCUS_35510 232230 232532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 232712 233854 gene locus_tag LOCUS_35520 232712 233854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 233829 234521 gene locus_tag LOCUS_35530 233829 234521 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_35530 235748 234621 gene locus_tag LOCUS_35540 235748 234621 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_35540 237253 235871 gene locus_tag LOCUS_35550 gene glmM 237253 235871 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_35550 237423 239444 gene locus_tag LOCUS_35560 237423 239444 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268477.1 protein_id gnl|my_center|LOCUS_35560 239460 240209 gene locus_tag LOCUS_35570 239460 240209 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_35570 240209 240790 gene locus_tag LOCUS_35580 240209 240790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 240787 241521 gene locus_tag LOCUS_35590 240787 241521 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130094389.1 protein_id gnl|my_center|LOCUS_35590 241548 242834 gene locus_tag LOCUS_35600 241548 242834 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_35600 243125 244648 gene locus_tag LOCUS_35610 243125 244648 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_35610 244686 245414 gene locus_tag LOCUS_35620 gene fabG 244686 245414 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_35620 245496 246716 gene locus_tag LOCUS_35630 245496 246716 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_35630 246832 247089 gene locus_tag LOCUS_35640 246832 247089 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_35640 247089 247970 gene locus_tag LOCUS_35650 247089 247970 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_35650 247981 248397 gene locus_tag LOCUS_35660 247981 248397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 248414 249067 gene locus_tag LOCUS_35670 248414 249067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 249095 249520 gene locus_tag LOCUS_35680 249095 249520 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_35680 249517 250653 gene locus_tag LOCUS_35690 249517 250653 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_35690 250679 251746 gene locus_tag LOCUS_35700 250679 251746 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 protein_id gnl|my_center|LOCUS_35700 251767 253020 gene locus_tag LOCUS_35710 251767 253020 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_35710 253020 253640 gene locus_tag LOCUS_35720 253020 253640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_35720 253642 253905 gene locus_tag LOCUS_35730 253642 253905 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_35730 253902 255098 gene locus_tag LOCUS_35740 253902 255098 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_35740 255161 256210 gene locus_tag LOCUS_35750 255161 256210 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_35750 256204 256977 gene locus_tag LOCUS_35760 256204 256977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 256988 257602 gene locus_tag LOCUS_35770 256988 257602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 257796 258203 gene locus_tag LOCUS_35780 257796 258203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 258203 258565 gene locus_tag LOCUS_35790 258203 258565 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_35790 258568 259767 gene locus_tag LOCUS_35800 258568 259767 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_35800 259777 263646 gene locus_tag LOCUS_35810 259777 263646 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_35810 263639 265147 gene locus_tag LOCUS_35820 263639 265147 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_35820 265151 266827 gene locus_tag LOCUS_35830 265151 266827 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_35830 266824 267186 gene locus_tag LOCUS_35840 gene acpS 266824 267186 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048318.1 protein_id gnl|my_center|LOCUS_35840 267198 268490 gene locus_tag LOCUS_35850 267198 268490 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_35850 268980 268492 gene locus_tag LOCUS_35860 268980 268492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 269050 269640 gene locus_tag LOCUS_35870 269050 269640 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_35870 269647 271968 gene locus_tag LOCUS_35880 269647 271968 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_35880 272849 272289 gene locus_tag LOCUS_35890 272849 272289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 273613 273422 gene locus_tag LOCUS_35900 273613 273422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 274486 273617 gene locus_tag LOCUS_35910 274486 273617 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_35910 274734 275318 gene locus_tag LOCUS_35920 274734 275318 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_35920 275395 276426 gene locus_tag LOCUS_35930 275395 276426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 276473 279889 gene locus_tag LOCUS_35940 276473 279889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_35940 279917 281551 gene locus_tag LOCUS_35950 279917 281551 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797527.1 protein_id gnl|my_center|LOCUS_35950 282603 281725 gene locus_tag LOCUS_35960 282603 281725 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_35960 282802 283839 gene locus_tag LOCUS_35970 282802 283839 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_35970 284736 287924 gene locus_tag LOCUS_35980 284736 287924 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_35980 287959 289650 gene locus_tag LOCUS_35990 287959 289650 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786951.1 protein_id gnl|my_center|LOCUS_35990 289793 290284 gene locus_tag LOCUS_36000 289793 290284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36000 290274 291599 gene locus_tag LOCUS_36010 290274 291599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36010 292188 295475 gene locus_tag LOCUS_36020 292188 295475 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_36020 295494 297185 gene locus_tag LOCUS_36030 295494 297185 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786951.1 protein_id gnl|my_center|LOCUS_36030 300094 297497 gene locus_tag LOCUS_36040 gene mutS 300094 297497 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_36040 300181 300717 gene locus_tag LOCUS_36050 300181 300717 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_36050 300721 301593 gene locus_tag LOCUS_36060 gene ubiA 300721 301593 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_36060 301609 302010 gene locus_tag LOCUS_36070 gene ruvX 301609 302010 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_36070 302063 302641 gene locus_tag LOCUS_36080 gene def 302063 302641 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_36080 302755 303306 gene locus_tag LOCUS_36090 302755 303306 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027261.1 protein_id gnl|my_center|LOCUS_36090 303315 304166 gene locus_tag LOCUS_36100 303315 304166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 304227 305141 gene locus_tag LOCUS_36110 304227 305141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 306899 305211 gene locus_tag LOCUS_36120 306899 305211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 307971 307006 gene locus_tag LOCUS_36130 307971 307006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 308995 308069 gene locus_tag LOCUS_36140 308995 308069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 310339 309536 gene locus_tag LOCUS_36150 310339 309536 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223236.1 protein_id gnl|my_center|LOCUS_36150 311486 310641 gene locus_tag LOCUS_36160 311486 310641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 312010 316113 gene locus_tag LOCUS_36170 312010 316113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 317258 316194 gene locus_tag LOCUS_36180 317258 316194 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_36180 317304 318035 gene locus_tag LOCUS_36190 gene lipB 317304 318035 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_36190 318709 318032 gene locus_tag LOCUS_36200 318709 318032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 319776 318871 gene locus_tag LOCUS_36210 319776 318871 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_36210 322081 319760 gene locus_tag LOCUS_36220 322081 319760 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_36220 323488 322118 gene locus_tag LOCUS_36230 323488 322118 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_36230 323803 324648 gene locus_tag LOCUS_36240 323803 324648 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_36240 324654 325721 gene locus_tag LOCUS_36250 324654 325721 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925592.1 protein_id gnl|my_center|LOCUS_36250 326165 327067 gene locus_tag LOCUS_36260 326165 327067 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_36260 327327 329006 gene locus_tag LOCUS_36270 gene ilvD 327327 329006 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_36270 328996 330723 gene locus_tag LOCUS_36280 gene ilvB 328996 330723 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_36280 330750 331292 gene locus_tag LOCUS_36290 gene ilvN 330750 331292 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_36290 331342 332385 gene locus_tag LOCUS_36300 gene ilvC 331342 332385 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_36300 332518 333774 gene locus_tag LOCUS_36310 gene ilvA 332518 333774 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250222.1 protein_id gnl|my_center|LOCUS_36310 333989 335182 gene locus_tag LOCUS_36320 333989 335182 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191163231.1 protein_id gnl|my_center|LOCUS_36320 335197 337656 gene locus_tag LOCUS_36330 335197 337656 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_36330 337676 339145 gene locus_tag LOCUS_36340 337676 339145 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_36340 339282 340925 gene locus_tag LOCUS_36350 339282 340925 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_36350 340963 342453 gene locus_tag LOCUS_36360 340963 342453 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_36360 342466 343794 gene locus_tag LOCUS_36370 gene xylA 342466 343794 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_36370 343809 344744 gene locus_tag LOCUS_36380 343809 344744 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_36380 344815 345000 gene locus_tag LOCUS_36390 344815 345000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 345179 345877 gene locus_tag LOCUS_36400 345179 345877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 347169 345943 gene locus_tag LOCUS_36410 347169 345943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 348453 347377 gene locus_tag LOCUS_36420 348453 347377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 349027 348476 gene locus_tag LOCUS_36430 349027 348476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 349176 349388 gene locus_tag LOCUS_36440 349176 349388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 350687 351517 gene locus_tag LOCUS_36450 350687 351517 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_36450 351540 352724 gene locus_tag LOCUS_36460 351540 352724 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_36460 352721 353563 gene locus_tag LOCUS_36470 352721 353563 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_36470 353601 354686 gene locus_tag LOCUS_36480 353601 354686 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_36480 354709 355734 gene locus_tag LOCUS_36490 gene aroB 354709 355734 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_36490 355737 357014 gene locus_tag LOCUS_36500 gene aroA 355737 357014 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249218.1 protein_id gnl|my_center|LOCUS_36500 357020 358015 gene locus_tag LOCUS_36510 gene aroC 357020 358015 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_36510 358313 358864 gene locus_tag LOCUS_36520 358313 358864 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_36520 358857 359978 gene locus_tag LOCUS_36530 358857 359978 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_36530 360050 363715 gene locus_tag LOCUS_36540 360050 363715 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108737.1 protein_id gnl|my_center|LOCUS_36540 363888 365228 gene locus_tag LOCUS_36550 363888 365228 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750838.1 protein_id gnl|my_center|LOCUS_36550 365258 366085 gene locus_tag LOCUS_36560 365258 366085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 366185 368329 gene locus_tag LOCUS_36570 366185 368329 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_36570 368357 369541 gene locus_tag LOCUS_36580 368357 369541 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_36580 369605 370585 gene locus_tag LOCUS_36590 369605 370585 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_36590 371431 370718 gene locus_tag LOCUS_36600 371431 370718 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_36600 372168 371467 gene locus_tag LOCUS_36610 372168 371467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 374120 372198 gene locus_tag LOCUS_36620 374120 372198 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_36620 374172 374681 gene locus_tag LOCUS_36630 374172 374681 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_36630 374741 376264 gene locus_tag LOCUS_36640 374741 376264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 376350 377057 gene locus_tag LOCUS_36650 376350 377057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 377502 378326 gene locus_tag LOCUS_36660 377502 378326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 378328 379005 gene locus_tag LOCUS_36670 378328 379005 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207180.1 protein_id gnl|my_center|LOCUS_36670 379008 380330 gene locus_tag LOCUS_36680 379008 380330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 383346 380596 gene locus_tag LOCUS_36690 383346 380596 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_36690 386607 383725 gene locus_tag LOCUS_36700 gene gcvP 386607 383725 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089349.1 protein_id gnl|my_center|LOCUS_36700 386783 387274 gene locus_tag LOCUS_36710 386783 387274 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775131.1 protein_id gnl|my_center|LOCUS_36710 388538 387282 gene locus_tag LOCUS_36720 gene nreB 388538 387282 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_36720 388670 389851 gene locus_tag LOCUS_36730 388670 389851 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_36730 390074 392203 gene locus_tag LOCUS_36740 390074 392203 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_36740 393985 392279 gene locus_tag LOCUS_36750 393985 392279 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_36750 395331 393988 gene locus_tag LOCUS_36760 395331 393988 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_36760 396165 395341 gene locus_tag LOCUS_36770 396165 395341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 397680 396187 gene locus_tag LOCUS_36780 397680 396187 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_36780 400946 397692 gene locus_tag LOCUS_36790 400946 397692 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769257.1 protein_id gnl|my_center|LOCUS_36790 402271 401189 gene locus_tag LOCUS_36800 402271 401189 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_36800 402926 402366 gene locus_tag LOCUS_36810 402926 402366 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_36810 403935 402985 gene locus_tag LOCUS_36820 403935 402985 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_36820 405284 404049 gene locus_tag LOCUS_36830 405284 404049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 405470 406267 gene locus_tag LOCUS_36840 405470 406267 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_36840 406290 406682 gene locus_tag LOCUS_36850 406290 406682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 407786 406683 gene locus_tag LOCUS_36860 407786 406683 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198339.1 protein_id gnl|my_center|LOCUS_36860 407984 408397 gene locus_tag LOCUS_36870 407984 408397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 408417 408815 gene locus_tag LOCUS_36880 408417 408815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 409943 409170 gene locus_tag LOCUS_36890 409943 409170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 410382 410858 gene locus_tag LOCUS_36900 410382 410858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 411296 411700 gene locus_tag LOCUS_36910 411296 411700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 412522 411929 gene locus_tag LOCUS_36920 412522 411929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 412695 413483 gene locus_tag LOCUS_36930 412695 413483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 413573 414316 gene locus_tag LOCUS_36940 413573 414316 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_36940 415704 414415 gene locus_tag LOCUS_36950 gene hemL 415704 414415 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_36950 416730 415717 gene locus_tag LOCUS_36960 gene hemB 416730 415717 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962216.1 protein_id gnl|my_center|LOCUS_36960 417620 416715 gene locus_tag LOCUS_36970 gene hemF 417620 416715 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_36970 418650 417622 gene locus_tag LOCUS_36980 gene hemE 418650 417622 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_36980 419366 418647 gene locus_tag LOCUS_36990 419366 418647 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_36990 420276 419356 gene locus_tag LOCUS_37000 gene hemC 420276 419356 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962224.1 protein_id gnl|my_center|LOCUS_37000 421536 420283 gene locus_tag LOCUS_37010 gene hemA 421536 420283 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_37010 421848 422891 gene locus_tag LOCUS_37020 gene hemH 421848 422891 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768824.1 protein_id gnl|my_center|LOCUS_37020 423030 424163 gene locus_tag LOCUS_37030 423030 424163 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_37030 424192 424500 gene locus_tag LOCUS_37040 424192 424500 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401030.1 protein_id gnl|my_center|LOCUS_37040 424507 426075 gene locus_tag LOCUS_37050 424507 426075 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813039.1 protein_id gnl|my_center|LOCUS_37050 426136 427485 gene locus_tag LOCUS_37060 426136 427485 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_37060 427624 428661 gene locus_tag LOCUS_37070 427624 428661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 429631 428729 gene locus_tag LOCUS_37080 gene fmt 429631 428729 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_37080 430826 429666 gene locus_tag LOCUS_37090 430826 429666 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_37090 430926 431354 gene locus_tag LOCUS_37100 430926 431354 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_37100 431430 432680 gene locus_tag LOCUS_37110 gene pepT 431430 432680 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_37110 432754 433473 gene locus_tag LOCUS_37120 432754 433473 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_37120 433536 433913 gene locus_tag LOCUS_37130 433536 433913 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_37130 434831 433971 gene locus_tag LOCUS_37140 gene prmC 434831 433971 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_37140 434901 435920 gene locus_tag LOCUS_37150 gene ribD 434901 435920 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_37150 435930 436526 gene locus_tag LOCUS_37160 435930 436526 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_37160 437735 436527 gene locus_tag LOCUS_37170 437735 436527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_37170 437932 438005 gene locus_tag LOCUS_t00400 437932 438005 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 438283 439047 gene locus_tag LOCUS_37180 438283 439047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 439790 439590 gene locus_tag LOCUS_37190 439790 439590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 440884 439844 gene locus_tag LOCUS_37200 440884 439844 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_37200 441076 442140 gene locus_tag LOCUS_37210 441076 442140 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_37210 442194 442278 gene locus_tag LOCUS_t00410 442194 442278 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 442365 442619 gene locus_tag LOCUS_37220 442365 442619 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972003.1 protein_id gnl|my_center|LOCUS_37220 442622 442879 gene locus_tag LOCUS_37230 gene yoeB 442622 442879 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_37230 442976 443060 gene locus_tag LOCUS_t00420 442976 443060 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 443197 444510 gene locus_tag LOCUS_37240 443197 444510 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157499.1 protein_id gnl|my_center|LOCUS_37240 444574 445215 gene locus_tag LOCUS_37250 444574 445215 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_37250 445482 446123 gene locus_tag LOCUS_37260 445482 446123 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784472.1 protein_id gnl|my_center|LOCUS_37260 446197 446796 gene locus_tag LOCUS_37270 446197 446796 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763514.1 protein_id gnl|my_center|LOCUS_37270 447877 446867 gene locus_tag LOCUS_37280 447877 446867 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_37280 449052 447874 gene locus_tag LOCUS_37290 449052 447874 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_37290 449127 449564 gene locus_tag LOCUS_37300 449127 449564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 450427 449627 gene locus_tag LOCUS_37310 gene pyrF 450427 449627 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_37310 450620 451405 gene locus_tag LOCUS_37320 450620 451405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 451436 452806 gene locus_tag LOCUS_37330 451436 452806 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_37330 453476 452850 gene locus_tag LOCUS_37340 gene paiB 453476 452850 CDS