>Feature sequence1 1 1425 gene locus_tag LOCUS_00010 gene dnaA 1 1425 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_00010 1447 1875 gene locus_tag LOCUS_00020 1447 1875 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_00020 2106 4970 gene locus_tag LOCUS_00030 2106 4970 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_00030 5176 5715 gene locus_tag LOCUS_00040 5176 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5951 6586 gene locus_tag LOCUS_00050 5951 6586 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_00050 6781 7755 gene locus_tag LOCUS_00060 6781 7755 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148287.1 protein_id gnl|my_center|LOCUS_00060 8451 7954 gene locus_tag LOCUS_00070 8451 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8950 8513 gene locus_tag LOCUS_00080 8950 8513 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532393.1 protein_id gnl|my_center|LOCUS_00080 9163 10659 gene locus_tag LOCUS_00090 9163 10659 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_00090 10703 11857 gene locus_tag LOCUS_00100 10703 11857 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_00100 11949 13274 gene locus_tag LOCUS_00110 gene rseP 11949 13274 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_00110 13686 13447 gene locus_tag LOCUS_00120 13686 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13724 14434 gene locus_tag LOCUS_00130 13724 14434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14528 14956 gene locus_tag LOCUS_00140 14528 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17023 15035 gene locus_tag LOCUS_00150 17023 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17417 19912 gene locus_tag LOCUS_00160 gene lon 17417 19912 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_00160 19949 20989 gene locus_tag LOCUS_00170 19949 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21087 22490 gene locus_tag LOCUS_00180 gene hslU 21087 22490 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404390.1 protein_id gnl|my_center|LOCUS_00180 23683 22817 gene locus_tag LOCUS_00190 23683 22817 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_00190 25682 23847 gene locus_tag LOCUS_00200 25682 23847 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_00200 27112 26234 gene locus_tag LOCUS_00210 27112 26234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27265 28275 gene locus_tag LOCUS_00220 27265 28275 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_00220 28756 30315 gene locus_tag LOCUS_00230 28756 30315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00230 30297 30659 gene locus_tag LOCUS_00240 30297 30659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00240 31069 32340 gene locus_tag LOCUS_00250 31069 32340 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_00250 32678 36106 gene locus_tag LOCUS_00260 32678 36106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 36234 36725 gene locus_tag LOCUS_00270 36234 36725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37241 39415 gene locus_tag LOCUS_00280 37241 39415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 39522 39776 gene locus_tag LOCUS_00290 39522 39776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 41643 40105 gene locus_tag LOCUS_00300 41643 40105 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_00300 42089 41793 gene locus_tag LOCUS_00310 42089 41793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 42772 42185 gene locus_tag LOCUS_00320 gene lpcA 42772 42185 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167499.1 protein_id gnl|my_center|LOCUS_00320 43203 42778 gene locus_tag LOCUS_00330 43203 42778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 45222 43372 gene locus_tag LOCUS_00340 45222 43372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_00340 46158 45346 gene locus_tag LOCUS_00350 46158 45346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 47925 46300 gene locus_tag LOCUS_00360 47925 46300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 48265 48921 gene locus_tag LOCUS_00370 gene upp 48265 48921 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_00370 49045 49512 gene locus_tag LOCUS_00380 49045 49512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 50597 53803 gene locus_tag LOCUS_00390 50597 53803 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_00390 53827 55356 gene locus_tag LOCUS_00400 53827 55356 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_00400 55632 59084 gene locus_tag LOCUS_00410 55632 59084 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184173497.1 protein_id gnl|my_center|LOCUS_00410 59237 60874 gene locus_tag LOCUS_00420 59237 60874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 61053 61871 gene locus_tag LOCUS_00430 61053 61871 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_00430 64380 62665 gene locus_tag LOCUS_00440 64380 62665 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_00440 64922 64380 gene locus_tag LOCUS_00450 64922 64380 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_00450 66688 65108 gene locus_tag LOCUS_00460 66688 65108 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_00460 67660 66788 gene locus_tag LOCUS_00470 67660 66788 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_00470 68056 69234 gene locus_tag LOCUS_00480 68056 69234 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_00480 69278 71152 gene locus_tag LOCUS_00490 69278 71152 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_00490 71309 72523 gene locus_tag LOCUS_00500 71309 72523 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_00500 72523 73749 gene locus_tag LOCUS_00510 72523 73749 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_00510 73827 74327 gene locus_tag LOCUS_00520 73827 74327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 74862 75986 gene locus_tag LOCUS_00530 74862 75986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 76666 79452 gene locus_tag LOCUS_00540 76666 79452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 79753 80742 gene locus_tag LOCUS_00550 gene mgrA 79753 80742 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_00550 81173 81619 gene locus_tag LOCUS_00560 81173 81619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 81634 82962 gene locus_tag LOCUS_00570 81634 82962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 82962 83753 gene locus_tag LOCUS_00580 82962 83753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 83983 93324 gene locus_tag LOCUS_00590 83983 93324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 94235 93585 gene locus_tag LOCUS_00600 94235 93585 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_00600 95706 94228 gene locus_tag LOCUS_00610 95706 94228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 96508 99018 gene locus_tag LOCUS_00620 gene nirB 96508 99018 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901082.1 protein_id gnl|my_center|LOCUS_00620 99120 99491 gene locus_tag LOCUS_00630 gene nirD 99120 99491 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_00630 99743 101200 gene locus_tag LOCUS_00640 99743 101200 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_00640 101384 102613 gene locus_tag LOCUS_00650 101384 102613 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_00650 102878 103042 gene locus_tag LOCUS_00660 102878 103042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 103029 106556 gene locus_tag LOCUS_00670 103029 106556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 106825 108282 gene locus_tag LOCUS_00680 