product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 protein_id gnl|my_center|LOCUS_37340 453647 453976 gene locus_tag LOCUS_37350 453647 453976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 455070 453973 gene locus_tag LOCUS_37360 455070 453973 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_37360 455219 455818 gene locus_tag LOCUS_37370 455219 455818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 455881 456771 gene locus_tag LOCUS_37380 455881 456771 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_37380 457853 456855 gene locus_tag LOCUS_37390 gene glsA 457853 456855 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883017.1 protein_id gnl|my_center|LOCUS_37390 459099 457873 gene locus_tag LOCUS_37400 459099 457873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 460627 459176 gene locus_tag LOCUS_37410 460627 459176 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_37410 462053 460662 gene locus_tag LOCUS_37420 462053 460662 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_37420 463311 462346 gene locus_tag LOCUS_37430 463311 462346 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_37430 463704 463510 gene locus_tag LOCUS_37440 463704 463510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 465322 463901 gene locus_tag LOCUS_37450 465322 463901 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_37450 465449 467680 gene locus_tag LOCUS_37460 465449 467680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 467685 468575 gene locus_tag LOCUS_37470 467685 468575 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398525.1 protein_id gnl|my_center|LOCUS_37470 469288 468653 gene locus_tag LOCUS_37480 469288 468653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 470400 469417 gene locus_tag LOCUS_37490 gene egtD 470400 469417 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_37490 471585 470404 gene locus_tag LOCUS_37500 gene egtB 471585 470404 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_37500 473131 471587 gene locus_tag LOCUS_37510 473131 471587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 473859 473128 gene locus_tag LOCUS_37520 473859 473128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210802.1 protein_id gnl|my_center|LOCUS_37520 475220 473856 gene locus_tag LOCUS_37530 475220 473856 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402863.1 protein_id gnl|my_center|LOCUS_37530 476654 475611 gene locus_tag LOCUS_37540 476654 475611 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_37540 476751 477971 gene locus_tag LOCUS_37550 476751 477971 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_37550 477997 479157 gene locus_tag LOCUS_37560 gene uxuA 477997 479157 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_37560 479280 480485 gene locus_tag LOCUS_37570 479280 480485 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080561929.1 protein_id gnl|my_center|LOCUS_37570 480594 481265 gene locus_tag LOCUS_37580 480594 481265 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_37580 482183 481266 gene locus_tag LOCUS_37590 482183 481266 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_37590 484173 482254 gene locus_tag LOCUS_37600 484173 482254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 487520 484170 gene locus_tag LOCUS_37610 487520 484170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 490885 487517 gene locus_tag LOCUS_37620 490885 487517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 491367 492137 gene locus_tag LOCUS_37630 491367 492137 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113677801.1 protein_id gnl|my_center|LOCUS_37630 492362 493189 gene locus_tag LOCUS_37640 492362 493189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 493260 493892 gene locus_tag LOCUS_37650 493260 493892 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078670810.1 protein_id gnl|my_center|LOCUS_37650 494579 497665 gene locus_tag LOCUS_37660 494579 497665 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_37660 497698 499155 gene locus_tag LOCUS_37670 497698 499155 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_37670 499414 500736 gene locus_tag LOCUS_37680 gene hemL 499414 500736 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456470.1 protein_id gnl|my_center|LOCUS_37680 500733 501911 gene locus_tag LOCUS_37690 gene dgoD 500733 501911 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_37690 501936 502694 gene locus_tag LOCUS_37700 501936 502694 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_37700 502710 504098 gene locus_tag LOCUS_37710 502710 504098 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_37710 504095 505666 gene locus_tag LOCUS_37720 504095 505666 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_37720 506021 506341 gene locus_tag LOCUS_37730 506021 506341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 >Feature sequence20 1802 345 gene locus_tag LOCUS_37740 1802 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 1986 2864 gene locus_tag LOCUS_37750 1986 2864 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_37750 3146 5569 gene locus_tag LOCUS_37760 3146 5569 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109335.1 protein_id gnl|my_center|LOCUS_37760 5604 5957 gene locus_tag LOCUS_37770 5604 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 5991 7139 gene locus_tag LOCUS_37780 5991 7139 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762717.1 protein_id gnl|my_center|LOCUS_37780 7217 8302 gene locus_tag LOCUS_37790 7217 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 8368 8826 gene locus_tag LOCUS_37800 8368 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 8849 10207 gene locus_tag LOCUS_37810 8849 10207 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 protein_id gnl|my_center|LOCUS_37810 10399 11982 gene locus_tag LOCUS_37820 10399 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 13358 12039 gene locus_tag LOCUS_37830 13358 12039 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_37830 13900 13490 gene locus_tag LOCUS_37840 13900 13490 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_37840 14476 13913 gene locus_tag LOCUS_37850 14476 13913 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_37850 15255 14473 gene locus_tag LOCUS_37860 15255 14473 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_37860 15954 15322 gene locus_tag LOCUS_37870 15954 15322 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_37870 17142 15973 gene locus_tag LOCUS_37880 gene pncB 17142 15973 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022501.1 protein_id gnl|my_center|LOCUS_37880 18734 17187 gene locus_tag LOCUS_37890 18734 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 19503 18970 gene locus_tag LOCUS_37900 19503 18970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 19788 20477 gene locus_tag LOCUS_37910 19788 20477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 20656 24750 gene locus_tag LOCUS_37920 20656 24750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 24905 27799 gene locus_tag LOCUS_37930 24905 27799 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036929.1 protein_id gnl|my_center|LOCUS_37930 27976 31044 gene locus_tag LOCUS_37940 27976 31044 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_37940 31070 32647 gene locus_tag LOCUS_37950 31070 32647 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_37950 33493 32705 gene locus_tag LOCUS_37960 33493 32705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 34547 33564 gene locus_tag LOCUS_37970 34547 33564 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 protein_id gnl|my_center|LOCUS_37970 34866 35468 gene locus_tag LOCUS_37980 34866 35468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 35508 36266 gene locus_tag LOCUS_37990 35508 36266 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_37990 38541 36235 gene locus_tag LOCUS_38000 38541 36235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 40049 38547 gene locus_tag LOCUS_38010 40049 38547 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921534.1 protein_id gnl|my_center|LOCUS_38010 40209 41105 gene locus_tag LOCUS_38020 40209 41105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 41173 42087 gene locus_tag LOCUS_38030 41173 42087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 42890 42078 gene locus_tag LOCUS_38040 42890 42078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 43061 45655 gene locus_tag LOCUS_38050 43061 45655 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166522727.1 protein_id gnl|my_center|LOCUS_38050 46156 45656 gene locus_tag LOCUS_38060 46156 45656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 48701 46317 gene locus_tag LOCUS_38070 48701 46317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_38070 49874 48819 gene locus_tag LOCUS_38080 49874 48819 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 protein_id gnl|my_center|LOCUS_38080 50853 49918 gene locus_tag LOCUS_38090 50853 49918 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146242.1 protein_id gnl|my_center|LOCUS_38090 51323 50913 gene locus_tag LOCUS_38100 51323 50913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 52258 51335 gene locus_tag LOCUS_38110 52258 51335 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063868.1 protein_id gnl|my_center|LOCUS_38110 52957 52262 gene locus_tag LOCUS_38120 52957 52262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 53526 55685 gene locus_tag LOCUS_38130 53526 55685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 57459 56023 gene locus_tag LOCUS_38140 gene aroP 57459 56023 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378543.1 protein_id gnl|my_center|LOCUS_38140 57868 58155 gene locus_tag LOCUS_38150 57868 58155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 58115 58618 gene locus_tag LOCUS_38160 58115 58618 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969809.1 protein_id gnl|my_center|LOCUS_38160 58630 59490 gene locus_tag LOCUS_38170 58630 59490 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969623.1 protein_id gnl|my_center|LOCUS_38170 59644 60339 gene locus_tag LOCUS_38180 59644 60339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 60410 61132 gene locus_tag LOCUS_38190 60410 61132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 61213 63699 gene locus_tag LOCUS_38200 61213 63699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 63887 66547 gene locus_tag LOCUS_38210 63887 66547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 66630 67361 gene locus_tag LOCUS_38220 66630 67361 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_38220 67456 68310 gene locus_tag LOCUS_38230 67456 68310 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919448.1 protein_id gnl|my_center|LOCUS_38230 68414 69082 gene locus_tag LOCUS_38240 68414 69082 CDS product DUF4184 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963374.1 protein_id gnl|my_center|LOCUS_38240 69129 69530 gene locus_tag LOCUS_38250 69129 69530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 70290 69547 gene locus_tag LOCUS_38260 70290 69547 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038619.1 protein_id gnl|my_center|LOCUS_38260 71920 70424 gene locus_tag LOCUS_38270 71920 70424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 73078 72014 gene locus_tag LOCUS_38280 73078 72014 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_38280 73506 73168 gene locus_tag LOCUS_38290 73506 73168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 75143 73674 gene locus_tag LOCUS_38300 75143 73674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 75312 76268 gene locus_tag LOCUS_38310 75312 76268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 76403 76618 gene locus_tag LOCUS_38320 76403 76618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 76632 77639 gene locus_tag LOCUS_38330 76632 77639 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_38330 77713 78183 gene locus_tag LOCUS_38340 77713 78183 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_38340 78333 79112 gene locus_tag LOCUS_38350 78333 79112 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_38350 79531 79193 gene locus_tag LOCUS_38360 79531 79193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 80544 79789 gene locus_tag LOCUS_38370 80544 79789 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393266.1 protein_id gnl|my_center|LOCUS_38370 81565 80789 gene locus_tag LOCUS_38380 81565 80789 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098249.1 protein_id gnl|my_center|LOCUS_38380 82015 82830 gene locus_tag LOCUS_38390 82015 82830 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172953.1 protein_id gnl|my_center|LOCUS_38390 83342 82902 gene locus_tag LOCUS_38400 83342 82902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 87116 83361 gene locus_tag LOCUS_38410 87116 83361 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929092.1 protein_id gnl|my_center|LOCUS_38410 89094 87331 gene locus_tag LOCUS_38420 89094 87331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 89949 89215 gene locus_tag LOCUS_38430 89949 89215 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766589.1 protein_id gnl|my_center|LOCUS_38430 90206 93346 gene locus_tag LOCUS_38440 90206 93346 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765284.1 protein_id gnl|my_center|LOCUS_38440 93464 95296 gene locus_tag LOCUS_38450 93464 95296 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767204.1 protein_id gnl|my_center|LOCUS_38450 95317 96510 gene locus_tag LOCUS_38460 95317 96510 CDS product DUF4959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108515.1 protein_id gnl|my_center|LOCUS_38460 96536 97732 gene locus_tag LOCUS_38470 96536 97732 CDS product DUF4998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767186.1 protein_id gnl|my_center|LOCUS_38470 97782 99116 gene locus_tag LOCUS_38480 97782 99116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 99126 99971 gene locus_tag LOCUS_38490 99126 99971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 100380 100967 gene locus_tag LOCUS_38500 100380 100967 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764449.1 protein_id gnl|my_center|LOCUS_38500 101025 101981 gene locus_tag LOCUS_38510 101025 101981 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_38510 102013 105351 gene locus_tag LOCUS_38520 102013 105351 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202338.1 protein_id gnl|my_center|LOCUS_38520 105382 106932 gene locus_tag LOCUS_38530 105382 106932 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785902.1 protein_id gnl|my_center|LOCUS_38530 107471 107115 gene locus_tag LOCUS_38540 107471 107115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 107979 107545 gene locus_tag LOCUS_38550 107979 107545 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_38550 108443 108021 gene locus_tag LOCUS_38560 108443 108021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 108863 108645 gene locus_tag LOCUS_38570 108863 108645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 109541 109287 gene locus_tag LOCUS_38580 109541 109287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 109895 109554 gene locus_tag LOCUS_38590 109895 109554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 112147 109907 gene locus_tag LOCUS_38600 112147 109907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 112420 113022 gene locus_tag LOCUS_38610 112420 113022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 113847 113101 gene locus_tag LOCUS_38620 113847 113101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 114059 114472 gene locus_tag LOCUS_38630 114059 114472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 114645 116378 gene locus_tag LOCUS_38640 114645 116378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_38640 116498 116902 gene locus_tag LOCUS_38650 116498 116902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 117067 117516 gene locus_tag LOCUS_38660 117067 117516 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530517.1 protein_id gnl|my_center|LOCUS_38660 117976 119076 gene locus_tag LOCUS_38670 117976 119076 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_38670 120581 119085 gene locus_tag LOCUS_38680 120581 119085 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 protein_id gnl|my_center|LOCUS_38680 120647 122512 gene locus_tag LOCUS_38690 gene btuB 120647 122512 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 protein_id gnl|my_center|LOCUS_38690 122685 123782 gene locus_tag LOCUS_38700 122685 123782 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_38700 123833 124174 gene locus_tag LOCUS_38710 123833 124174 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_38710 124201 124755 gene locus_tag LOCUS_38720 124201 124755 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243497.1 protein_id gnl|my_center|LOCUS_38720 125905 125129 gene locus_tag LOCUS_38730 125905 125129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 126689 127363 gene locus_tag LOCUS_38740 126689 127363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 128165 127479 gene locus_tag LOCUS_38750 128165 127479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 129680 128481 gene locus_tag LOCUS_38760 129680 128481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 130032 129946 gene locus_tag LOCUS_t00430 130032 129946 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 130198 130125 gene locus_tag LOCUS_t00440 130198 130125 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 131106 130279 gene locus_tag LOCUS_38770 131106 130279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 131130 132227 gene locus_tag LOCUS_38780 131130 132227 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919988.1 protein_id gnl|my_center|LOCUS_38780 132295 133299 gene locus_tag LOCUS_38790 132295 133299 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928862.1 protein_id gnl|my_center|LOCUS_38790 133316 134095 gene locus_tag LOCUS_38800 133316 134095 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_38800 134116 134745 gene locus_tag LOCUS_38810 gene can 134116 134745 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_38810 134757 135272 gene locus_tag LOCUS_38820 134757 135272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 137582 135324 gene locus_tag LOCUS_38830 137582 135324 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_38830 137781 138506 gene locus_tag LOCUS_38840 gene mazG 137781 138506 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_38840 138512 142273 gene locus_tag LOCUS_38850 138512 142273 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_38850 142336 142863 gene locus_tag LOCUS_38860 142336 142863 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986783.1 protein_id gnl|my_center|LOCUS_38860 143896 142934 gene locus_tag LOCUS_38870 gene plsX 143896 142934 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_38870 144139 143945 gene locus_tag LOCUS_38880 gene rpmF 144139 143945 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_38880 144709 144170 gene locus_tag LOCUS_38890 144709 144170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 144908 147376 gene locus_tag LOCUS_38900 144908 147376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 148260 147373 gene locus_tag LOCUS_38910 148260 147373 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 protein_id gnl|my_center|LOCUS_38910 148284 149366 gene locus_tag LOCUS_38920 148284 149366 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_38920 150381 149434 gene locus_tag LOCUS_38930 gene rocF 150381 149434 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226959.1 protein_id gnl|my_center|LOCUS_38930 151553 150414 gene locus_tag LOCUS_38940 151553 150414 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_38940 151755 152429 gene locus_tag LOCUS_38950 151755 152429 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_38950 152439 153668 gene locus_tag LOCUS_38960 152439 153668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 153831 154016 gene locus_tag LOCUS_38970 153831 154016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 154080 155300 gene locus_tag LOCUS_38980 154080 155300 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_38980 156312 155776 gene locus_tag LOCUS_38990 gene dcd 156312 155776 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_38990 156380 157021 gene locus_tag LOCUS_39000 156380 157021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 157042 157524 gene locus_tag LOCUS_39010 157042 157524 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963564.1 protein_id gnl|my_center|LOCUS_39010 157517 157903 gene locus_tag LOCUS_39020 157517 157903 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269203.1 protein_id gnl|my_center|LOCUS_39020 158076 159155 gene locus_tag LOCUS_39030 158076 159155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 159198 161825 gene locus_tag LOCUS_39040 159198 161825 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_39040 161927 162586 gene locus_tag LOCUS_39050 161927 162586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 162745 164151 gene locus_tag LOCUS_39060 gene lpdA 162745 164151 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_39060 164282 166447 gene locus_tag LOCUS_39070 164282 166447 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_39070 166572 167156 gene locus_tag LOCUS_39080 166572 167156 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_39080 167269 168423 gene locus_tag LOCUS_39090 167269 168423 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_39090 168632 172081 gene locus_tag LOCUS_39100 168632 172081 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_39100 172092 173612 gene locus_tag LOCUS_39110 172092 173612 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750838.1 protein_id gnl|my_center|LOCUS_39110 173634 174770 gene locus_tag LOCUS_39120 173634 174770 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_39120 176115 175222 gene locus_tag LOCUS_39130 176115 175222 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201850.1 protein_id gnl|my_center|LOCUS_39130 177636 176149 gene locus_tag LOCUS_39140 177636 176149 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_39140 177758 178663 gene locus_tag LOCUS_39150 177758 178663 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838160.1 protein_id gnl|my_center|LOCUS_39150 179262 178720 gene locus_tag LOCUS_39160 179262 178720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 180777 179326 gene locus_tag LOCUS_39170 180777 179326 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_39170 182266 180872 gene locus_tag LOCUS_39180 182266 180872 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_39180 185961 182278 gene locus_tag LOCUS_39190 185961 182278 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106605886.1 protein_id gnl|my_center|LOCUS_39190 186972 186019 gene locus_tag LOCUS_39200 186972 186019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 187623 187024 gene locus_tag LOCUS_39210 187623 187024 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801526.1 protein_id gnl|my_center|LOCUS_39210 188239 187739 gene locus_tag LOCUS_39220 188239 187739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 188779 188252 gene locus_tag LOCUS_39230 188779 188252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 190529 188892 gene locus_tag LOCUS_39240 gene groL 190529 188892 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_39240 190862 190578 gene locus_tag LOCUS_39250 190862 190578 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_39250 191160 192089 gene locus_tag LOCUS_39260 gene nusB 191160 192089 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_39260 192100 192543 gene locus_tag LOCUS_39270 192100 192543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 192580 192936 gene locus_tag LOCUS_39280 192580 192936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 193007 193594 gene locus_tag LOCUS_39290 gene coaE 193007 193594 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_39290 193619 194260 gene locus_tag LOCUS_39300 193619 194260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 195746 194556 gene locus_tag LOCUS_39310 195746 194556 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108289.1 protein_id gnl|my_center|LOCUS_39310 196576 195869 gene locus_tag LOCUS_39320 196576 195869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 197829 196633 gene locus_tag LOCUS_39330 197829 196633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 198054 201206 gene locus_tag LOCUS_39340 gene secDF 198054 201206 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_39340 202328 201984 gene locus_tag LOCUS_39350 202328 201984 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_39350 202461 205280 gene locus_tag LOCUS_39360 202461 205280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157307892.1 protein_id gnl|my_center|LOCUS_39360 205291 206343 gene locus_tag LOCUS_39370 205291 206343 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594900.1 protein_id gnl|my_center|LOCUS_39370 206831 206340 gene locus_tag LOCUS_39380 206831 206340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 209519 206883 gene locus_tag LOCUS_39390 209519 206883 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_39390 209731 210291 gene locus_tag LOCUS_39400 209731 210291 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_39400 210358 211491 gene locus_tag LOCUS_39410 210358 211491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 211734 215042 gene locus_tag LOCUS_39420 211734 215042 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303104.1 protein_id gnl|my_center|LOCUS_39420 215065 216555 gene locus_tag LOCUS_39430 215065 216555 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108730.1 protein_id gnl|my_center|LOCUS_39430 216574 217338 gene locus_tag LOCUS_39440 216574 217338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 217356 218867 gene locus_tag LOCUS_39450 217356 218867 CDS product PKD-like family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055219209.1 protein_id gnl|my_center|LOCUS_39450 218945 220306 gene locus_tag LOCUS_39460 218945 220306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 220698 221234 gene locus_tag LOCUS_39470 220698 221234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 222370 221354 gene locus_tag LOCUS_39480 222370 221354 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_39480 222763 223620 gene locus_tag LOCUS_39490 222763 223620 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_39490 223783 224628 gene locus_tag LOCUS_39500 223783 224628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 224674 225621 gene locus_tag LOCUS_39510 gene trxB 224674 225621 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_39510 225675 226025 gene locus_tag LOCUS_39520 225675 226025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 226129 226884 gene locus_tag LOCUS_39530 226129 226884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 228230 226896 gene locus_tag LOCUS_39540 228230 226896 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788174.1 protein_id gnl|my_center|LOCUS_39540 228396 229271 gene locus_tag LOCUS_39550 228396 229271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 229262 229825 gene locus_tag LOCUS_39560 gene rsmD 229262 229825 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_39560 229836 230318 gene locus_tag LOCUS_39570 gene coaD 229836 230318 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_39570 230324 230773 gene locus_tag LOCUS_39580 230324 230773 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932987.1 protein_id gnl|my_center|LOCUS_39580 231493 230774 gene locus_tag LOCUS_39590 231493 230774 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942220.1 protein_id gnl|my_center|LOCUS_39590 232125 231496 gene locus_tag LOCUS_39600 232125 231496 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_39600 232173 232808 gene locus_tag LOCUS_39610 gene pyrE 232173 232808 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_39610 232863 233237 gene locus_tag LOCUS_39620 232863 233237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 234562 234819 gene locus_tag LOCUS_39630 234562 234819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 235445 235056 gene locus_tag LOCUS_39640 235445 235056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 236071 236481 gene locus_tag LOCUS_39650 236071 236481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 236779 238176 gene locus_tag LOCUS_39660 236779 238176 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_39660 238790 239134 gene locus_tag LOCUS_39670 238790 239134 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840149.1 protein_id gnl|my_center|LOCUS_39670 239996 239136 gene locus_tag LOCUS_39680 239996 239136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 240592 240152 gene locus_tag LOCUS_39690 240592 240152 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_39690 240815 241228 gene locus_tag LOCUS_39700 240815 241228 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_39700 241372 242655 gene locus_tag LOCUS_39710 241372 242655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 242655 243086 gene locus_tag LOCUS_39720 242655 243086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 243112 244119 gene locus_tag LOCUS_39730 243112 244119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 244319 246883 gene locus_tag LOCUS_39740 244319 246883 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_39740 247109 247609 gene locus_tag LOCUS_39750 247109 247609 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_39750 247606 248142 gene locus_tag LOCUS_39760 247606 248142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 248132 249202 gene locus_tag LOCUS_39770 248132 249202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 249233 249955 gene locus_tag LOCUS_39780 249233 249955 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_39780 249987 251144 gene locus_tag LOCUS_39790 249987 251144 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_39790 251428 251198 gene locus_tag LOCUS_39800 251428 251198 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_39800 251855 251586 gene locus_tag LOCUS_39810 251855 251586 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_39810 252197 251904 gene locus_tag LOCUS_39820 252197 251904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 253126 253135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 254205 253972 gene locus_tag LOCUS_39830 254205 253972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 254999 254400 gene locus_tag LOCUS_39840 254999 254400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 255968 255168 gene locus_tag LOCUS_39850 gene tpiA 255968 255168 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_39850 257135 255969 gene locus_tag LOCUS_39860 257135 255969 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_39860 257458 257204 gene locus_tag LOCUS_39870 257458 257204 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_39870 258013 257522 gene locus_tag LOCUS_39880 258013 257522 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939267.1 protein_id gnl|my_center|LOCUS_39880 260386 258146 gene locus_tag LOCUS_39890 260386 258146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 260956 260558 gene locus_tag LOCUS_39900 260956 260558 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_39900 261932 261030 gene locus_tag LOCUS_39910 261932 261030 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_39910 262668 262051 gene locus_tag LOCUS_39920 262668 262051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402939.1 protein_id gnl|my_center|LOCUS_39920 263580 262708 gene locus_tag LOCUS_39930 263580 262708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 265965 263599 gene locus_tag LOCUS_39940 265965 263599 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_39940 266500 266291 gene locus_tag LOCUS_39950 266500 266291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 266595 267587 gene locus_tag LOCUS_39960 266595 267587 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 protein_id gnl|my_center|LOCUS_39960 268775 267915 gene locus_tag LOCUS_39970 268775 267915 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 protein_id gnl|my_center|LOCUS_39970 269240 268830 gene locus_tag LOCUS_39980 269240 268830 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_39980 269842 269303 gene locus_tag LOCUS_39990 gene cysC 269842 269303 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_39990 270618 269839 gene locus_tag LOCUS_40000 270618 269839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 271816 270602 gene locus_tag LOCUS_40010 271816 270602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 273421 271895 gene locus_tag LOCUS_40020 273421 271895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 274426 273461 gene locus_tag LOCUS_40030 274426 273461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 275485 274502 gene locus_tag LOCUS_40040 275485 274502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 277891 275666 gene locus_tag LOCUS_40050 277891 275666 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_40050 279518 278016 gene locus_tag LOCUS_40060 279518 278016 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_40060 280141 279602 gene locus_tag LOCUS_40070 280141 279602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 280642 280172 gene locus_tag LOCUS_40080 280642 280172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 281920 280736 gene locus_tag LOCUS_40090 gene nhaA 281920 280736 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963884.1 protein_id gnl|my_center|LOCUS_40090 283573 281942 gene locus_tag LOCUS_40100 283573 281942 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_40100 284580 283585 gene locus_tag LOCUS_40110 284580 283585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 285972 284677 gene locus_tag LOCUS_40120 285972 284677 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_40120 286200 288896 gene locus_tag LOCUS_40130 286200 288896 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_40130 289725 289141 gene locus_tag LOCUS_40140 289725 289141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 289953 290114 gene locus_tag LOCUS_40150 289953 290114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 290228 290479 gene locus_tag LOCUS_40160 290228 290479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 291227 290487 gene locus_tag LOCUS_40170 291227 290487 CDS product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003918527.1 protein_id gnl|my_center|LOCUS_40170 291415 292437 gene locus_tag LOCUS_40180 291415 292437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 293323 293249 gene locus_tag LOCUS_t00450 293323 293249 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 293418 294089 gene locus_tag LOCUS_40190 gene ung 293418 294089 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106436.1 protein_id gnl|my_center|LOCUS_40190 294133 294876 gene locus_tag LOCUS_40200 294133 294876 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_40200 295244 294867 gene locus_tag LOCUS_40210 295244 294867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 296059 295313 gene locus_tag LOCUS_40220 296059 295313 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_40220 296261 297535 gene locus_tag LOCUS_40230 296261 297535 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_40230 297558 300980 gene locus_tag LOCUS_40240 297558 300980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 301203 301403 gene locus_tag LOCUS_40250 301203 301403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 301981 301427 gene locus_tag LOCUS_40260 gene msrA 301981 301427 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434146.1 protein_id gnl|my_center|LOCUS_40260 302312 304417 gene locus_tag LOCUS_40270 302312 304417 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963184.1 protein_id gnl|my_center|LOCUS_40270 304489 305376 gene locus_tag LOCUS_40280 304489 305376 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 protein_id gnl|my_center|LOCUS_40280 305828 306868 gene locus_tag LOCUS_40290 305828 306868 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_40290 307009 310113 gene locus_tag LOCUS_40300 307009 310113 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_40300 310131 311537 gene locus_tag LOCUS_40310 310131 311537 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_40310 311910 312458 gene locus_tag LOCUS_40320 311910 312458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 312565 315000 gene locus_tag LOCUS_40330 312565 315000 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073096256.1 protein_id gnl|my_center|LOCUS_40330 315171 315256 gene locus_tag LOCUS_t00460 315171 315256 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 315794 315882 gene locus_tag LOCUS_t00470 315794 315882 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 316027 318168 gene locus_tag LOCUS_40340 316027 318168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202044.1 protein_id gnl|my_center|LOCUS_40340 318287 318895 gene locus_tag LOCUS_40350 318287 318895 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_40350 318972 320138 gene locus_tag LOCUS_40360 318972 320138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 320431 323694 gene locus_tag LOCUS_40370 320431 323694 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_40370 323719 325170 gene locus_tag LOCUS_40380 323719 325170 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_40380 325185 327179 gene locus_tag LOCUS_40390 325185 327179 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_40390 328816 327569 gene locus_tag LOCUS_40400 328816 327569 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392000.1 protein_id gnl|my_center|LOCUS_40400 329874 328813 gene locus_tag LOCUS_40410 329874 328813 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_40410 331313 329928 gene locus_tag LOCUS_40420 331313 329928 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750838.1 protein_id gnl|my_center|LOCUS_40420 334843 331325 gene locus_tag LOCUS_40430 334843 331325 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108737.1 protein_id gnl|my_center|LOCUS_40430 335861 334866 gene locus_tag LOCUS_40440 335861 334866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 336493 335948 gene locus_tag LOCUS_40450 336493 335948 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765767.1 protein_id gnl|my_center|LOCUS_40450 336693 337157 gene locus_tag LOCUS_40460 336693 337157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 337252 338730 gene locus_tag LOCUS_40470 337252 338730 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328020.1 protein_id gnl|my_center|LOCUS_40470 338943 340214 gene locus_tag LOCUS_40480 338943 340214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 340227 340766 gene locus_tag LOCUS_40490 340227 340766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 341467 340877 gene locus_tag LOCUS_40500 341467 340877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 341945 341478 gene locus_tag LOCUS_40510 341945 341478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 342843 342100 gene locus_tag LOCUS_40520 342843 342100 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_40520 343855 342848 gene locus_tag LOCUS_40530 343855 342848 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_40530 344079 344164 gene locus_tag LOCUS_t00480 344079 344164 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 344472 345053 gene locus_tag LOCUS_40540 344472 345053 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_40540 345178 345765 gene locus_tag LOCUS_40550 345178 345765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 346042 346551 gene locus_tag LOCUS_40560 346042 346551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 346562 346993 gene locus_tag LOCUS_40570 346562 346993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 347681 347100 gene locus_tag LOCUS_40580 347681 347100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 348163 347720 gene locus_tag LOCUS_40590 348163 347720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 348672 348169 gene locus_tag LOCUS_40600 348672 348169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 348845 349834 gene locus_tag LOCUS_40610 348845 349834 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448438.1 protein_id gnl|my_center|LOCUS_40610 350698 349916 gene locus_tag LOCUS_40620 350698 349916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 351217 350888 gene locus_tag LOCUS_40630 351217 350888 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_40630 351381 351851 gene locus_tag LOCUS_40640 351381 351851 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 protein_id gnl|my_center|LOCUS_40640 352871 351858 gene locus_tag LOCUS_40650 352871 351858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 353661 352888 gene locus_tag LOCUS_40660 353661 352888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 354452 353697 gene locus_tag LOCUS_40670 354452 353697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 355269 354553 gene locus_tag LOCUS_40680 355269 354553 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_40680 355380 355793 gene locus_tag LOCUS_40690 355380 355793 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_40690 355903 357312 gene locus_tag LOCUS_40700 355903 357312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 357815 357381 gene locus_tag LOCUS_40710 357815 357381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 358677 357868 gene locus_tag LOCUS_40720 358677 357868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 358867 361326 gene locus_tag LOCUS_40730 358867 361326 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849784.1 protein_id gnl|my_center|LOCUS_40730 361999 361397 gene locus_tag LOCUS_40740 361999 361397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 362187 362690 gene locus_tag LOCUS_40750 362187 362690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 362711 363376 gene locus_tag LOCUS_40760 362711 363376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 363388 364128 gene locus_tag LOCUS_40770 363388 364128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 364183 364851 gene locus_tag LOCUS_40780 364183 364851 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966222.1 protein_id gnl|my_center|LOCUS_40780 365811 364852 gene locus_tag LOCUS_40790 365811 364852 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_40790 365913 366287 gene locus_tag LOCUS_40800 365913 366287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 366346 368748 gene locus_tag LOCUS_40810 366346 368748 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_40810 368869 371793 gene locus_tag LOCUS_40820 368869 371793 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_40820 371845 372411 gene locus_tag LOCUS_40830 371845 372411 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_40830 372457 372801 gene locus_tag LOCUS_40840 372457 372801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 372798 373322 gene locus_tag LOCUS_40850 372798 373322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 373349 373744 gene locus_tag LOCUS_40860 373349 373744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 373868 375340 gene locus_tag LOCUS_40870 gene cls 373868 375340 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435010.1 protein_id gnl|my_center|LOCUS_40870 375729 376487 gene locus_tag LOCUS_40880 375729 376487 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126919401.1 protein_id gnl|my_center|LOCUS_40880 376619 377104 gene locus_tag LOCUS_40890 376619 377104 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_40890 377877 378485 gene locus_tag LOCUS_40900 377877 378485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 378535 379791 gene locus_tag LOCUS_40910 378535 379791 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_40910 379794 380690 gene locus_tag LOCUS_40920 379794 380690 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_40920 380697 381611 gene locus_tag LOCUS_40930 380697 381611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 381608 382339 gene locus_tag LOCUS_40940 381608 382339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 382343 383449 gene locus_tag LOCUS_40950 382343 383449 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_40950 383449 384564 gene locus_tag LOCUS_40960 383449 384564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_40960 386042 384630 gene locus_tag LOCUS_40970 386042 384630 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299143.1 protein_id gnl|my_center|LOCUS_40970 386136 386606 gene locus_tag LOCUS_40980 386136 386606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 386603 387073 gene locus_tag LOCUS_40990 386603 387073 