106825 108282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 109177 108299 gene locus_tag LOCUS_00690 109177 108299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 109398 110609 gene locus_tag LOCUS_00700 109398 110609 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_00700 110927 111865 gene locus_tag LOCUS_00710 110927 111865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 112503 112180 gene locus_tag LOCUS_00720 112503 112180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 112762 113247 gene locus_tag LOCUS_00730 gene moaC 112762 113247 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461493.1 protein_id gnl|my_center|LOCUS_00730 113228 114406 gene locus_tag LOCUS_00740 113228 114406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 114417 114608 gene locus_tag LOCUS_00750 114417 114608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 114550 114990 gene locus_tag LOCUS_00760 114550 114990 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_00760 115441 115031 gene locus_tag LOCUS_00770 115441 115031 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_00770 115821 115579 gene locus_tag LOCUS_00780 115821 115579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 115929 116936 gene locus_tag LOCUS_00790 gene moaA 115929 116936 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461492.1 protein_id gnl|my_center|LOCUS_00790 118333 117050 gene locus_tag LOCUS_00800 118333 117050 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964308.1 protein_id gnl|my_center|LOCUS_00800 119966 118512 gene locus_tag LOCUS_00810 119966 118512 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_00810 121930 119981 gene locus_tag LOCUS_00820 gene nuoL 121930 119981 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_00820 122342 122013 gene locus_tag LOCUS_00830 gene nuoK 122342 122013 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_00830 123012 122494 gene locus_tag LOCUS_00840 123012 122494 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_00840 123619 123089 gene locus_tag LOCUS_00850 123619 123089 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_00850 123957 123655 gene locus_tag LOCUS_00860 123957 123655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 125099 124014 gene locus_tag LOCUS_00870 gene nuoH 125099 124014 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_00870 126098 125106 gene locus_tag LOCUS_00880 126098 125106 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_00880 127563 126217 gene locus_tag LOCUS_00890 gene nuoF 127563 126217 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_00890 128026 127691 gene locus_tag LOCUS_00900 128026 127691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00900 128527 128303 gene locus_tag LOCUS_00910 128527 128303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00910 128950 128657 gene locus_tag LOCUS_00920 128950 128657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 130284 129028 gene locus_tag LOCUS_00930 130284 129028 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_00930 130961 130449 gene locus_tag LOCUS_00940 130961 130449 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964320.1 protein_id gnl|my_center|LOCUS_00940 131507 130965 gene locus_tag LOCUS_00950 131507 130965 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_00950 131985 131605 gene locus_tag LOCUS_00960 gene ndhC 131985 131605 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 protein_id gnl|my_center|LOCUS_00960 133549 132611 gene locus_tag LOCUS_00970 133549 132611 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_00970 135365 133707 gene locus_tag LOCUS_00980 gene pruA 135365 133707 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_00980 136278 135568 gene locus_tag LOCUS_00990 136278 135568 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_00990 136720 136334 gene locus_tag LOCUS_01000 136720 136334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 136934 137632 gene locus_tag LOCUS_01010 136934 137632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 137844 139433 gene locus_tag LOCUS_01020 137844 139433 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_01020 140608 139589 gene locus_tag LOCUS_01030 140608 139589 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222113.1 protein_id gnl|my_center|LOCUS_01030 141020 142165 gene locus_tag LOCUS_01040 141020 142165 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229810.1 protein_id gnl|my_center|LOCUS_01040 143745 142201 gene locus_tag LOCUS_01050 143745 142201 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_01050 143871 144683 gene locus_tag LOCUS_01060 gene ispE 143871 144683 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_01060 145571 144636 gene locus_tag LOCUS_01070 145571 144636 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_01070 146806 145730 gene locus_tag LOCUS_01080 146806 145730 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_01080 148142 147012 gene locus_tag LOCUS_01090 gene tgt 148142 147012 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_01090 148925 148314 gene locus_tag LOCUS_01100 148925 148314 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_01100 149631 148948 gene locus_tag LOCUS_01110 149631 148948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_01110 150159 149635 gene locus_tag LOCUS_01120 150159 149635 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_01120 150336 150581 gene locus_tag LOCUS_01130 150336 150581 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_01130 150653 151873 gene locus_tag LOCUS_01140 150653 151873 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_01140 152022 152348 gene locus_tag LOCUS_01150 152022 152348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 152469 153596 gene locus_tag LOCUS_01160 152469 153596 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_01160 153605 154552 gene locus_tag LOCUS_01170 gene hemC 153605 154552 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_01170 154565 155227 gene locus_tag LOCUS_01180 154565 155227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 155689 155345 gene locus_tag LOCUS_01190 155689 155345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 156508 155750 gene locus_tag LOCUS_01200 156508 155750 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_01200 157719 156655 gene locus_tag LOCUS_01210 157719 156655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 160415 157887 gene locus_tag LOCUS_01220 gene priA 160415 157887 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_01220 162844 160817 gene locus_tag LOCUS_01230 162844 160817 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_01230 163901 162915 gene locus_tag LOCUS_01240 163901 162915 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_01240 164528 164085 gene locus_tag LOCUS_01250 gene rplI 164528 164085 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_01250 164795 164544 gene locus_tag LOCUS_01260 gene rpsR 164795 164544 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_01260 165172 164792 gene locus_tag LOCUS_01270 gene rpsF 165172 164792 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_01270 165986 167299 gene locus_tag LOCUS_01280 165986 167299 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_01280 167347 170367 gene locus_tag LOCUS_01290 167347 170367 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_01290 170455 171882 gene locus_tag LOCUS_01300 gene nrfD 170455 171882 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_01300 171875 172402 gene locus_tag LOCUS_01310 171875 172402 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_01310 172402 173082 gene locus_tag LOCUS_01320 172402 173082 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872574.1 protein_id gnl|my_center|LOCUS_01320 173183 174397 gene locus_tag LOCUS_01330 173183 174397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 174691 175467 gene locus_tag LOCUS_01340 174691 175467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 175565 175771 gene locus_tag LOCUS_01350 175565 175771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01350 175723 177399 gene locus_tag LOCUS_01360 175723 177399 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_01360 177409 178482 gene locus_tag LOCUS_01370 177409 178482 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_01370 178482 179378 gene locus_tag LOCUS_01380 gene cyoE 178482 179378 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_01380 179390 179974 gene locus_tag LOCUS_01390 179390 179974 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_01390 180045 180803 gene locus_tag LOCUS_01400 180045 180803 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_01400 180891 181238 gene locus_tag LOCUS_01410 180891 181238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 181248 181922 gene locus_tag LOCUS_01420 181248 181922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 181912 182445 gene locus_tag LOCUS_01430 181912 182445 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_01430 182467 182712 gene locus_tag LOCUS_01440 182467 182712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 183093 186812 gene locus_tag LOCUS_01450 183093 186812 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_01450 186809 190315 gene locus_tag LOCUS_01460 186809 190315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_01460 191059 190385 gene locus_tag LOCUS_01470 191059 190385 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_01470 191511 191188 gene locus_tag LOCUS_01480 191511 191188 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_01480 191896 191630 gene locus_tag LOCUS_01490 191896 191630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 192375 192974 gene locus_tag LOCUS_01500 192375 192974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 193349 193519 gene locus_tag LOCUS_01510 193349 193519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 193742 194146 gene locus_tag LOCUS_01520 193742 194146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 194528 194274 gene locus_tag LOCUS_01530 194528 194274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 194950 195321 gene locus_tag LOCUS_01540 194950 195321 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909062.1 protein_id gnl|my_center|LOCUS_01540 195507 195890 gene locus_tag LOCUS_01550 195507 195890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 196356 196874 gene locus_tag LOCUS_01560 196356 196874 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974988.1 protein_id gnl|my_center|LOCUS_01560 197456 196965 gene locus_tag LOCUS_01570 197456 196965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 197873 198619 gene locus_tag LOCUS_01580 gene truA 197873 198619 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_01580 198786 200552 gene locus_tag LOCUS_01590 198786 200552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_01590 200641 201162 gene locus_tag LOCUS_01600 200641 201162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 201693 201163 gene locus_tag LOCUS_01610 201693 201163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 202401 201790 gene locus_tag LOCUS_01620 202401 201790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 203618 202563 gene locus_tag LOCUS_01630 gene hemW 203618 202563 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_01630 203864 205618 gene locus_tag LOCUS_01640 203864 205618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 205731 205805 gene locus_tag LOCUS_t00010 205731 205805 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 206964 206077 gene locus_tag LOCUS_01650 206964 206077 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_01650 207441 210473 gene locus_tag LOCUS_01660 207441 210473 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_01660 210497 211969 gene locus_tag LOCUS_01670 210497 211969 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_01670 212217 213371 gene locus_tag LOCUS_01680 212217 213371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 213663 215096 gene locus_tag LOCUS_01690 213663 215096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 215656 217365 gene locus_tag LOCUS_01700 215656 217365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 217499 218968 gene locus_tag LOCUS_01710 gene uxaC 217499 218968 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187445.1 protein_id gnl|my_center|LOCUS_01710 218968 219813 gene locus_tag LOCUS_01720 218968 219813 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964640.1 protein_id gnl|my_center|LOCUS_01720 220230 220973 gene locus_tag LOCUS_01730 220230 220973 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_01730 221110 222105 gene locus_tag LOCUS_01740 221110 222105 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027124.1 protein_id gnl|my_center|LOCUS_01740 222673 223878 gene locus_tag LOCUS_01750 222673 223878 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_01750 223929 224117 gene locus_tag LOCUS_01760 223929 224117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 224435 225172 gene locus_tag LOCUS_01770 224435 225172 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_01770 225222 225983 gene locus_tag LOCUS_01780 gene glcK 225222 225983 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01780 226361 227158 gene locus_tag LOCUS_01790 226361 227158 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_01790 227447 228679 gene locus_tag LOCUS_01800 227447 228679 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726980.1 protein_id gnl|my_center|LOCUS_01800 228691 229677 gene locus_tag LOCUS_01810 228691 229677 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723635.1 protein_id gnl|my_center|LOCUS_01810 230071 230961 gene locus_tag LOCUS_01820 230071 230961 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_01820 232056 234728 gene locus_tag LOCUS_01830 232056 234728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 234767 235750 gene locus_tag LOCUS_01840 234767 235750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 235899 236783 gene locus_tag LOCUS_01850 235899 236783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 236916 239798 gene locus_tag LOCUS_01860 236916 239798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 240408 240076 gene locus_tag LOCUS_01870 240408 240076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 240869 242041 gene locus_tag LOCUS_01880 240869 242041 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393248.1 protein_id gnl|my_center|LOCUS_01880 242054 242740 gene locus_tag LOCUS_01890 242054 242740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 244729 243062 gene locus_tag LOCUS_01900 244729 243062 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_01900 244969 245184 gene locus_tag LOCUS_01910 244969 245184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 245211 245624 gene locus_tag LOCUS_01920 gene ruvX 245211 245624 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_01920 245912 246478 gene locus_tag LOCUS_01930 gene def 245912 246478 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_01930 