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_40990 387261 388688 gene locus_tag LOCUS_41000 387261 388688 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948036.1 protein_id gnl|my_center|LOCUS_41000 388800 389681 gene locus_tag LOCUS_41010 gene yedA 388800 389681 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212262.1 protein_id gnl|my_center|LOCUS_41010 389668 390603 gene locus_tag LOCUS_41020 389668 390603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 390590 391030 gene locus_tag LOCUS_41030 390590 391030 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 protein_id gnl|my_center|LOCUS_41030 391131 391688 gene locus_tag LOCUS_41040 391131 391688 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_41040 391707 392483 gene locus_tag LOCUS_41050 gene rlmB 391707 392483 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_41050 392516 393361 gene locus_tag LOCUS_41060 392516 393361 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_41060 393387 394361 gene locus_tag LOCUS_41070 393387 394361 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_41070 395934 394441 gene locus_tag LOCUS_41080 395934 394441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 396048 398273 gene locus_tag LOCUS_41090 396048 398273 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203451.1 protein_id gnl|my_center|LOCUS_41090 398725 399471 gene locus_tag LOCUS_41100 398725 399471 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_41100 399713 402733 gene locus_tag LOCUS_41110 399713 402733 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_41110 402752 404095 gene locus_tag LOCUS_41120 402752 404095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 404771 404172 gene locus_tag LOCUS_41130 404771 404172 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_41130 404825 405928 gene locus_tag LOCUS_41140 404825 405928 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883676.1 protein_id gnl|my_center|LOCUS_41140 405976 406461 gene locus_tag LOCUS_41150 405976 406461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 406466 408880 gene locus_tag LOCUS_41160 406466 408880 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_41160 408981 409054 gene locus_tag LOCUS_t00490 408981 409054 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 410349 409129 gene locus_tag LOCUS_41170 410349 409129 CDS product DUF5677 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208386.1 protein_id gnl|my_center|LOCUS_41170 410767 410387 gene locus_tag LOCUS_41180 410767 410387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 410979 410812 gene locus_tag LOCUS_41190 410979 410812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 413942 411525 gene locus_tag LOCUS_41200 413942 411525 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_41200 414873 414001 gene locus_tag LOCUS_41210 gene fdhD 414873 414001 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_41210 416440 415142 gene locus_tag LOCUS_41220 416440 415142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 417228 416443 gene locus_tag LOCUS_41230 417228 416443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 417680 418060 gene locus_tag LOCUS_41240 417680 418060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 418188 418754 gene locus_tag LOCUS_41250 418188 418754 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970075.1 protein_id gnl|my_center|LOCUS_41250 420631 418826 gene locus_tag LOCUS_41260 420631 418826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 421071 420661 gene locus_tag LOCUS_41270 421071 420661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 421321 422748 gene locus_tag LOCUS_41280 421321 422748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247976.1 protein_id gnl|my_center|LOCUS_41280 422955 423731 gene locus_tag LOCUS_41290 422955 423731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 424179 425042 gene locus_tag LOCUS_41300 424179 425042 CDS product DUF4886 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119653.1 protein_id gnl|my_center|LOCUS_41300 425631 425122 gene locus_tag LOCUS_41310 425631 425122 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974220.1 protein_id gnl|my_center|LOCUS_41310 425948 425631 gene locus_tag LOCUS_41320 425948 425631 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_41320 426355 425969 gene locus_tag LOCUS_41330 426355 425969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 427512 426499 gene locus_tag LOCUS_41340 427512 426499 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_41340 427765 430926 gene locus_tag LOCUS_41350 427765 430926 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_41350 430974 432542 gene locus_tag LOCUS_41360 430974 432542 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_41360 432545 433435 gene locus_tag LOCUS_41370 432545 433435 CDS product DUF5017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108772.1 protein_id gnl|my_center|LOCUS_41370 433443 435125 gene locus_tag LOCUS_41380 433443 435125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 435122 437674 gene locus_tag LOCUS_41390 435122 437674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 437697 441035 gene locus_tag LOCUS_41400 437697 441035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 441032 442417 gene locus_tag LOCUS_41410 441032 442417 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 protein_id gnl|my_center|LOCUS_41410 442578 445352 gene locus_tag LOCUS_41420 442578 445352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 445362 447638 gene locus_tag LOCUS_41430 445362 447638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 448536 447754 gene locus_tag LOCUS_41440 448536 447754 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_41440 449191 448598 gene locus_tag LOCUS_41450 449191 448598 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_41450 449345 449932 gene locus_tag LOCUS_41460 449345 449932 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_41460 449999 451216 gene locus_tag LOCUS_41470 449999 451216 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_41470 451444 454740 gene locus_tag LOCUS_41480 451444 454740 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_41480 454751 456211 gene locus_tag LOCUS_41490 454751 456211 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_41490 456239 457006 gene locus_tag LOCUS_41500 456239 457006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 457036 457962 gene locus_tag LOCUS_41510 gene gldA 457036 457962 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_41510 458052 460289 gene locus_tag LOCUS_41520 458052 460289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 460365 461636 gene locus_tag LOCUS_41530 460365 461636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 461633 462952 gene locus_tag LOCUS_41540 461633 462952 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555764.1 protein_id gnl|my_center|LOCUS_41540 463022 464503 gene locus_tag LOCUS_41550 463022 464503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 465423 464668 gene locus_tag LOCUS_41560 gene lieB 465423 464668 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_41560 466194 465436 gene locus_tag LOCUS_41570 466194 465436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017474.1 protein_id gnl|my_center|LOCUS_41570 467185 466205 gene locus_tag LOCUS_41580 467185 466205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 469903 467546 gene locus_tag LOCUS_41590 469903 467546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 470006 470896 gene locus_tag LOCUS_41600 470006 470896 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_41600 471470 470913 gene locus_tag LOCUS_41610 471470 470913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_41610 472060 471593 gene locus_tag LOCUS_41620 472060 471593 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088958.1 protein_id gnl|my_center|LOCUS_41620 474297 472084 gene locus_tag LOCUS_41630 474297 472084 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_41630 474609 475733 gene locus_tag LOCUS_41640 474609 475733 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_41640 475742 476722 gene locus_tag LOCUS_41650 gene moaA 475742 476722 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119704.1 protein_id gnl|my_center|LOCUS_41650 476719 477312 gene locus_tag LOCUS_41660 476719 477312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 477316 478056 gene locus_tag LOCUS_41670 477316 478056 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_41670 478075 478302 gene locus_tag LOCUS_41680 478075 478302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 478334 478774 gene locus_tag LOCUS_41690 478334 478774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 479952 478789 gene locus_tag LOCUS_41700 479952 478789 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_41700 >Feature sequence21 830 483 gene locus_tag LOCUS_41710 830 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 1457 963 gene locus_tag LOCUS_41720 1457 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 2209 1538 gene locus_tag LOCUS_41730 2209 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 2629 3786 gene locus_tag LOCUS_41740 2629 3786 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_41740 4067 4804 gene locus_tag LOCUS_41750 4067 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41750 4838 5968 gene locus_tag LOCUS_41760 gene hppD 4838 5968 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_41760 7255 6053 gene locus_tag LOCUS_41770 7255 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 8659 7433 gene locus_tag LOCUS_41780 8659 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 10164 8818 gene locus_tag LOCUS_41790 10164 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 10418 11518 gene locus_tag LOCUS_41800 10418 11518 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_41800 11963 15034 gene locus_tag LOCUS_41810 11963 15034 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_41810 15052 16524 gene locus_tag LOCUS_41820 15052 16524 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_41820 16545 17657 gene locus_tag LOCUS_41830 16545 17657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 17757 18983 gene locus_tag LOCUS_41840 17757 18983 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_41840 20153 19323 gene locus_tag LOCUS_41850 20153 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 22017 20176 gene locus_tag LOCUS_41860 22017 20176 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790751.1 protein_id gnl|my_center|LOCUS_41860 25372 22031 gene locus_tag LOCUS_41870 25372 22031 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764281.1 protein_id gnl|my_center|LOCUS_41870 26838 25636 gene locus_tag LOCUS_41880 26838 25636 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_41880 27427 26933 gene locus_tag LOCUS_41890 27427 26933 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_41890 27846 28658 gene locus_tag LOCUS_41900 27846 28658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 28767 28955 gene locus_tag LOCUS_41910 28767 28955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 29011 29331 gene locus_tag LOCUS_41920 29011 29331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 29482 30054 gene locus_tag LOCUS_41930 29482 30054 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_41930 30087 31781 gene locus_tag LOCUS_41940 30087 31781 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_41940 31857 33551 gene locus_tag LOCUS_41950 31857 33551 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_41950 34276 34716 gene locus_tag LOCUS_41960 34276 34716 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 protein_id gnl|my_center|LOCUS_41960 34894 35337 gene locus_tag LOCUS_41970 34894 35337 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554011.1 protein_id gnl|my_center|LOCUS_41970 35318 35956 gene locus_tag LOCUS_41980 35318 35956 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405105.1 protein_id gnl|my_center|LOCUS_41980 35994 36785 gene locus_tag LOCUS_41990 35994 36785 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257323.1 protein_id gnl|my_center|LOCUS_41990 36893 38632 gene locus_tag LOCUS_42000 gene nuoC 36893 38632 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090458.1 protein_id gnl|my_center|LOCUS_42000 38644 39108 gene locus_tag LOCUS_42010 gene nuoE 38644 39108 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090460.1 protein_id gnl|my_center|LOCUS_42010 39110 40426 gene locus_tag LOCUS_42020 gene nuoF 39110 40426 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 protein_id gnl|my_center|LOCUS_42020 40423 43122 gene locus_tag LOCUS_42030 gene nuoG 40423 43122 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113377.1 protein_id gnl|my_center|LOCUS_42030 43151 44104 gene locus_tag LOCUS_42040 gene nuoH 43151 44104 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705661.1 protein_id gnl|my_center|LOCUS_42040 44111 44626 gene locus_tag LOCUS_42050 gene nuoI 44111 44626 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172752.1 protein_id gnl|my_center|LOCUS_42050 44640 45167 gene locus_tag LOCUS_42060 gene nuoJ 44640 45167 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090473.1 protein_id gnl|my_center|LOCUS_42060 45164 45469 gene locus_tag LOCUS_42070 gene nuoK 45164 45469 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317980.1 protein_id gnl|my_center|LOCUS_42070 45500 47359 gene locus_tag LOCUS_42080 gene nuoL 45500 47359 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056611.1 protein_id gnl|my_center|LOCUS_42080 47378 48856 gene locus_tag LOCUS_42090 gene nuoM 47378 48856 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815944.1 protein_id gnl|my_center|LOCUS_42090 48866 50296 gene locus_tag LOCUS_42100 gene nuoN 48866 50296 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090482.1 protein_id gnl|my_center|LOCUS_42100 50485 51189 gene locus_tag LOCUS_42110 50485 51189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 51206 52048 gene locus_tag LOCUS_42120 51206 52048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 52269 55526 gene locus_tag LOCUS_42130 52269 55526 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_42130 56330 55596 gene locus_tag LOCUS_42140 56330 55596 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 protein_id gnl|my_center|LOCUS_42140 56977 56402 gene locus_tag LOCUS_42150 56977 56402 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_42150 57081 58859 gene locus_tag LOCUS_42160 57081 58859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 60680 58932 gene locus_tag LOCUS_42170 60680 58932 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_42170 63968 60699 gene locus_tag LOCUS_42180 63968 60699 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_42180 65899 64634 gene locus_tag LOCUS_42190 65899 64634 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_42190 66003 67061 gene locus_tag LOCUS_42200 gene fbp 66003 67061 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454699.1 protein_id gnl|my_center|LOCUS_42200 67076 67645 gene locus_tag LOCUS_42210 67076 67645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 67745 68509 gene locus_tag LOCUS_42220 67745 68509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_42220 68538 69068 gene locus_tag LOCUS_42230 gene bstA 68538 69068 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_42230 69072 69632 gene locus_tag LOCUS_42240 69072 69632 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791456.1 protein_id gnl|my_center|LOCUS_42240 70090 69656 gene locus_tag LOCUS_42250 70090 69656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 71488 70181 gene locus_tag LOCUS_42260 71488 70181 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_42260 72986 71499 gene locus_tag LOCUS_42270 72986 71499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 73937 73047 gene locus_tag LOCUS_42280 73937 73047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 74081 75346 gene locus_tag LOCUS_42290 74081 75346 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_42290 76756 75461 gene locus_tag LOCUS_42300 76756 75461 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_42300 77340 76753 gene locus_tag LOCUS_42310 77340 76753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 78379 77333 gene locus_tag LOCUS_42320 78379 77333 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_42320 78577 78915 gene locus_tag LOCUS_42330 78577 78915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 78998 81487 gene locus_tag LOCUS_42340 gene ccsA 78998 81487 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_42340 81568 82557 gene locus_tag LOCUS_42350 81568 82557 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_42350 82632 83204 gene locus_tag LOCUS_42360 82632 83204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 83267 83998 gene locus_tag LOCUS_42370 gene bshB1 83267 83998 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_42370 84467 84057 gene locus_tag LOCUS_42380 84467 84057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 84842 85066 gene locus_tag LOCUS_42390 84842 85066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 85119 85457 gene locus_tag LOCUS_42400 85119 85457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 85616 86038 gene locus_tag LOCUS_42410 85616 86038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 86363 86593 gene locus_tag LOCUS_42420 86363 86593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 86586 87014 gene locus_tag LOCUS_42430 86586 87014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 87499 87846 gene locus_tag LOCUS_42440 87499 87846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 87843 88010 gene locus_tag LOCUS_42450 87843 88010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 88420 88875 gene locus_tag LOCUS_42460 88420 88875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 90535 89267 gene locus_tag LOCUS_42470 90535 89267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 91350 91727 gene locus_tag LOCUS_42480 91350 91727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 92416 91778 gene locus_tag LOCUS_42490 92416 91778 CDS product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175643.1 protein_id gnl|my_center|LOCUS_42490 92576 93307 gene locus_tag LOCUS_42500 92576 93307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 95380 93533 gene locus_tag LOCUS_42510 95380 93533 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_42510 96040 95462 gene locus_tag LOCUS_42520 96040 95462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 96716 97270 gene locus_tag LOCUS_42530 96716 97270 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_42530 97350 97937 gene locus_tag LOCUS_42540 97350 97937 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220673.1 protein_id gnl|my_center|LOCUS_42540 98054 98293 gene locus_tag LOCUS_42550 gene rpmB 98054 98293 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002809459.1 protein_id gnl|my_center|LOCUS_42550 98335 98517 gene locus_tag LOCUS_42560 gene rpmG 98335 98517 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_42560 98616 98789 gene locus_tag LOCUS_42570 98616 98789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 98899 99861 gene locus_tag LOCUS_42580 gene ftsY 98899 99861 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_42580 100687 100160 gene locus_tag LOCUS_42590 100687 100160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 100837 101718 gene locus_tag LOCUS_42600 100837 101718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 101880 103187 gene locus_tag LOCUS_42610 gene rimO 101880 103187 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_42610 103260 105029 gene locus_tag LOCUS_42620 103260 105029 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_42620 105118 107106 gene locus_tag LOCUS_42630 gene glgB 105118 107106 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_42630 107394 108305 gene locus_tag LOCUS_42640 107394 108305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 108454 109011 gene locus_tag LOCUS_42650 108454 109011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 109193 111145 gene locus_tag LOCUS_42660 109193 111145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 111469 114681 gene locus_tag LOCUS_42670 111469 114681 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_42670 114687 116105 gene locus_tag LOCUS_42680 114687 116105 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_42680 116844 116179 gene locus_tag LOCUS_42690 116844 116179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275454.1 protein_id gnl|my_center|LOCUS_42690 117011 117421 gene locus_tag LOCUS_42700 117011 117421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 117464 118099 gene locus_tag LOCUS_42710 117464 118099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 118633 118106 gene locus_tag LOCUS_42720 118633 118106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 118688 119191 gene locus_tag LOCUS_42730 118688 119191 CDS product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779367.1 protein_id gnl|my_center|LOCUS_42730 119297 119228 gene locus_tag LOCUS_t00500 119297 119228 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 120521 119304 gene locus_tag LOCUS_42740 120521 119304 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947944.1 protein_id gnl|my_center|LOCUS_42740 123008 120615 gene locus_tag LOCUS_42750 123008 120615 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_42750 124316 123285 gene locus_tag LOCUS_42760 124316 123285 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_42760 124424 127549 gene locus_tag LOCUS_42770 124424 127549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 127634 128263 gene locus_tag LOCUS_42780 127634 128263 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_42780 128425 128967 gene locus_tag LOCUS_42790 128425 128967 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_42790 129035 130111 gene locus_tag LOCUS_42800 129035 130111 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138280268.1 protein_id gnl|my_center|LOCUS_42800 130252 134028 gene locus_tag LOCUS_42810 130252 134028 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106605886.1 protein_id gnl|my_center|LOCUS_42810 134047 135663 gene locus_tag LOCUS_42820 134047 135663 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_42820 136174 139290 gene locus_tag LOCUS_42830 136174 139290 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_42830 