247459 246638 gene locus_tag LOCUS_01940 247459 246638 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_01940 247681 249921 gene locus_tag LOCUS_01950 247681 249921 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_01950 250755 250003 gene locus_tag LOCUS_01960 250755 250003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 251107 252072 gene locus_tag LOCUS_01970 251107 252072 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_01970 252151 252594 gene locus_tag LOCUS_01980 252151 252594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01980 253402 256458 gene locus_tag LOCUS_01990 253402 256458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 256872 257435 gene locus_tag LOCUS_02000 256872 257435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 257645 258298 gene locus_tag LOCUS_02010 257645 258298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 259705 258644 gene locus_tag LOCUS_02020 gene rlmN 259705 258644 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_02020 260426 259992 gene locus_tag LOCUS_02030 260426 259992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 260657 261325 gene locus_tag LOCUS_02040 gene mnmD 260657 261325 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_02040 261453 261722 gene locus_tag LOCUS_02050 261453 261722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 262168 261764 gene locus_tag LOCUS_02060 262168 261764 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_02060 262833 262462 gene locus_tag LOCUS_02070 262833 262462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 263063 264562 gene locus_tag LOCUS_02080 263063 264562 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_02080 264767 264958 gene locus_tag LOCUS_02090 264767 264958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 265570 265049 gene locus_tag LOCUS_02100 265570 265049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 266258 265758 gene locus_tag LOCUS_02110 266258 265758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 266772 266503 gene locus_tag LOCUS_02120 266772 266503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 267039 267770 gene locus_tag LOCUS_02130 267039 267770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 268239 267784 gene locus_tag LOCUS_02140 268239 267784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 269366 268251 gene locus_tag LOCUS_02150 269366 268251 CDS product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 protein_id gnl|my_center|LOCUS_02150 273475 269612 gene locus_tag LOCUS_02160 273475 269612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 274696 273587 gene locus_tag LOCUS_02170 274696 273587 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_02170 276132 274882 gene locus_tag LOCUS_02180 276132 274882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_02180 276563 276183 gene locus_tag LOCUS_02190 276563 276183 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404040.1 protein_id gnl|my_center|LOCUS_02190 277885 276641 gene locus_tag LOCUS_02200 277885 276641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_02200 278708 277998 gene locus_tag LOCUS_02210 278708 277998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 protein_id gnl|my_center|LOCUS_02210 279970 279167 gene locus_tag LOCUS_02220 279970 279167 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922506.1 protein_id gnl|my_center|LOCUS_02220 280525 280154 gene locus_tag LOCUS_02230 280525 280154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 280932 281120 gene locus_tag LOCUS_02240 280932 281120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 281171 282721 gene locus_tag LOCUS_02250 281171 282721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02250 282703 283110 gene locus_tag LOCUS_02260 282703 283110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02260 284665 283253 gene locus_tag LOCUS_02270 gene lpdA 284665 283253 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_02270 286941 285220 gene locus_tag LOCUS_02280 286941 285220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 289863 287092 gene locus_tag LOCUS_02290 289863 287092 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_02290 290283 291965 gene locus_tag LOCUS_02300 290283 291965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 292240 294954 gene locus_tag LOCUS_02310 292240 294954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 294990 295403 gene locus_tag LOCUS_02320 294990 295403 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889046.1 protein_id gnl|my_center|LOCUS_02320 295623 296162 gene locus_tag LOCUS_02330 295623 296162 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962904.1 protein_id gnl|my_center|LOCUS_02330 296236 296754 gene locus_tag LOCUS_02340 296236 296754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 297013 297426 gene locus_tag LOCUS_02350 297013 297426 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_02350 297487 299199 gene locus_tag LOCUS_02360 297487 299199 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_02360 300579 299242 gene locus_tag LOCUS_02370 300579 299242 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_02370 300905 301132 gene locus_tag LOCUS_02380 300905 301132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 301545 301898 gene locus_tag LOCUS_02390 301545 301898 CDS product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928747.1 protein_id gnl|my_center|LOCUS_02390 301901 302389 gene locus_tag LOCUS_02400 301901 302389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_02400 302527 303939 gene locus_tag LOCUS_02410 302527 303939 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084144.1 protein_id gnl|my_center|LOCUS_02410 304279 304812 gene locus_tag LOCUS_02420 304279 304812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 304979 305365 gene locus_tag LOCUS_02430 304979 305365 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_02430 307310 305433 gene locus_tag LOCUS_02440 gene asnB 307310 305433 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101239.1 protein_id gnl|my_center|LOCUS_02440 308145 307468 gene locus_tag LOCUS_02450 gene nth 308145 307468 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_02450 308395 308165 gene locus_tag LOCUS_02460 308395 308165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 308969 308370 gene locus_tag LOCUS_02470 308969 308370 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_02470 309890 309570 gene locus_tag LOCUS_02480 309890 309570 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_02480 310122 312605 gene locus_tag LOCUS_02490 310122 312605 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_02490 313421 314014 gene locus_tag LOCUS_02500 313421 314014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 314024 316186 gene locus_tag LOCUS_02510 314024 316186 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_02510 316327 316557 gene locus_tag LOCUS_02520 316327 316557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 316566 318719 gene locus_tag LOCUS_02530 gene feoB 316566 318719 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_02530 323257 318902 gene locus_tag LOCUS_02540 323257 318902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 323985 323545 gene locus_tag LOCUS_02550 323985 323545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 327735 324649 gene locus_tag LOCUS_02560 327735 324649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 328694 327762 gene locus_tag LOCUS_02570 gene hyi 328694 327762 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531398.1 