139310 141013 gene locus_tag LOCUS_42840 139310 141013 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_42840 142140 144038 gene locus_tag LOCUS_42850 142140 144038 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_42850 144066 144920 gene locus_tag LOCUS_42860 144066 144920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 144924 145325 gene locus_tag LOCUS_42870 144924 145325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 145350 147890 gene locus_tag LOCUS_42880 145350 147890 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_42880 148046 149425 gene locus_tag LOCUS_42890 148046 149425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 149443 150777 gene locus_tag LOCUS_42900 149443 150777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 150905 151441 gene locus_tag LOCUS_42910 150905 151441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 151494 151967 gene locus_tag LOCUS_42920 151494 151967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 152533 152021 gene locus_tag LOCUS_42930 152533 152021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 153528 152545 gene locus_tag LOCUS_42940 153528 152545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 154680 153562 gene locus_tag LOCUS_42950 154680 153562 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_42950 155633 154677 gene locus_tag LOCUS_42960 155633 154677 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_42960 156109 155630 gene locus_tag LOCUS_42970 156109 155630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 157371 156106 gene locus_tag LOCUS_42980 157371 156106 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_42980 157536 157610 gene locus_tag LOCUS_t00510 157536 157610 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 158283 158507 gene locus_tag LOCUS_42990 158283 158507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 159204 158617 gene locus_tag LOCUS_43000 159204 158617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 159362 160363 gene locus_tag LOCUS_43010 159362 160363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 160458 161549 gene locus_tag LOCUS_43020 160458 161549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123815508.1 protein_id gnl|my_center|LOCUS_43020 162824 161625 gene locus_tag LOCUS_43030 162824 161625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 163103 164293 gene locus_tag LOCUS_43040 163103 164293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 165614 164364 gene locus_tag LOCUS_43050 165614 164364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 166674 165670 gene locus_tag LOCUS_43060 166674 165670 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_43060 167593 166751 gene locus_tag LOCUS_43070 167593 166751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 168183 168671 gene locus_tag LOCUS_43080 gene asnC 168183 168671 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707730.1 protein_id gnl|my_center|LOCUS_43080 168718 169323 gene locus_tag LOCUS_43090 168718 169323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 172547 169320 gene locus_tag LOCUS_43100 172547 169320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 172732 174387 gene locus_tag LOCUS_43110 172732 174387 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_43110 175246 174389 gene locus_tag LOCUS_43120 175246 174389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 175662 175390 gene locus_tag LOCUS_43130 175662 175390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 175943 176521 gene locus_tag LOCUS_43140 175943 176521 CDS product 5'-nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208025.1 protein_id gnl|my_center|LOCUS_43140 176531 177088 gene locus_tag LOCUS_43150 176531 177088 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_43150 177081 177425 gene locus_tag LOCUS_43160 177081 177425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 177524 177814 gene locus_tag LOCUS_43170 177524 177814 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_43170 177832 178602 gene locus_tag LOCUS_43180 177832 178602 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142748.1 protein_id gnl|my_center|LOCUS_43180 178814 179089 gene locus_tag LOCUS_43190 178814 179089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 179322 182546 gene locus_tag LOCUS_43200 179322 182546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 182746 183144 gene locus_tag LOCUS_43210 182746 183144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 184096 183206 gene locus_tag LOCUS_43220 184096 183206 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_43220 184609 185172 gene locus_tag LOCUS_43230 184609 185172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 185652 185245 gene locus_tag LOCUS_43240 185652 185245 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640452.1 protein_id gnl|my_center|LOCUS_43240 185891 186421 gene locus_tag LOCUS_43250 185891 186421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 186672 188099 gene locus_tag LOCUS_43260 186672 188099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 188240 188662 gene locus_tag LOCUS_43270 188240 188662 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_43270 189670 188678 gene locus_tag LOCUS_43280 189670 188678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 189908 189786 gene locus_tag LOCUS_43290 189908 189786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 190236 190637 gene locus_tag LOCUS_43300 190236 190637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 191592 191068 gene locus_tag LOCUS_43310 191592 191068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 192050 191595 gene locus_tag LOCUS_43320 192050 191595 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783529.1 protein_id gnl|my_center|LOCUS_43320 192836 192144 gene locus_tag LOCUS_43330 192836 192144 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_43330 193022 194857 gene locus_tag LOCUS_43340 193022 194857 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784059.1 protein_id gnl|my_center|LOCUS_43340 194980 197832 gene locus_tag LOCUS_43350 194980 197832 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_43350 198052 198822 gene locus_tag LOCUS_43360 198052 198822 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_43360 200262 199252 gene locus_tag LOCUS_43370 200262 199252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 201518 200274 gene locus_tag LOCUS_43380 201518 200274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 204277 201530 gene locus_tag LOCUS_43390 204277 201530 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_43390 205282 204389 gene locus_tag LOCUS_43400 205282 204389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 205387 206223 gene locus_tag LOCUS_43410 205387 206223 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_43410 206234 206614 gene locus_tag LOCUS_43420 206234 206614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 206604 207104 gene locus_tag LOCUS_43430 206604 207104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_43430 207224 208411 gene locus_tag LOCUS_43440 207224 208411 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_43440 208797 208456 gene locus_tag LOCUS_43450 208797 208456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 209029 208769 gene locus_tag LOCUS_43460 209029 208769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 209140 209976 gene locus_tag LOCUS_43470 209140 209976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 210066 212207 gene locus_tag LOCUS_43480 210066 212207 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172660227.1 protein_id gnl|my_center|LOCUS_43480 212285 213802 gene locus_tag LOCUS_43490 212285 213802 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_43490 214952 213873 gene locus_tag LOCUS_43500 gene dinB 214952 213873 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974700.1 protein_id gnl|my_center|LOCUS_43500 215318 215004 gene locus_tag LOCUS_43510 215318 215004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 215422 215925 gene locus_tag LOCUS_43520 215422 215925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 217094 215934 gene locus_tag LOCUS_43530 217094 215934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 217303 217794 gene locus_tag LOCUS_43540 217303 217794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 218570 217878 gene locus_tag LOCUS_43550 218570 217878 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687920.1 protein_id gnl|my_center|LOCUS_43550 218677 219258 gene locus_tag LOCUS_43560 218677 219258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 protein_id gnl|my_center|LOCUS_43560 219350 221299 gene locus_tag LOCUS_43570 219350 221299 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_43570 221668 225726 gene locus_tag LOCUS_43580 221668 225726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 225925 229122 gene locus_tag LOCUS_43590 225925 229122 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_43590 229142 230791 gene locus_tag LOCUS_43600 229142 230791 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_43600 230813 232039 gene locus_tag LOCUS_43610 230813 232039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 232042 233787 gene locus_tag LOCUS_43620 232042 233787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 234586 234110 gene locus_tag LOCUS_43630 234586 234110 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_43630 234946 234638 gene locus_tag LOCUS_43640 234946 234638 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_43640 235381 234953 gene locus_tag LOCUS_43650 235381 234953 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_43650 236638 235394 gene locus_tag LOCUS_43660 236638 235394 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_43660 237974 236667 gene locus_tag LOCUS_43670 gene sufD 237974 236667 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194301.1 protein_id gnl|my_center|LOCUS_43670 238745 237978 gene locus_tag LOCUS_43680 gene sufC 238745 237978 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_43680 240208 238763 gene locus_tag LOCUS_43690 gene sufB 240208 238763 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_43690 240454 241110 gene locus_tag LOCUS_43700 240454 241110 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940263.1 protein_id gnl|my_center|LOCUS_43700 241501 241178 gene locus_tag LOCUS_43710 241501 241178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 241936 241580 gene locus_tag LOCUS_43720 241936 241580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 242070 242441 gene locus_tag LOCUS_43730 242070 242441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 242428 243024 gene locus_tag LOCUS_43740 242428 243024 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_43740 243058 244809 gene locus_tag LOCUS_43750 243058 244809 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_43750 244869 245900 gene locus_tag LOCUS_43760 244869 245900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 246778 245909 gene locus_tag LOCUS_43770 246778 245909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 247150 250161 gene locus_tag LOCUS_43780 247150 250161 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_43780 250188 251843 gene locus_tag LOCUS_43790 250188 251843 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_43790 251926 252966 gene locus_tag LOCUS_43800 251926 252966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 253191 254501 gene locus_tag LOCUS_43810 253191 254501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 254541 255548 gene locus_tag LOCUS_43820 254541 255548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 255579 257549 gene locus_tag LOCUS_43830 255579 257549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 257564 259138 gene locus_tag LOCUS_43840 257564 259138 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087120.1 protein_id gnl|my_center|LOCUS_43840 260216 259194 gene locus_tag LOCUS_43850 260216 259194 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230820.1 protein_id gnl|my_center|LOCUS_43850 263047 260234 gene locus_tag LOCUS_43860 263047 260234 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_43860 264963 263302 gene locus_tag LOCUS_43870 264963 263302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 265067 265861 gene locus_tag LOCUS_43880 265067 265861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 266482 265871 gene locus_tag LOCUS_43890 266482 265871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 267433 266651 gene locus_tag LOCUS_43900 267433 266651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 267882 267673 gene locus_tag LOCUS_43910 267882 267673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 268797 267898 gene locus_tag LOCUS_43920 268797 267898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 269663 268941 gene locus_tag LOCUS_43930 269663 268941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 269825 269898 gene locus_tag LOCUS_t00520 269825 269898 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 271053 270052 gene locus_tag LOCUS_43940 271053 270052 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 protein_id gnl|my_center|LOCUS_43940 272313 271105 gene locus_tag LOCUS_43950 272313 271105 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_43950 272441 273025 gene locus_tag LOCUS_43960 272441 273025 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_43960 273116 274372 gene locus_tag LOCUS_43970 273116 274372 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_43970 274487 278053 gene locus_tag LOCUS_43980 274487 278053 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_43980 278065 279585 gene locus_tag LOCUS_43990 278065 279585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 279603 280718 gene locus_tag LOCUS_44000 279603 280718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 280888 281367 gene locus_tag LOCUS_44010 280888 281367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 281782 281354 gene locus_tag LOCUS_44020 281782 281354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 282385 281897 gene locus_tag LOCUS_44030 282385 281897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 282482 283261 gene locus_tag LOCUS_44040 282482 283261 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765472.1 protein_id gnl|my_center|LOCUS_44040 283557 285731 gene locus_tag LOCUS_44050 283557 285731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 285755 286339 gene locus_tag LOCUS_44060 285755 286339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 286727 286999 gene locus_tag LOCUS_44070 286727 286999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 287459 288055 gene locus_tag LOCUS_44080 287459 288055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 288204 288689 gene locus_tag LOCUS_44090 288204 288689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 290032 288755 gene locus_tag LOCUS_44100 290032 288755 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_44100 290658 290086 gene locus_tag LOCUS_44110 290658 290086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 292069 290672 gene locus_tag LOCUS_44120 292069 290672 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247976.1 protein_id gnl|my_center|LOCUS_44120 292146 292559 gene locus_tag LOCUS_44130 292146 292559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 293126 292524 gene locus_tag LOCUS_44140 293126 292524 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_44140 293383 293841 gene locus_tag LOCUS_44150 293383 293841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 293909 296374 gene locus_tag LOCUS_44160 293909 296374 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_44160 296377 297621 gene locus_tag LOCUS_44170 296377 297621 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_44170 297726 301106 gene locus_tag LOCUS_44180 297726 301106 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_44180 301119 302651 gene locus_tag LOCUS_44190 301119 302651 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_44190 306218 302814 gene locus_tag LOCUS_44200 306218 302814 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_44200 307458 306316 gene locus_tag LOCUS_44210 307458 306316 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_44210 309092 307536 gene locus_tag LOCUS_44220 309092 307536 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_44220 309693 309097 gene locus_tag LOCUS_44230 309693 309097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 309791 309976 gene locus_tag LOCUS_44240 309791 309976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 310015 310443 gene locus_tag LOCUS_44250 310015 310443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 310517 311161 gene locus_tag LOCUS_44260 310517 311161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 311922 311155 gene locus_tag LOCUS_44270 311922 311155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 313142 312369 gene locus_tag LOCUS_44280 313142 312369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 313381 314907 gene locus_tag LOCUS_44290 313381 314907 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108692.1 protein_id gnl|my_center|LOCUS_44290 316414 314963 gene locus_tag LOCUS_44300 316414 314963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_44300 316628 316825 gene locus_tag LOCUS_44310 316628 316825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 316850 317584 gene locus_tag LOCUS_44320 316850 317584 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889003.1 protein_id gnl|my_center|LOCUS_44320 317631 318407 gene locus_tag LOCUS_44330 317631 318407 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345837.1 protein_id gnl|my_center|LOCUS_44330 318623 320812 gene locus_tag LOCUS_44340 318623 320812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 323120 320898 gene locus_tag LOCUS_44350 323120 320898 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_44350 327004 323207 gene locus_tag LOCUS_44360 327004 323207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 328283 327381 gene locus_tag LOCUS_44370 328283 327381 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_44370 328413 331844 gene locus_tag LOCUS_44380 328413 331844 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090339627.1 protein_id gnl|my_center|LOCUS_44380 331945 332802 gene locus_tag LOCUS_44390 331945 332802 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_44390 332806 333936 gene locus_tag LOCUS_44400 332806 333936 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_44400 335250 334018 gene locus_tag LOCUS_44410 335250 334018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 336923 335262 gene locus_tag LOCUS_44420 336923 335262 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_44420 340232 336948 gene locus_tag LOCUS_44430 340232 336948 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_44430 341344 340439 gene locus_tag LOCUS_44440 341344 340439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 341960 341421 gene locus_tag LOCUS_44450 341960 341421 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_44450 342062 342520 gene locus_tag LOCUS_44460 342062 342520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 343284 342517 gene locus_tag LOCUS_44470 343284 342517 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_44470 344342 343281 gene locus_tag LOCUS_44480 344342 343281 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 protein_id gnl|my_center|LOCUS_44480 345343 344357 gene locus_tag LOCUS_44490 345343 344357 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 protein_id gnl|my_center|LOCUS_44490 346128 345340 gene locus_tag LOCUS_44500 346128 345340 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_44500 346721 346125 gene locus_tag LOCUS_44510 346721 346125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 346940 347401 gene locus_tag LOCUS_44520 346940 347401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 347413 347649 gene locus_tag LOCUS_44530 347413 347649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 348239 347802 gene locus_tag LOCUS_44540 348239 347802 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526860.1 protein_id gnl|my_center|LOCUS_44540 348400 351108 gene locus_tag LOCUS_44550 348400 351108 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_44550 351401 351189 gene locus_tag LOCUS_44560 351401 351189 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_44560 352015 351401 gene locus_tag LOCUS_44570 352015 351401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 352602 352033 gene locus_tag LOCUS_44580 352602 352033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 353041 352589 gene locus_tag LOCUS_44590 353041 352589 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 protein_id gnl|my_center|LOCUS_44590 353946 354344 gene locus_tag LOCUS_44600 353946 354344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 354526 354308 gene locus_tag LOCUS_44610 354526 354308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 355176 354649 gene locus_tag LOCUS_44620 355176 354649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 355898 355221 gene locus_tag LOCUS_44630 355898 355221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 356124 357986 gene locus_tag LOCUS_44640 356124 357986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 358979 358227 gene locus_tag LOCUS_44650 358979 358227 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114678736.1 protein_id gnl|my_center|LOCUS_44650 359083 360144 gene locus_tag LOCUS_44660 359083 360144 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946868.1 protein_id gnl|my_center|LOCUS_44660 360416 374596 gene locus_tag LOCUS_44670 360416 374596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 375659 374670 gene locus_tag LOCUS_44680 375659 374670 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103700.1 protein_id gnl|my_center|LOCUS_44680 375942 377531 gene locus_tag LOCUS_44690 375942 377531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 377860 378129 gene locus_tag LOCUS_44700 377860 378129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 378200 380704 gene locus_tag LOCUS_44710 378200 380704 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 protein_id gnl|my_center|LOCUS_44710 380972 381301 gene locus_tag LOCUS_44720 380972 381301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 381425 382537 gene locus_tag LOCUS_44730 381425 382537 