protein_id gnl|my_center|LOCUS_02570 329153 330292 gene locus_tag LOCUS_02580 329153 330292 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_02580 330515 331561 gene locus_tag LOCUS_02590 330515 331561 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972870.1 protein_id gnl|my_center|LOCUS_02590 332340 331765 gene locus_tag LOCUS_02600 332340 331765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 335810 332478 gene locus_tag LOCUS_02610 335810 332478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 336347 337171 gene locus_tag LOCUS_02620 336347 337171 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_02620 337271 338509 gene locus_tag LOCUS_02630 337271 338509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 338632 339705 gene locus_tag LOCUS_02640 338632 339705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 339900 340238 gene locus_tag LOCUS_02650 339900 340238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 340360 341166 gene locus_tag LOCUS_02660 340360 341166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 343393 341840 gene locus_tag LOCUS_02670 343393 341840 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_02670 343637 343383 gene locus_tag LOCUS_02680 343637 343383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 344938 343622 gene locus_tag LOCUS_02690 344938 343622 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02690 347603 344943 gene locus_tag LOCUS_02700 347603 344943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 349344 347695 gene locus_tag LOCUS_02710 349344 347695 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_02710 352392 349366 gene locus_tag LOCUS_02720 352392 349366 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_02720 353268 353194 gene locus_tag LOCUS_t00020 353268 353194 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 353809 353387 gene locus_tag LOCUS_02730 353809 353387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 355202 354177 gene locus_tag LOCUS_02740 gene pheS 355202 354177 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_02740 355613 356227 gene locus_tag LOCUS_02750 355613 356227 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_02750 356231 357700 gene locus_tag LOCUS_02760 356231 357700 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_02760 357735 358868 gene locus_tag LOCUS_02770 357735 358868 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_02770 358877 362284 gene locus_tag LOCUS_02780 358877 362284 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_02780 362295 362546 gene locus_tag LOCUS_02790 362295 362546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 363253 362657 gene locus_tag LOCUS_02800 363253 362657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 364298 363555 gene locus_tag LOCUS_02810 364298 363555 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767602.1 protein_id gnl|my_center|LOCUS_02810 365231 364443 gene locus_tag LOCUS_02820 365231 364443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 366376 365765 gene locus_tag LOCUS_02830 366376 365765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 366575 366354 gene locus_tag LOCUS_02840 366575 366354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 367100 367624 gene locus_tag LOCUS_02850 367100 367624 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_02850 367693 368271 gene locus_tag LOCUS_02860 367693 368271 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_02860 368379 368454 gene locus_tag LOCUS_t00030 368379 368454 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 368937 368710 gene locus_tag LOCUS_02870 368937 368710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 371076 369721 gene locus_tag LOCUS_02880 371076 369721 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479977.1 protein_id gnl|my_center|LOCUS_02880 371442 372227 gene locus_tag LOCUS_02890 371442 372227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 373317 372250 gene locus_tag LOCUS_02900 373317 372250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 374048 373350 gene locus_tag LOCUS_02910 374048 373350 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045801381.1 protein_id gnl|my_center|LOCUS_02910 374494 375573 gene locus_tag LOCUS_02920 374494 375573 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411484.1 protein_id gnl|my_center|LOCUS_02920 375845 377629 gene locus_tag LOCUS_02930 375845 377629 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 protein_id gnl|my_center|LOCUS_02930 378319 377852 gene locus_tag LOCUS_02940 378319 377852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 378846 378559 gene locus_tag LOCUS_02950 378846 378559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 379354 379686 gene locus_tag LOCUS_02960 379354 379686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 379683 380243 gene locus_tag LOCUS_02970 379683 380243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02970 380981 380268 gene locus_tag LOCUS_02980 380981 380268 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_02980 382086 380974 gene locus_tag LOCUS_02990 382086 380974 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_02990 383221 382154 gene locus_tag LOCUS_03000 383221 382154 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_03000 383432 383809 gene locus_tag LOCUS_03010 383432 383809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 384110 385138 gene locus_tag LOCUS_03020 384110 385138 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_03020 385146 385814 gene locus_tag LOCUS_03030 385146 385814 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_03030 386192 386530 gene locus_tag LOCUS_03040 386192 386530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 387976 386804 gene locus_tag LOCUS_03050 387976 386804 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_03050 390311 387981 gene locus_tag LOCUS_03060 390311 387981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 390458 390685 gene locus_tag LOCUS_03070 390458 390685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 392059 390932 gene locus_tag LOCUS_03080 392059 390932 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088659.1 protein_id gnl|my_center|LOCUS_03080 392400 393473 gene locus_tag LOCUS_03090 392400 393473 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 protein_id gnl|my_center|LOCUS_03090 394607 393570 gene locus_tag LOCUS_03100 394607 393570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 395863 394970 gene locus_tag LOCUS_03110 395863 394970 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_03110 396933 395908 gene locus_tag LOCUS_03120 396933 395908 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_03120 397829 397056 gene locus_tag LOCUS_03130 397829 397056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_03130 398665 397850 gene locus_tag LOCUS_03140 398665 397850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_03140 399920 402835 gene locus_tag LOCUS_03150 399920 402835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 403158 404291 gene locus_tag LOCUS_03160 403158 404291 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_03160 405827 404313 gene locus_tag LOCUS_03170 405827 404313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 406077 406994 gene locus_tag LOCUS_03180 gene rbsK 406077 406994 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_03180 407187 408182 gene locus_tag LOCUS_03190 407187 408182 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_03190 410274 408901 gene locus_tag LOCUS_03200 410274 408901 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_03200 411650 410427 gene locus_tag LOCUS_03210 gene eboE 411650 410427 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_03210 413336 411978 gene locus_tag LOCUS_03220 413336 411978 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_03220 413611 414945 gene locus_tag LOCUS_03230 413611 414945 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_03230 415018 415094 gene locus_tag LOCUS_t00040 415018 415094 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 415703 415257 gene locus_tag LOCUS_03240 415703 415257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 416431 415793 gene locus_tag LOCUS_03250 gene mip 416431 415793 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_03250 416725 417339 gene locus_tag LOCUS_03260 416725 417339 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_03260 417336 418700 gene locus_tag LOCUS_03270 417336 418700 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_03270 418700 419767 gene locus_tag LOCUS_03280 418700 419767 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_03280 419770 421317 gene locus_tag LOCUS_03290 419770 421317 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_03290 422373 421408 gene locus_tag LOCUS_03300 gene rfaD 422373 421408 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_03300 422564 423448 gene locus_tag LOCUS_03310 422564 423448 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_03310 423445 424452 gene locus_tag LOCUS_03320 423445 424452 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_03320 424452 424871 gene locus_tag LOCUS_03330 424452 424871 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_03330 425032 426150 gene locus_tag LOCUS_03340 gene lpxB 425032 426150 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089240244.1 protein_id gnl|my_center|LOCUS_03340 427530 426307 gene locus_tag LOCUS_03350 gene clpX 427530 426307 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964183.1 protein_id gnl|my_center|LOCUS_03350 427811 429088 gene locus_tag LOCUS_03360 427811 429088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 429085 430122 gene locus_tag LOCUS_03370 gene mcrC 429085 430122 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_03370 430945 430244 gene locus_tag LOCUS_03380 gene clpP 430945 430244 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_03380 431818 431084 gene locus_tag LOCUS_03390 431818 431084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03390 432414 431815 gene locus_tag LOCUS_03400 432414 431815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03400 432570 432488 gene locus_tag LOCUS_t00050 432570 432488 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 432884 435088 gene locus_tag LOCUS_03410 432884 435088 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_03410 435189 435656 gene locus_tag LOCUS_03420 435189 435656 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_03420 435653 435997 gene locus_tag LOCUS_03430 435653 435997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 436059 436397 gene locus_tag LOCUS_03440 436059 436397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03440 436670 437326 gene locus_tag LOCUS_03450 436670 437326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 438201 439718 gene locus_tag LOCUS_r00010 438201 439718 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 439929 440003 gene locus_tag LOCUS_t00060 439929 440003 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 440016 440090 gene locus_tag LOCUS_t00070 440016 440090 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 440309 443190 gene locus_tag LOCUS_r00020 440309 443190 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 443354 443460 gene locus_tag LOCUS_r00030 443354 443460 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 444492 444052 gene locus_tag LOCUS_03460 444492 444052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03460 444837 444505 gene locus_tag LOCUS_03470 444837 444505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03470 445218 445069 gene locus_tag LOCUS_03480 445218 445069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 445794 448820 gene locus_tag LOCUS_03490 445794 448820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 449152 450171 gene locus_tag LOCUS_03500 449152 450171 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_03500 450958 450335 gene locus_tag LOCUS_03510 450958 450335 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_03510 451532 452572 gene locus_tag LOCUS_03520 451532 452572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 452687 456301 gene locus_tag LOCUS_03530 452687 456301 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_03530 456345 458096 gene locus_tag LOCUS_03540 456345 458096 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_03540 458225 461773 gene locus_tag LOCUS_03550 458225 461773 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184173497.1 protein_id gnl|my_center|LOCUS_03550 461889 463376 gene locus_tag LOCUS_03560 461889 463376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 464825 463467 gene locus_tag LOCUS_03570 464825 463467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 465697 465068 gene locus_tag LOCUS_03580 465697 465068 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767805.1 protein_id gnl|my_center|LOCUS_03580 466172 467212 gene locus_tag LOCUS_03590 466172 467212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 467324 470860 gene locus_tag LOCUS_03600 467324 470860 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_03600 470934 472499 gene locus_tag LOCUS_03610 470934 472499 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_03610 472650 476177 gene locus_tag LOCUS_03620 472650 476177 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184173497.1 protein_id gnl|my_center|LOCUS_03620 477083 476280 gene locus_tag LOCUS_03630 477083 476280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 478578 477535 gene locus_tag LOCUS_03640 478578 477535 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_03640 479483 478875 gene locus_tag LOCUS_03650 479483 478875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 480203 479997 gene locus_tag LOCUS_03660 480203 479997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 480948 480298 gene locus_tag LOCUS_03670 480948 480298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 482128 481259 gene locus_tag LOCUS_03680 482128 481259 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_03680 483953 482415 gene locus_tag LOCUS_03690 483953 482415 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_03690 485087 484320 gene locus_tag LOCUS_03700 485087 484320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 485780 485196 gene locus_tag LOCUS_03710 485780 485196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 487182 485935 gene locus_tag LOCUS_03720 487182 485935 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_03720 488918 487830 gene locus_tag LOCUS_03730 gene proB 488918 487830 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108944.1 protein_id gnl|my_center|LOCUS_03730 489050 489508 gene locus_tag LOCUS_03740 489050 489508 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 protein_id gnl|my_center|LOCUS_03740 491048 489750 gene locus_tag LOCUS_03750 491048 489750 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_03750 491306 492367 gene locus_tag LOCUS_03760 491306 492367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 492364 493590 gene