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_44730 382571 387115 gene locus_tag LOCUS_44740 382571 387115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 387782 387171 gene locus_tag LOCUS_44750 387782 387171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 388054 387842 gene locus_tag LOCUS_44760 388054 387842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 388380 388111 gene locus_tag LOCUS_44770 388380 388111 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_44770 390065 388404 gene locus_tag LOCUS_44780 390065 388404 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_44780 391480 390074 gene locus_tag LOCUS_44790 391480 390074 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223372.1 protein_id gnl|my_center|LOCUS_44790 393096 391858 gene locus_tag LOCUS_44800 393096 391858 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786305.1 protein_id gnl|my_center|LOCUS_44800 394456 393080 gene locus_tag LOCUS_44810 394456 393080 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_44810 395641 394475 gene locus_tag LOCUS_44820 395641 394475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44820 396889 395651 gene locus_tag LOCUS_44830 396889 395651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_44830 397573 396908 gene locus_tag LOCUS_44840 397573 396908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_44840 399026 397551 gene locus_tag LOCUS_44850 399026 397551 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_44850 400267 399023 gene locus_tag LOCUS_44860 400267 399023 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291923.1 protein_id gnl|my_center|LOCUS_44860 400464 402206 gene locus_tag LOCUS_44870 400464 402206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 402270 402905 gene locus_tag LOCUS_44880 402270 402905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 402917 403384 gene locus_tag LOCUS_44890 402917 403384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 403452 403982 gene locus_tag LOCUS_44900 403452 403982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 406328 404073 gene locus_tag LOCUS_44910 gene ggpS 406328 404073 CDS product glucosylglycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038150.1 protein_id gnl|my_center|LOCUS_44910 406511 408304 gene locus_tag LOCUS_44920 406511 408304 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_44920 408387 408950 gene locus_tag LOCUS_44930 408387 408950 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619543.1 protein_id gnl|my_center|LOCUS_44930 408957 409685 gene locus_tag LOCUS_44940 408957 409685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 409811 412249 gene locus_tag LOCUS_44950 409811 412249 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_44950 412357 413403 gene locus_tag LOCUS_44960 412357 413403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 413557 415056 gene locus_tag LOCUS_44970 413557 415056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 415346 415053 gene locus_tag LOCUS_44980 415346 415053 CDS product RNA polymerase alpha subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718625.1 protein_id gnl|my_center|LOCUS_44980 415403 415585 gene locus_tag LOCUS_44990 415403 415585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 415847 418375 gene locus_tag LOCUS_45000 415847 418375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 418378 419472 gene locus_tag LOCUS_45010 418378 419472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 419476 419967 gene locus_tag LOCUS_45020 419476 419967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 420018 427337 gene locus_tag LOCUS_45030 420018 427337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 427342 428124 gene locus_tag LOCUS_45040 427342 428124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 428195 437134 gene locus_tag LOCUS_45050 428195 437134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 437115 437543 gene locus_tag LOCUS_45060 437115 437543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 >Feature sequence22 <1 3741 gene locus_tag LOCUS_45070 <1 3741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein 3768 4784 gene locus_tag LOCUS_45080 3768 4784 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_45080 4815 6797 gene locus_tag LOCUS_45090 4815 6797 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_45090 6904 7566 gene locus_tag LOCUS_45100 6904 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 7726 8322 gene locus_tag LOCUS_45110 7726 8322 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_45110 8390 8986 gene locus_tag LOCUS_45120 8390 8986 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763535.1 protein_id gnl|my_center|LOCUS_45120 9067 10077 gene locus_tag LOCUS_45130 9067 10077 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785220.1 protein_id gnl|my_center|LOCUS_45130 10423 13860 gene locus_tag LOCUS_45140 10423 13860 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_45140 13887 15605 gene locus_tag LOCUS_45150 13887 15605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 15605 16786 gene locus_tag LOCUS_45160 15605 16786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 16806 17879 gene locus_tag LOCUS_45170 16806 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 17885 19129 gene locus_tag LOCUS_45180 17885 19129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 19152 20150 gene locus_tag LOCUS_45190 19152 20150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 20166 23435 gene locus_tag LOCUS_45200 20166 23435 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_45200 23461 25656 gene locus_tag LOCUS_45210 23461 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 26608 25724 gene locus_tag LOCUS_45220 26608 25724 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612250.1 protein_id gnl|my_center|LOCUS_45220 26706 27980 gene locus_tag LOCUS_45230 26706 27980 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267482.1 protein_id gnl|my_center|LOCUS_45230 28035 29678 gene locus_tag LOCUS_45240 28035 29678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 30913 29741 gene locus_tag LOCUS_45250 30913 29741 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_45250 33260 31008 gene locus_tag LOCUS_45260 33260 31008 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107588.1 protein_id gnl|my_center|LOCUS_45260 36094 33260 gene locus_tag LOCUS_45270 36094 33260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 37656 36157 gene locus_tag LOCUS_45280 37656 36157 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_45280 39123 37687 gene locus_tag LOCUS_45290 39123 37687 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_45290 40274 39123 gene locus_tag LOCUS_45300 40274 39123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 40737 40345 gene locus_tag LOCUS_45310 40737 40345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 41195 43807 gene locus_tag LOCUS_45320 41195 43807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 44165 45283 gene locus_tag LOCUS_45330 44165 45283 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120643.1 protein_id gnl|my_center|LOCUS_45330 45280 45948 gene locus_tag LOCUS_45340 45280 45948 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921908.1 protein_id gnl|my_center|LOCUS_45340 46856 46014 gene locus_tag LOCUS_45350 46856 46014 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784150.1 protein_id gnl|my_center|LOCUS_45350 47589 46972 gene locus_tag LOCUS_45360 47589 46972 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772562.1 protein_id gnl|my_center|LOCUS_45360 47745 48995 gene locus_tag LOCUS_45370 gene pgtP 47745 48995 CDS product phosphoglycerate transporter PgtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955756.1 protein_id gnl|my_center|LOCUS_45370 49024 51258 gene locus_tag LOCUS_45380 49024 51258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 51321 52145 gene locus_tag LOCUS_45390 51321 52145 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 protein_id gnl|my_center|LOCUS_45390 52872 52150 gene locus_tag LOCUS_45400 52872 52150 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222179.1 protein_id gnl|my_center|LOCUS_45400 57222 52927 gene locus_tag LOCUS_45410 57222 52927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 59107 57227 gene locus_tag LOCUS_45420 59107 57227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 59659 60222 gene locus_tag LOCUS_45430 59659 60222 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760068.1 protein_id gnl|my_center|LOCUS_45430 60263 61291 gene locus_tag LOCUS_45440 60263 61291 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_45440 61429 64464 gene locus_tag LOCUS_45450 61429 64464 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_45450 64489 65949 gene locus_tag LOCUS_45460 64489 65949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 65930 67330 gene locus_tag LOCUS_45470 65930 67330 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108981.1 protein_id gnl|my_center|LOCUS_45470 67327 68868 gene locus_tag LOCUS_45480 67327 68868 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_45480 69412 72567 gene locus_tag LOCUS_45490 69412 72567 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765284.1 protein_id gnl|my_center|LOCUS_45490 72586 74508 gene locus_tag LOCUS_45500 72586 74508 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108516.1 protein_id gnl|my_center|LOCUS_45500 74527 75717 gene locus_tag LOCUS_45510 74527 75717 CDS product DUF5000 domain-containing lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108677.1 protein_id gnl|my_center|LOCUS_45510 75736 76779 gene locus_tag LOCUS_45520 75736 76779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 77769 77029 gene locus_tag LOCUS_45530 77769 77029 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 protein_id gnl|my_center|LOCUS_45530 77952 77773 gene locus_tag LOCUS_45540 77952 77773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 79610 77958 gene locus_tag LOCUS_45550 79610 77958 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229498.1 protein_id gnl|my_center|LOCUS_45550 80835 79669 gene locus_tag LOCUS_45560 80835 79669 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 protein_id gnl|my_center|LOCUS_45560 83722 80846 gene locus_tag LOCUS_45570 83722 80846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 86565 83737 gene locus_tag LOCUS_45580 86565 83737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 87287 86565 gene locus_tag LOCUS_45590 87287 86565 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218129451.1 protein_id gnl|my_center|LOCUS_45590 87459 88352 gene locus_tag LOCUS_45600 87459 88352 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_45600 88552 89379 gene locus_tag LOCUS_45610 88552 89379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 91571 89442 gene locus_tag LOCUS_45620 91571 89442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 91881 93626 gene locus_tag LOCUS_45630 91881 93626 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_45630 93836 94465 gene locus_tag LOCUS_45640 93836 94465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 94744 95070 gene locus_tag LOCUS_45650 94744 95070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 95928 95071 gene locus_tag LOCUS_45660 95928 95071 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_45660 96751 97350 gene locus_tag LOCUS_45670 96751 97350 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404975.1 protein_id gnl|my_center|LOCUS_45670 97461 98660 gene locus_tag LOCUS_45680 97461 98660 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_45680 99012 102404 gene locus_tag LOCUS_45690 99012 102404 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_45690 102416 103849 gene locus_tag LOCUS_45700 102416 103849 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107856.1 protein_id gnl|my_center|LOCUS_45700 103929 104873 gene locus_tag LOCUS_45710 103929 104873 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_45710 104870 107080 gene locus_tag LOCUS_45720 104870 107080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 107315 108208 gene locus_tag LOCUS_45730 107315 108208 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224955.1 protein_id gnl|my_center|LOCUS_45730 108205 109377 gene locus_tag LOCUS_45740 108205 109377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 109397 110959 gene locus_tag LOCUS_45750 109397 110959 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766132.1 protein_id gnl|my_center|LOCUS_45750 111015 111386 gene locus_tag LOCUS_45760 111015 111386 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039139.1 protein_id gnl|my_center|LOCUS_45760 112259 111387 gene locus_tag LOCUS_45770 112259 111387 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432420.1 protein_id gnl|my_center|LOCUS_45770 112677 115244 gene locus_tag LOCUS_45780 112677 115244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 115265 117580 gene locus_tag LOCUS_45790 115265 117580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 118321 117725 gene locus_tag LOCUS_45800 118321 117725 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962260.1 protein_id gnl|my_center|LOCUS_45800 118420 118833 gene locus_tag LOCUS_45810 118420 118833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133558586.1 protein_id gnl|my_center|LOCUS_45810 118888 123213 gene locus_tag LOCUS_45820 118888 123213 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_45820 123216 124358 gene locus_tag LOCUS_45830 123216 124358 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_45830 124948 124460 gene locus_tag LOCUS_45840 124948 124460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 126387 124948 gene locus_tag LOCUS_45850 126387 124948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 126710 127114 gene locus_tag LOCUS_45860 126710 127114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 127220 127762 gene locus_tag LOCUS_45870 127220 127762 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_45870 127764 128585 gene locus_tag LOCUS_45880 127764 128585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 128996 130012 gene locus_tag LOCUS_45890 128996 130012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 130044 131069 gene locus_tag LOCUS_45900 130044 131069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 131089 132075 gene locus_tag LOCUS_45910 131089 132075 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_45910 132151 132354 gene locus_tag LOCUS_45920 132151 132354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 132621 133850 gene locus_tag LOCUS_45930 132621 133850 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_45930 134637 133924 gene locus_tag LOCUS_45940 134637 133924 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_45940 135839 134799 gene locus_tag LOCUS_45950 135839 134799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 139387 135857 gene locus_tag LOCUS_45960 139387 135857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 143480 139419 gene locus_tag LOCUS_45970 143480 139419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098509933.1 protein_id gnl|my_center|LOCUS_45970 145640 143484 gene locus_tag LOCUS_45980 145640 143484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 150380 145644 gene locus_tag LOCUS_45990 150380 145644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 152266 150395 gene locus_tag LOCUS_46000 152266 150395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 152795 153313 gene locus_tag LOCUS_46010 152795 153313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 153966 153316 gene locus_tag LOCUS_46020 153966 153316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 154651 153956 gene locus_tag LOCUS_46030 154651 153956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 154921 155679 gene locus_tag LOCUS_46040 154921 155679 CDS product DUF2314 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244131.1 protein_id gnl|my_center|LOCUS_46040 155718 156332 gene locus_tag LOCUS_46050 155718 156332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 156791 156216 gene locus_tag LOCUS_46060 156791 156216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 157668 156880 gene locus_tag LOCUS_46070 157668 156880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 158662 158390 gene locus_tag LOCUS_46080 158662 158390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 159399 159315 gene locus_tag LOCUS_t00530 159399 159315 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 160340 159528 gene locus_tag LOCUS_46090 160340 159528 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_46090 160428 160997 gene locus_tag LOCUS_46100 160428 160997 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 protein_id gnl|my_center|LOCUS_46100 161061 162026 gene locus_tag LOCUS_46110 161061 162026 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049100798.1 protein_id gnl|my_center|LOCUS_46110 162307 165648 gene locus_tag LOCUS_46120 162307 165648 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_46120 165668 167050 gene locus_tag LOCUS_46130 165668 167050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 168123 167122 gene locus_tag LOCUS_46140 168123 167122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 169102 168116 gene locus_tag LOCUS_46150 169102 168116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_46150 169340 169158 gene locus_tag LOCUS_46160 169340 169158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 169514 170644 gene locus_tag LOCUS_46170 169514 170644 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_46170 170641 171213 gene locus_tag LOCUS_46180 170641 171213 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_46180 171244 172665 gene locus_tag LOCUS_46190 171244 172665 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_46190 172701 173276 gene locus_tag LOCUS_46200 172701 173276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 173320 174231 gene locus_tag LOCUS_46210 gene miaA 173320 174231 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_46210 175877 174318 gene locus_tag LOCUS_46220 175877 174318 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_46220 177027 176002 gene locus_tag LOCUS_46230 177027 176002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 177357 178832 gene locus_tag LOCUS_46240 gene proS 177357 178832 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_46240 178851 181796 gene locus_tag LOCUS_46250 178851 181796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 181793 182554 gene locus_tag LOCUS_46260 181793 182554 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_46260 184521 182995 gene locus_tag LOCUS_46270 184521 182995 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_46270 185791 184778 gene locus_tag LOCUS_46280 185791 184778 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_46280 185883 186230 gene locus_tag LOCUS_46290 185883 186230 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_46290 186327 187325 gene locus_tag LOCUS_46300 186327 187325 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_46300 187341 188165 gene locus_tag LOCUS_46310 187341 188165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 188191 188499 gene locus_tag LOCUS_46320 188191 188499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 189149 188763 gene locus_tag LOCUS_46330 189149 188763 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_46330 190352 189159 gene locus_tag LOCUS_46340 190352 189159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 191173 190364 gene locus_tag LOCUS_46350 191173 190364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 192287 191184 gene locus_tag LOCUS_46360 192287 191184 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_46360 193273 192326 gene locus_tag LOCUS_46370 193273 192326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_46370 194044 193277 gene locus_tag LOCUS_46380 194044 193277 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259732.1 protein_id gnl|my_center|LOCUS_46380 194542 194087 gene locus_tag LOCUS_46390 194542 194087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 194619 195383 gene locus_tag LOCUS_46400 194619 195383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 198974 195720 gene locus_tag LOCUS_46410 198974 195720 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_46410 199283 200485 gene locus_tag LOCUS_46420 199283 200485 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_46420 205431 200614 gene locus_tag LOCUS_46430 205431 200614 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_46430 205552 206577 gene locus_tag LOCUS_46440 205552 206577 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_46440 206907 210152 gene locus_tag LOCUS_46450 206907 210152 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_46450 210172 211761 gene locus_tag LOCUS_46460 210172 211761 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766186.1 protein_id gnl|my_center|LOCUS_46460 211780 212475 gene locus_tag LOCUS_46470 211780 212475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 212508 213440 gene locus_tag LOCUS_46480 212508 213440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 214236 213511 gene locus_tag LOCUS_46490 214236 213511 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_46490 215329 214229 gene locus_tag LOCUS_46500 215329 214229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 217584 215413 gene locus_tag LOCUS_46510 217584 215413 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_46510 218632 217763 gene locus_tag LOCUS_46520 218632 217763 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_46520 219697 218639 gene locus_tag LOCUS_46530 219697 218639 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_46530 220115 219699 gene locus_tag LOCUS_46540 220115 219699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 220639 220112 gene locus_tag LOCUS_46550 220639 220112 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_46550 222363 220678 gene locus_tag LOCUS_46560 gene ggt 222363 220678 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_46560 222465 224957 gene locus_tag LOCUS_46570 222465 224957 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_46570 225632 225030 gene locus_tag LOCUS_46580 225632 225030 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 protein_id gnl|my_center|LOCUS_46580 226692 225715 gene locus_tag LOCUS_46590 226692 225715 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_46590 