locus_tag LOCUS_03770 492364 493590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03770 493774 495393 gene locus_tag LOCUS_03780 gene ggt 493774 495393 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_03780 495592 496407 gene locus_tag LOCUS_03790 gene mutM 495592 496407 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262776.1 protein_id gnl|my_center|LOCUS_03790 496794 499253 gene locus_tag LOCUS_03800 496794 499253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 500421 499621 gene locus_tag LOCUS_03810 500421 499621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 501464 500649 gene locus_tag LOCUS_03820 501464 500649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 502042 504273 gene locus_tag LOCUS_03830 502042 504273 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_03830 504711 506498 gene locus_tag LOCUS_03840 504711 506498 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_03840 507112 506612 gene locus_tag LOCUS_03850 507112 506612 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_03850 508088 511216 gene locus_tag LOCUS_03860 508088 511216 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_03860 511231 511488 gene locus_tag LOCUS_03870 511231 511488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 511575 512978 gene locus_tag LOCUS_03880 511575 512978 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_03880 513117 514169 gene locus_tag LOCUS_03890 513117 514169 CDS product glycan-binding surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796119.1 protein_id gnl|my_center|LOCUS_03890 514189 515748 gene locus_tag LOCUS_03900 514189 515748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 516035 517690 gene locus_tag LOCUS_03910 516035 517690 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582688.1 protein_id gnl|my_center|LOCUS_03910 517886 519631 gene locus_tag LOCUS_03920 517886 519631 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_03920 519810 523133 gene locus_tag LOCUS_03930 519810 523133 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_03930 523124 524479 gene locus_tag LOCUS_03940 523124 524479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 524715 525677 gene locus_tag LOCUS_03950 524715 525677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 525920 529489 gene locus_tag LOCUS_03960 525920 529489 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_03960 529492 530022 gene locus_tag LOCUS_03970 529492 530022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 530785 534354 gene locus_tag LOCUS_03980 530785 534354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 534776 535222 gene locus_tag LOCUS_03990 534776 535222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 538555 535877 gene locus_tag LOCUS_04000 538555 535877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 539408 543010 gene locus_tag LOCUS_04010 539408 543010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 543587 546409 gene locus_tag LOCUS_04020 543587 546409 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404755.1 protein_id gnl|my_center|LOCUS_04020 546694 548535 gene locus_tag LOCUS_04030 546694 548535 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_04030 548537 549202 gene locus_tag LOCUS_04040 548537 549202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 549232 550029 gene locus_tag LOCUS_04050 549232 550029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 550181 551293 gene locus_tag LOCUS_04060 550181 551293 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230820.1 protein_id gnl|my_center|LOCUS_04060 553099 551858 gene locus_tag LOCUS_04070 553099 551858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 553443 554780 gene locus_tag LOCUS_04080 553443 554780 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_04080 555513 558764 gene locus_tag LOCUS_04090 555513 558764 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_04090 558842 559501 gene locus_tag LOCUS_04100 558842 559501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04100 559555 560415 gene locus_tag LOCUS_04110 559555 560415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04110 561011 562123 gene locus_tag LOCUS_04120 561011 562123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 563303 562545 gene locus_tag LOCUS_04130 563303 562545 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921908.1 protein_id gnl|my_center|LOCUS_04130 563388 563966 gene locus_tag LOCUS_04140 563388 563966 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903986.1 protein_id gnl|my_center|LOCUS_04140 564070 565230 gene locus_tag LOCUS_04150 564070 565230 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921907.1 protein_id gnl|my_center|LOCUS_04150 565297 566160 gene locus_tag LOCUS_04160 565297 566160 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107810.1 protein_id gnl|my_center|LOCUS_04160 566911 566336 gene locus_tag LOCUS_04170 566911 566336 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_04170 568133 566982 gene locus_tag LOCUS_04180 568133 566982 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_04180 570107 568341 gene locus_tag LOCUS_04190 570107 568341 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_04190 571054 570137 gene locus_tag LOCUS_04200 571054 570137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04200 573198 571003 gene locus_tag LOCUS_04210 573198 571003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04210 575677 573893 gene locus_tag LOCUS_04220 575677 573893 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_04220 576337 577314 gene locus_tag LOCUS_04230 576337 577314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 577697 577909 gene locus_tag LOCUS_04240 577697 577909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 578584 581718 gene locus_tag LOCUS_04250 578584 581718 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_04250 581894 583234 gene locus_tag LOCUS_04260 581894 583234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 583480 585195 gene locus_tag LOCUS_04270 583480 585195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 587629 585548 gene locus_tag LOCUS_04280 587629 585548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 587927 589036 gene locus_tag LOCUS_04290 587927 589036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 589871 590119 gene locus_tag LOCUS_04300 589871 590119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 590277 591227 gene locus_tag LOCUS_04310 590277 591227 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 protein_id gnl|my_center|LOCUS_04310 592202 591309 gene locus_tag LOCUS_04320 gene uvsE 592202 591309 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961166.1 protein_id gnl|my_center|LOCUS_04320 592697 592302 gene locus_tag LOCUS_04330 592697 592302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 593891 593223 gene locus_tag LOCUS_04340 593891 593223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 594695 594246 gene locus_tag LOCUS_04350 594695 594246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 596338 595088 gene locus_tag LOCUS_04360 596338 595088 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_04360 596469 597191 gene locus_tag LOCUS_04370 gene radC 596469 597191 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_04370 597530 598153 gene locus_tag LOCUS_04380 597530 598153 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902507.1 protein_id gnl|my_center|LOCUS_04380 598269 600683 gene locus_tag LOCUS_04390 gene pheT 598269 600683 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_04390 