227775 226726 gene locus_tag LOCUS_46600 gene mltG 227775 226726 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_46600 228227 227859 gene locus_tag LOCUS_46610 gene secG 228227 227859 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_46610 229852 228254 gene locus_tag LOCUS_46620 229852 228254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 230411 229893 gene locus_tag LOCUS_46630 230411 229893 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_46630 231672 230419 gene locus_tag LOCUS_46640 231672 230419 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_46640 233105 231687 gene locus_tag LOCUS_46650 gene miaB 233105 231687 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552700.1 protein_id gnl|my_center|LOCUS_46650 233609 237328 gene locus_tag LOCUS_46660 233609 237328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 237450 237523 gene locus_tag LOCUS_t00540 237450 237523 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 238447 239049 gene locus_tag LOCUS_46670 238447 239049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 239145 239747 gene locus_tag LOCUS_46680 239145 239747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 239741 240181 gene locus_tag LOCUS_46690 239741 240181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 242485 241115 gene locus_tag LOCUS_46700 242485 241115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 243195 242683 gene locus_tag LOCUS_46710 243195 242683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_46710 244016 243228 gene locus_tag LOCUS_46720 244016 243228 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_46720 245310 244021 gene locus_tag LOCUS_46730 245310 244021 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_46730 245374 245871 gene locus_tag LOCUS_46740 245374 245871 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_46740 246824 245874 gene locus_tag LOCUS_46750 246824 245874 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_46750 248545 246824 gene locus_tag LOCUS_46760 248545 246824 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_46760 248643 249299 gene locus_tag LOCUS_46770 248643 249299 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_46770 252009 249430 gene locus_tag LOCUS_46780 252009 249430 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_46780 252922 252332 gene locus_tag LOCUS_46790 252922 252332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 253068 252994 gene locus_tag LOCUS_t00550 253068 252994 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 253497 253159 gene locus_tag LOCUS_46800 253497 253159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 253919 255127 gene locus_tag LOCUS_46810 253919 255127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 257725 255254 gene locus_tag LOCUS_46820 257725 255254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 257811 259055 gene locus_tag LOCUS_46830 257811 259055 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_46830 261043 259052 gene locus_tag LOCUS_46840 261043 259052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 261722 261129 gene locus_tag LOCUS_46850 261722 261129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 261902 262108 gene locus_tag LOCUS_46860 261902 262108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 262810 262187 gene locus_tag LOCUS_46870 262810 262187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46870 263308 262814 gene locus_tag LOCUS_46880 gene folK 263308 262814 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_46880 263390 265141 gene locus_tag LOCUS_46890 gene sppA 263390 265141 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_46890 265219 266004 gene locus_tag LOCUS_46900 265219 266004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 266524 266186 gene locus_tag LOCUS_46910 266524 266186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 266813 267850 gene locus_tag LOCUS_46920 266813 267850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_46920 267878 268423 gene locus_tag LOCUS_46930 267878 268423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 268520 268999 gene locus_tag LOCUS_46940 268520 268999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 270687 269356 gene locus_tag LOCUS_46950 gene bioA 270687 269356 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_46950 270840 271139 gene locus_tag LOCUS_46960 270840 271139 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786368.1 protein_id gnl|my_center|LOCUS_46960 271161 271532 gene locus_tag LOCUS_46970 271161 271532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 271544 271774 gene locus_tag LOCUS_46980 271544 271774 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786366.1 protein_id gnl|my_center|LOCUS_46980 271786 272658 gene locus_tag LOCUS_46990 271786 272658 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_46990 272668 273375 gene locus_tag LOCUS_47000 272668 273375 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 protein_id gnl|my_center|LOCUS_47000 273399 273605 gene locus_tag LOCUS_47010 273399 273605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 275122 273749 gene locus_tag LOCUS_47020 275122 273749 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_47020 276913 275126 gene locus_tag LOCUS_47030 276913 275126 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 protein_id gnl|my_center|LOCUS_47030 277650 276970 gene locus_tag LOCUS_47040 277650 276970 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034858431.1 protein_id gnl|my_center|LOCUS_47040 279530 278208 gene locus_tag LOCUS_47050 279530 278208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 281627 279543 gene locus_tag LOCUS_47060 281627 279543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 282677 281808 gene locus_tag LOCUS_47070 282677 281808 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932949.1 protein_id gnl|my_center|LOCUS_47070 283865 282687 gene locus_tag LOCUS_47080 283865 282687 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_47080 286136 283953 gene locus_tag LOCUS_47090 286136 283953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 287199 286435 gene locus_tag LOCUS_47100 gene map 287199 286435 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_47100 287584 287258 gene locus_tag LOCUS_47110 287584 287258 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263159.1 protein_id gnl|my_center|LOCUS_47110 287731 288228 gene locus_tag LOCUS_47120 287731 288228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 288354 289058 gene locus_tag LOCUS_47130 gene pepE 288354 289058 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_47130 289192 290709 gene locus_tag LOCUS_47140 289192 290709 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785179.1 protein_id gnl|my_center|LOCUS_47140 290786 292501 gene locus_tag LOCUS_47150 290786 292501 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_47150 293208 292498 gene locus_tag LOCUS_47160 293208 292498 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_47160 293356 294483 gene locus_tag LOCUS_47170 293356 294483 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_47170 295556 294555 gene locus_tag LOCUS_47180 295556 294555 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_47180 295662 296246 gene locus_tag LOCUS_47190 295662 296246 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_47190 296325 297362 gene locus_tag LOCUS_47200 296325 297362 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138280268.1 protein_id gnl|my_center|LOCUS_47200 297427 301140 gene locus_tag LOCUS_47210 297427 301140 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_47210 301165 302844 gene locus_tag LOCUS_47220 301165 302844 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786951.1 protein_id gnl|my_center|LOCUS_47220 302953 303918 gene locus_tag LOCUS_47230 302953 303918 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_47230 304651 303905 gene locus_tag LOCUS_47240 304651 303905 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_47240 304747 305307 gene locus_tag LOCUS_47250 304747 305307 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468869.1 protein_id gnl|my_center|LOCUS_47250 305944 305381 gene locus_tag LOCUS_47260 305944 305381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 306954 306169 gene locus_tag LOCUS_47270 306954 306169 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_47270 308236 306992 gene locus_tag LOCUS_47280 308236 306992 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108036.1 protein_id gnl|my_center|LOCUS_47280 308780 308262 gene locus_tag LOCUS_47290 308780 308262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 310967 309381 gene locus_tag LOCUS_47300 310967 309381 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_47300 311273 311839 gene locus_tag LOCUS_47310 311273 311839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 311855 313006 gene locus_tag LOCUS_47320 311855 313006 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_47320 313633 312998 gene locus_tag LOCUS_47330 313633 312998 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_47330 315416 313638 gene locus_tag LOCUS_47340 315416 313638 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993691.1 protein_id gnl|my_center|LOCUS_47340 316164 315523 gene locus_tag LOCUS_47350 316164 315523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 316543 318894 gene locus_tag LOCUS_47360 316543 318894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_47360 319779 318964 gene locus_tag LOCUS_47370 319779 318964 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_47370 319983 321104 gene locus_tag LOCUS_47380 319983 321104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 321889 321089 gene locus_tag LOCUS_47390 321889 321089 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_47390 323935 322070 gene locus_tag LOCUS_47400 323935 322070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_47400 324378 323998 gene locus_tag LOCUS_47410 324378 323998 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_47410 325162 324356 gene locus_tag LOCUS_47420 325162 324356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766739.1 protein_id gnl|my_center|LOCUS_47420 325849 325211 gene locus_tag LOCUS_47430 325849 325211 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854162.1 protein_id gnl|my_center|LOCUS_47430 325947 326759 gene locus_tag LOCUS_47440 325947 326759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 326840 327478 gene locus_tag LOCUS_47450 326840 327478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831548.1 protein_id gnl|my_center|LOCUS_47450 327441 327968 gene locus_tag LOCUS_47460 327441 327968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 327978 329369 gene locus_tag LOCUS_47470 327978 329369 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_47470 329469 329855 gene locus_tag LOCUS_47480 329469 329855 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 protein_id gnl|my_center|LOCUS_47480 330082 330513 gene locus_tag LOCUS_47490 330082 330513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 330625 331665 gene locus_tag LOCUS_47500 330625 331665 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_47500 332457 331717 gene locus_tag LOCUS_47510 332457 331717 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198766.1 protein_id gnl|my_center|LOCUS_47510 333583 332606 gene locus_tag LOCUS_47520 333583 332606 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_47520 333838 334812 gene locus_tag LOCUS_47530 gene plcA 333838 334812 CDS product phosphatidylinositol diacylglycerol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066288.1 protein_id gnl|my_center|LOCUS_47530 335078 335710 gene locus_tag LOCUS_47540 335078 335710 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009615.1 protein_id gnl|my_center|LOCUS_47540 335869 337455 gene locus_tag LOCUS_47550 335869 337455 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767969.1 protein_id gnl|my_center|LOCUS_47550 338087 337458 gene locus_tag LOCUS_47560 338087 337458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 338160 339035 gene locus_tag LOCUS_47570 338160 339035 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243358.1 protein_id gnl|my_center|LOCUS_47570 340443 339544 gene locus_tag LOCUS_47580 340443 339544 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100007.1 protein_id gnl|my_center|LOCUS_47580 340584 341810 gene locus_tag LOCUS_47590 340584 341810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973720.1 protein_id gnl|my_center|LOCUS_47590 341919 341993 gene locus_tag LOCUS_t00560 341919 341993 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 342118 342567 gene locus_tag LOCUS_47600 342118 342567 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 protein_id gnl|my_center|LOCUS_47600 343268 342570 gene locus_tag LOCUS_47610 343268 342570 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_47610 343828 343361 gene locus_tag LOCUS_47620 343828 343361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 344778 343927 gene locus_tag LOCUS_47630 344778 343927 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764761.1 protein_id gnl|my_center|LOCUS_47630 345952 344999 gene locus_tag LOCUS_47640 345952 344999 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767372.1 protein_id gnl|my_center|LOCUS_47640 346633 346088 gene locus_tag LOCUS_47650 346633 346088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47650 347970 346630 gene locus_tag LOCUS_47660 347970 346630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 349053 348118 gene locus_tag LOCUS_47670 gene queG 349053 348118 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_47670 349217 351235 gene locus_tag LOCUS_47680 349217 351235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 351232 353151 gene locus_tag LOCUS_47690 351232 353151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 354468 353209 gene locus_tag LOCUS_47700 354468 353209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 354758 357358 gene locus_tag LOCUS_47710 gene clpB 354758 357358 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_47710 357702 358187 gene locus_tag LOCUS_47720 gene guaD 357702 358187 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_47720 358531 358181 gene locus_tag LOCUS_47730 358531 358181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 359141 358563 gene locus_tag LOCUS_47740 359141 358563 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_47740 360232 359213 gene locus_tag LOCUS_47750 360232 359213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 360848 360300 gene locus_tag LOCUS_47760 360848 360300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 360922 361686 gene locus_tag LOCUS_47770 360922 361686 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_47770 364232 361761 gene locus_tag LOCUS_47780 364232 361761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 365432 364890 gene locus_tag LOCUS_47790 365432 364890 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_47790 366061 365594 gene locus_tag LOCUS_47800 366061 365594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 367194 366154 gene locus_tag LOCUS_47810 367194 366154 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_47810 367752 367297 gene locus_tag LOCUS_47820 gene purE 367752 367297 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_47820 367974 370583 gene locus_tag LOCUS_47830 367974 370583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 370591 370983 gene locus_tag LOCUS_47840 370591 370983 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_47840 371668 370964 gene locus_tag LOCUS_47850 gene rpe 371668 370964 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_47850 372501 371671 gene locus_tag LOCUS_47860 372501 371671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 373845 372511 gene locus_tag LOCUS_47870 gene thrC 373845 372511 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_47870 374794 373832 gene locus_tag LOCUS_47880 374794 373832 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_47880 377245 374804 gene locus_tag LOCUS_47890 gene thrA 377245 374804 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_47890 >Feature sequence23 911 150 gene locus_tag LOCUS_47900 911 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 1233 904 gene locus_tag LOCUS_47910 1233 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 1654 1580 gene locus_tag LOCUS_t00570 1654 1580 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1725 2630 gene locus_tag LOCUS_47920 gene gluQRS 1725 2630 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406656.1 protein_id gnl|my_center|LOCUS_47920 3243 2623 gene locus_tag LOCUS_47930 3243 2623 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_47930 3351 3683 gene locus_tag LOCUS_47940 3351 3683 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301848.1 protein_id gnl|my_center|LOCUS_47940 3868 4062 gene locus_tag LOCUS_47950 3868 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 4163 4076 gene locus_tag LOCUS_t00580 4163 4076 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4480 4235 gene locus_tag LOCUS_47960 4480 4235 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941406.1 protein_id gnl|my_center|LOCUS_47960 5558 4524 gene locus_tag LOCUS_47970 5558 4524 CDS product type I asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796414.1 protein_id gnl|my_center|LOCUS_47970 6371 5601 gene locus_tag LOCUS_47980 6371 5601 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_47980 6490 7362 gene locus_tag LOCUS_47990 6490 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 8054 7440 gene locus_tag LOCUS_48000 8054 7440 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_48000 8101 9639 gene locus_tag LOCUS_48010 gene gltX 8101 9639 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964585.1 protein_id gnl|my_center|LOCUS_48010 11376 9709 gene locus_tag LOCUS_48020 11376 9709 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_48020 11478 11897 gene locus_tag LOCUS_48030 11478 11897 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_48030 12007 12846 gene locus_tag LOCUS_48040 12007 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 12965 13741 gene locus_tag LOCUS_48050 12965 13741 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_48050 13784 15184 gene locus_tag LOCUS_48060 gene fumC 13784 15184 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_48060 16426 15455 gene locus_tag LOCUS_48070 16426 15455 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148287.1 protein_id gnl|my_center|LOCUS_48070 19484 16620 gene locus_tag LOCUS_48080 19484 16620 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_48080 20604 19924 gene locus_tag LOCUS_48090 20604 19924 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_48090 23134 20642 gene locus_tag LOCUS_48100 23134 20642 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503907.1 protein_id gnl|my_center|LOCUS_48100 24152 23202 gene locus_tag LOCUS_48110 24152 23202 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_48110 25923 24202 gene locus_tag LOCUS_48120 25923 24202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 26657 25920 gene locus_tag LOCUS_48130 gene gldF 26657 25920 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_48130 27118 26792 gene locus_tag LOCUS_48140 27118 26792 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_48140 28295 27132 gene locus_tag LOCUS_48150 28295 27132 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_48150 28397 28798 gene locus_tag LOCUS_48160 gene mce 28397 28798 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_48160 29476 29799 gene locus_tag LOCUS_48170 29476 29799 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052820167.1 protein_id gnl|my_center|LOCUS_48170 31103 29796 gene locus_tag LOCUS_48180 31103 29796 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_48180 31348 31614 gene locus_tag LOCUS_48190 31348 31614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 31634 32185 gene locus_tag LOCUS_48200 31634 32185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 32213 33142 gene locus_tag LOCUS_48210 32213 33142 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_48210 33208 33534 gene locus_tag LOCUS_48220 33208 33534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 33618 34004 gene locus_tag LOCUS_48230 gene apaG 33618 34004 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 protein_id gnl|my_center|LOCUS_48230 35026 34001 gene locus_tag LOCUS_48240 gene gldB 35026 34001 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_48240 35047 35772 gene locus_tag LOCUS_48250 35047 35772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 35815 37485 gene locus_tag LOCUS_48260 35815 37485 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_48260 37504 38805 gene locus_tag LOCUS_48270 gene serS 37504 38805 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_48270 39702 38878 gene locus_tag LOCUS_48280 39702 38878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 40051 42825 gene locus_tag LOCUS_48290 40051 42825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 42867 43172 gene locus_tag LOCUS_48300 42867 43172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 43255 43800 gene locus_tag LOCUS_48310 43255 43800 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584342.1 protein_id gnl|my_center|LOCUS_48310 43807 44865 gene locus_tag LOCUS_48320 43807 44865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 44904 45980 gene locus_tag LOCUS_48330 gene moeZ 44904 45980 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_48330 46166 47524 gene locus_tag LOCUS_48340 46166 47524 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106462662.1 protein_id gnl|my_center|LOCUS_48340 47601 48743 gene locus_tag LOCUS_48350 47601 48743 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_48350 50006 49080 gene locus_tag LOCUS_48360 gene bla 50006 49080 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_48360 51051 50059 gene locus_tag LOCUS_48370 51051 50059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 51144 52778 gene locus_tag LOCUS_48380 51144 52778 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_48380 52964 56026 gene locus_tag LOCUS_48390 52964 56026 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789829.1 protein_id gnl|my_center|LOCUS_48390 56100 57542 gene locus_tag LOCUS_48400 56100 57542 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_48400 57542 58555 gene locus_tag LOCUS_48410 57542 58555 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_48410 58584 59606 gene locus_tag LOCUS_48420 58584 59606 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616255.1 protein_id gnl|my_center|LOCUS_48420 59615 59950 gene locus_tag LOCUS_48430 59615 59950 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039139.1 protein_id gnl|my_center|LOCUS_48430 60957 60454 gene locus_tag LOCUS_48440 60957 60454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 63037 60971 gene locus_tag LOCUS_48450 63037 60971 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_48450 64860 63157 gene locus_tag LOCUS_48460 64860 63157 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_48460 65064 66341 gene locus_tag LOCUS_48470 gene purD 65064 66341 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_48470 66498 67520 gene locus_tag LOCUS_48480 66498 67520 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_48480 67663 68490 gene locus_tag LOCUS_48490 gene mreC 67663 68490 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_48490 68487 68996 gene locus_tag LOCUS_48500 68487 68996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 69029 70993 gene locus_tag LOCUS_48510 gene mrdA 69029 70993 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_48510 71019 72305 gene locus_tag LOCUS_48520 gene rodA 71019 72305 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_48520 72330 73082 gene locus_tag LOCUS_48530 72330 73082 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436857.1 protein_id gnl|my_center|LOCUS_48530 73079 73423 gene locus_tag LOCUS_48540 73079 73423 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727669.1 protein_id gnl|my_center|LOCUS_48540 73946 73461 gene locus_tag LOCUS_48550 73946 73461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 74603 73971 gene locus_tag LOCUS_48560 74603 73971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 75174 74623 gene locus_tag LOCUS_48570 75174 74623 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_48570 76294 75332 gene locus_tag LOCUS_48580 76294 75332 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_48580 77368 76337 gene locus_tag LOCUS_48590 gene galE 77368 76337 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_48590 78238 77378 gene locus_tag LOCUS_48600 gene rfbA 78238 77378 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 protein_id gnl|my_center|LOCUS_48600 79590 78583 gene locus_tag LOCUS_48610 79590 78583 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766890.1 protein_id gnl|my_center|LOCUS_48610 80259 79609 gene locus_tag LOCUS_48620 80259 79609 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_48620 80476 81303 gene locus_tag LOCUS_48630 80476 81303 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_48630 81382 81765 gene locus_tag LOCUS_48640 81382 81765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 82011 84746 gene locus_tag LOCUS_48650 82011 84746 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_48650 84845 86248 gene locus_tag LOCUS_48660 84845 86248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 86427 87677 gene locus_tag LOCUS_48670 86427 87677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 87958 87695 gene locus_tag LOCUS_48680 87958 87695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 88515 88117 gene locus_tag LOCUS_48690 88515 88117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 88988 88584 gene locus_tag LOCUS_48700 88988 88584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 90100 89048 gene locus_tag LOCUS_48710 90100 89048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_48710 90916 90233 gene locus_tag LOCUS_48720 90916 90233 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_48720 91273 93459 gene locus_tag LOCUS_48730 91273 93459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 93842 95608 gene locus_tag LOCUS_48740 93842 95608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_48740 95932 96993 gene locus_tag LOCUS_48750 gene atpB 95932 96993 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_48750 97032 97292 gene locus_tag LOCUS_48760 gene atpE 97032 97292 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777530.1 protein_id gnl|my_center|LOCUS_48760 97397 97879 gene locus_tag LOCUS_48770 97397 97879 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_48770 97903 98463 gene locus_tag LOCUS_48780 gene atpH 97903 98463 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_48780 98555 100132 gene locus_tag LOCUS_48790 gene atpA 98555 100132 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_48790 100572 102680 gene locus_tag LOCUS_48800 100572 102680 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_48800 102715 103359 gene locus_tag LOCUS_48810 102715 103359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 protein_id gnl|my_center|LOCUS_48810 103427 103726 gene locus_tag LOCUS_48820 103427 103726 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_48820 103823 104674 gene locus_tag LOCUS_48830 103823 104674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 105756 104677 gene locus_tag LOCUS_48840 gene pdxA 105756 104677 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964471.1 protein_id gnl|my_center|LOCUS_48840 105860 106612 gene locus_tag LOCUS_48850 gene rsmA 105860 106612 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_48850 106609 107535 gene locus_tag LOCUS_48860 106609 107535 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_48860 107691 108164 gene locus_tag LOCUS_48870 gene greA 107691 108164 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_48870 108259 108660 gene locus_tag LOCUS_48880 108259 108660 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_48880 109358 108657 gene locus_tag LOCUS_48890 109358 108657 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_48890 110088 109519 gene locus_tag LOCUS_48900 gene ruvC 110088 109519 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_48900 110274 111107 gene locus_tag LOCUS_48910 110274 111107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 111118 111909 gene locus_tag LOCUS_48920 111118 111909 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_48920 111970 112671 gene locus_tag LOCUS_48930 111970 112671 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_48930 113792 112752 gene locus_tag LOCUS_48940 gene ruvB 113792 112752 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_48940 113868 114836 gene locus_tag LOCUS_48950 113868 114836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 115721 114912 gene locus_tag LOCUS_48960 115721 114912 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_48960 116480 116761 gene locus_tag LOCUS_48970 116480 116761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 120264 117067 gene locus_tag LOCUS_48980 120264 117067 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107757.1 protein_id gnl|my_center|LOCUS_48980 120712 121992 gene locus_tag LOCUS_48990 120712 121992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 124856 122079 gene locus_tag LOCUS_49000 gene leuS 124856 122079 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_49000 125027 125899 gene locus_tag LOCUS_49010 125027 125899 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_49010 125920 126171 gene locus_tag LOCUS_49020 125920 126171 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_49020 126237 127019 gene locus_tag LOCUS_49030 126237 127019 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_49030 127078 128256 gene locus_tag LOCUS_49040 127078 128256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 129558 128341 gene locus_tag LOCUS_49050 129558 128341 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_49050 130066 129605 gene locus_tag LOCUS_49060 gene tsaE 130066 129605 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_49060 130264 132411 gene locus_tag LOCUS_49070 130264 132411 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723407.1 protein_id gnl|my_center|LOCUS_49070 132450 133055 gene locus_tag LOCUS_49080 132450 133055 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_49080 133059 134966 gene locus_tag LOCUS_49090 133059 134966 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_49090 136018 134972 gene locus_tag LOCUS_49100 136018 134972 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_49100 136394 136023 gene locus_tag LOCUS_49110 gene spdL 136394 136023 CDS product SdpC immunity protein SpdL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242803.1 protein_id gnl|my_center|LOCUS_49110 137977 136418 gene locus_tag LOCUS_49120 137977 136418 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_49120 138473 138021 gene locus_tag LOCUS_49130 138473 138021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 139331 138492 gene locus_tag LOCUS_49140 139331 138492 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_49140 140666 139335 gene locus_tag LOCUS_49150 140666 139335 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_49150 141331 140714 gene locus_tag LOCUS_49160 141331 140714 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838378.1 protein_id gnl|my_center|LOCUS_49160 142115 141315 gene locus_tag LOCUS_49170 gene lpxA 142115 141315 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_49170 143537 142125 gene locus_tag LOCUS_49180 143537 142125 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_49180 144623 143568 gene locus_tag LOCUS_49190 gene lpxD 144623 143568 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_49190 145942 144716 gene locus_tag LOCUS_49200 145942 144716 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_49200 146103 147656 gene locus_tag LOCUS_49210 146103 147656 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_49210 147678 148061 gene locus_tag LOCUS_49220 147678 148061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 148058 148822 gene locus_tag LOCUS_49230 148058 148822 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_49230 148859 149605 gene locus_tag LOCUS_49240 148859 149605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 149622 150764 gene locus_tag LOCUS_49250 gene acdA 149622 150764 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_49250 150890 151357 gene locus_tag LOCUS_49260 150890 151357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 151528 153153 gene locus_tag LOCUS_49270 151528 153153 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208330.1 protein_id gnl|my_center|LOCUS_49270 153874 153383 gene locus_tag LOCUS_49280 153874 153383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 153970 154845 gene locus_tag LOCUS_49290 153970 154845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 154848 155423 gene locus_tag LOCUS_49300 154848 155423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 155732 155532 gene locus_tag LOCUS_49310 155732 155532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 157010 155766 gene locus_tag LOCUS_49320 gene clpX 157010 155766 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_49320 158334 157615 gene locus_tag LOCUS_49330 gene clpP 158334 157615 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_49330 159694 158324 gene locus_tag LOCUS_49340 gene tig 159694 158324 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_49340 161026 159998 gene locus_tag LOCUS_49350 161026 159998 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 protein_id gnl|my_center|LOCUS_49350 161136 162191 gene locus_tag LOCUS_49360 gene rhaT 161136 162191 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_49360 162199 164289 gene locus_tag LOCUS_49370 162199 164289 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974433.1 protein_id gnl|my_center|LOCUS_49370 164302 165576 gene locus_tag LOCUS_49380 gene rhaI 164302 165576 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968713.1 protein_id gnl|my_center|LOCUS_49380 165580 166929 gene locus_tag LOCUS_49390 165580 166929 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973088.1 protein_id gnl|my_center|LOCUS_49390 168284 167046 gene locus_tag LOCUS_49400 168284 167046 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_49400 168715 169905 gene locus_tag LOCUS_49410 168715 169905 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766061.1 protein_id gnl|my_center|LOCUS_49410 169915 171156 gene locus_tag LOCUS_49420 169915 171156 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_49420 171650 174922 gene locus_tag LOCUS_49430 171650 174922 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765284.1 protein_id gnl|my_center|LOCUS_49430 174970 176874 gene locus_tag LOCUS_49440 174970 176874 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108516.1 protein_id gnl|my_center|LOCUS_49440 176902 178101 gene locus_tag LOCUS_49450 176902 178101 CDS product DUF4959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108515.1 protein_id gnl|my_center|LOCUS_49450 178124 179329 gene locus_tag LOCUS_49460 178124 179329 CDS product DUF4998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108678.1 protein_id gnl|my_center|LOCUS_49460 179339 180463 gene locus_tag LOCUS_49470 179339 180463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 180509 183493 gene locus_tag LOCUS_49480 180509 183493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 184013 184387 gene locus_tag LOCUS_49490 184013 184387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 185598 184468 gene locus_tag LOCUS_49500 185598 184468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 186082 186000 gene locus_tag LOCUS_t00590 186082 186000 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 186283 188529 gene locus_tag LOCUS_49510 186283 188529 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_49510 188608 189870 gene locus_tag LOCUS_49520 188608 189870 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_49520 189968 190498 gene locus_tag LOCUS_49530 189968 190498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 190598 191794 gene locus_tag LOCUS_49540 190598 191794 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_49540 192758 191799 gene locus_tag LOCUS_49550 192758 191799 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_49550 192810 194393 gene locus_tag LOCUS_49560 192810 194393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 194466 195389 gene locus_tag LOCUS_49570 194466 195389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 195491 196183 gene locus_tag LOCUS_49580 gene purQ 195491 196183 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_49580 196236 196691 gene locus_tag LOCUS_49590 196236 196691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 196812 198833 gene locus_tag LOCUS_49600 196812 198833 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_49600 199773 198910 gene locus_tag LOCUS_49610 199773 198910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 199964 200647 gene locus_tag LOCUS_49620 199964 200647 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_49620 200657 201982 gene locus_tag LOCUS_49630 200657 201982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 202009 203415 gene locus_tag LOCUS_49640 202009 203415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 203429 206662 gene locus_tag LOCUS_49650 203429 206662 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_49650 206646 207746 gene locus_tag LOCUS_49660 206646 207746 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_49660 207941 209542 gene locus_tag LOCUS_49670 207941 209542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 209539 213123 gene locus_tag LOCUS_49680 209539 213123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 213133 213957 gene locus_tag LOCUS_49690 213133 213957 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429044.1 protein_id gnl|my_center|LOCUS_49690 214312 213950 gene locus_tag LOCUS_49700 214312 213950 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_49700 216538 214460 gene locus_tag LOCUS_49710 216538 214460 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_49710 217075 216677 gene locus_tag LOCUS_49720 217075 216677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 217217 217402 gene locus_tag LOCUS_49730 217217 217402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 218574 217342 gene locus_tag LOCUS_49740 218574 217342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 219919 218783 gene locus_tag LOCUS_49750 219919 218783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 221211 219928 gene locus_tag LOCUS_49760 221211 219928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 222894 221236 gene locus_tag LOCUS_49770 222894 221236 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_49770 226179 222904 gene locus_tag LOCUS_49780 226179 222904 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_49780 227442 226438 gene locus_tag LOCUS_49790 227442 226438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 227549 228127 gene locus_tag LOCUS_49800 227549 228127 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_49800 228322 229386 gene locus_tag LOCUS_49810 228322 229386 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_49810 229850 229458 gene locus_tag LOCUS_49820 229850 229458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 230399 229938 gene locus_tag LOCUS_49830 230399 229938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 230870 234475 gene locus_tag LOCUS_49840 230870 234475 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_49840 234562 235851 gene locus_tag LOCUS_49850 234562 235851 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108256.1 protein_id gnl|my_center|LOCUS_49850 237066 236284 gene locus_tag LOCUS_49860 237066 236284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 237670 237596 gene locus_tag LOCUS_t00600 237670 237596 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 237887 238264 gene locus_tag LOCUS_49870 237887 238264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 238388 239062 gene locus_tag LOCUS_49880 238388 239062 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_49880 239071 240312 gene locus_tag LOCUS_49890 239071 240312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 240391 241881 gene locus_tag LOCUS_49900 240391 241881 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_49900 242396 241977 gene locus_tag LOCUS_49910 242396 241977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 243477 242380 gene locus_tag LOCUS_49920 243477 242380 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_49920 245560 243500 gene locus_tag LOCUS_49930 245560 243500 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090388836.1 protein_id gnl|my_center|LOCUS_49930 246416 245718 gene locus_tag LOCUS_49940 246416 245718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 247443 246445 gene locus_tag LOCUS_49950 247443 246445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 248111 248848 gene locus_tag LOCUS_49960 248111 248848 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035648.1 protein_id gnl|my_center|LOCUS_49960 250118 248880 gene locus_tag LOCUS_49970 250118 248880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 251673 250231 gene locus_tag LOCUS_49980 251673 250231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 251813 252424 gene locus_tag LOCUS_49990 251813 252424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 252801 252421 gene locus_tag LOCUS_50000 252801 252421 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_50000 253202 254071 gene locus_tag LOCUS_50010 253202 254071 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_50010 254177 255496 gene locus_tag LOCUS_50020 gene ffh 254177 255496 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_50020 255621 256085 gene locus_tag LOCUS_50030 255621 256085 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763025.1 protein_id gnl|my_center|LOCUS_50030 256119 256685 gene locus_tag LOCUS_50040 256119 256685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 256698 257378 gene locus_tag LOCUS_50050 gene trmD 256698 257378 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_50050 257465 257812 gene locus_tag LOCUS_50060 gene rplS 257465 257812 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_50060 258139 258366 gene locus_tag LOCUS_50070 258139 258366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 258526 259896 gene locus_tag LOCUS_50080 gene gatA 258526 259896 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931960.1 protein_id gnl|my_center|LOCUS_50080 259999 261153 gene locus_tag LOCUS_50090 259999 261153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 261487 263256 gene locus_tag LOCUS_50100 261487 263256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 263464 265209 gene locus_tag LOCUS_50110 263464 265209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 267336 265915 gene locus_tag LOCUS_50120 267336 265915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 268749 269135 gene locus_tag LOCUS_50130 268749 269135 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 protein_id gnl|my_center|LOCUS_50130 269175 270401 gene locus_tag LOCUS_50140 gene lysA 269175 270401 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_50140 270403 271026 gene locus_tag LOCUS_50150 270403 271026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 271095 273461 gene locus_tag LOCUS_50160 271095 273461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 277163 273537 gene locus_tag LOCUS_50170 277163 273537 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_50170 277912 277160 gene locus_tag LOCUS_50180 277912 277160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 278086 279297 gene locus_tag LOCUS_50190 278086 279297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 279304 281298 gene locus_tag LOCUS_50200 279304 281298 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108091.1 protein_id gnl|my_center|LOCUS_50200 281309 281803 gene locus_tag LOCUS_50210 281309 281803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 281800 283203 gene locus_tag LOCUS_50220 281800 283203 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_50220 286298 283200 gene locus_tag LOCUS_50230 286298 283200 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_50230 287205 286354 gene locus_tag LOCUS_50240 287205 286354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 287417 288484 gene locus_tag LOCUS_50250 287417 288484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 290089 288485 gene locus_tag LOCUS_50260 290089 288485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260