600686 600982 gene locus_tag LOCUS_04400 600686 600982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 601124 601414 gene locus_tag LOCUS_04410 601124 601414 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_04410 601513 603078 gene locus_tag LOCUS_04420 gene rny 601513 603078 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760083.1 protein_id gnl|my_center|LOCUS_04420 603382 604359 gene locus_tag LOCUS_04430 603382 604359 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_04430 605475 604408 gene locus_tag LOCUS_04440 605475 604408 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957692.1 protein_id gnl|my_center|LOCUS_04440 606735 605587 gene locus_tag LOCUS_04450 606735 605587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 607348 609636 gene locus_tag LOCUS_04460 607348 609636 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_04460 612881 609759 gene locus_tag LOCUS_04470 612881 609759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 613876 613634 gene locus_tag LOCUS_04480 613876 613634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 614392 615873 gene locus_tag LOCUS_04490 614392 615873 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_04490 616186 617100 gene locus_tag LOCUS_04500 616186 617100 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141477.1 protein_id gnl|my_center|LOCUS_04500 617344 618216 gene locus_tag LOCUS_04510 617344 618216 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_04510 618680 618300 gene locus_tag LOCUS_04520 618680 618300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494187.1 protein_id gnl|my_center|LOCUS_04520 618878 619900 gene locus_tag LOCUS_04530 618878 619900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 621761 620217 gene locus_tag LOCUS_04540 621761 620217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 622715 621780 gene locus_tag LOCUS_04550 622715 621780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 624872 623133 gene locus_tag LOCUS_04560 624872 623133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 624966 625727 gene locus_tag LOCUS_04570 624966 625727 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208285.1 protein_id gnl|my_center|LOCUS_04570 625718 626044 gene locus_tag LOCUS_04580 625718 626044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04580 626132 626776 gene locus_tag LOCUS_04590 626132 626776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 626921 628339 gene locus_tag LOCUS_04600 626921 628339 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202983.1 protein_id gnl|my_center|LOCUS_04600 628508 629809 gene locus_tag LOCUS_04610 628508 629809 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109014.1 protein_id gnl|my_center|LOCUS_04610 629813 631342 gene locus_tag LOCUS_04620 629813 631342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 631431 632510 gene locus_tag LOCUS_04630 631431 632510 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_04630 632515 634731 gene locus_tag LOCUS_04640 632515 634731 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_04640 634865 636022 gene locus_tag LOCUS_04650 634865 636022 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_04650 637146 636049 gene locus_tag LOCUS_04660 637146 636049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842007.1 protein_id gnl|my_center|LOCUS_04660 637713 639230 gene locus_tag LOCUS_04670 637713 639230 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695913.1 protein_id gnl|my_center|LOCUS_04670 640858 640424 gene locus_tag LOCUS_04680 640858 640424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04680 641235 640858 gene locus_tag LOCUS_04690 641235 640858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04690 641907 641245 gene locus_tag LOCUS_04700 641907 641245 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 protein_id gnl|my_center|LOCUS_04700 642931 641900 gene locus_tag LOCUS_04710 gene metN 642931 641900 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594016.1 protein_id gnl|my_center|LOCUS_04710 644147 643044 gene locus_tag LOCUS_04720 gene solA 644147 643044 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_04720 644478 644909 gene locus_tag LOCUS_04730 644478 644909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 644915 645523 gene locus_tag LOCUS_04740 644915 645523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 645516 647579 gene locus_tag LOCUS_04750 645516 647579 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444445.1 protein_id gnl|my_center|LOCUS_04750 648612 650615 gene locus_tag LOCUS_04760 648612 650615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 650635 651942 gene locus_tag LOCUS_04770 650635 651942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 651900 653639 gene locus_tag LOCUS_04780 651900 653639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04780 653655 655205 gene locus_tag LOCUS_04790 653655 655205 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_04790 655281 656000 gene locus_tag LOCUS_04800 655281 656000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 656341 656928 gene locus_tag LOCUS_04810 656341 656928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 657255 656896 gene locus_tag LOCUS_04820 657255 656896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 657167 657982 gene locus_tag LOCUS_04830 657167 657982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 658655 658975 gene locus_tag LOCUS_04840 658655 658975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 659022 659228 gene locus_tag LOCUS_04850 659022 659228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 659880 660863 gene locus_tag LOCUS_04860 659880 660863 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 protein_id gnl|my_center|LOCUS_04860 661139 663259 gene locus_tag LOCUS_04870 661139 663259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 663263 664174 gene locus_tag LOCUS_04880 663263 664174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 664179 665900 gene locus_tag LOCUS_04890 664179 665900 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_04890 666114 666590 gene locus_tag LOCUS_04900 666114 666590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 666890 666815 gene locus_tag LOCUS_t00080 666890 666815 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 666980 667609 gene locus_tag LOCUS_04910 666980 667609 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_04910 667599 668744 gene locus_tag LOCUS_04920 667599 668744 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_04920 669080 669859 gene locus_tag LOCUS_04930 669080 669859 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_04930 670367 669963 gene locus_tag LOCUS_04940 670367 669963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 671241 670426 gene locus_tag LOCUS_04950 671241 670426 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 protein_id gnl|my_center|LOCUS_04950 672003 673649 gene locus_tag LOCUS_04960 672003 673649 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_04960 673679 674209 gene locus_tag LOCUS_04970 673679 674209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 675335 674433 gene locus_tag LOCUS_04980 675335 674433 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_04980 675703 676113 gene locus_tag LOCUS_04990 675703 676113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 676338 678710 gene locus_tag LOCUS_05000 676338 678710 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_05000 678932 678765 gene locus_tag LOCUS_05010 678932 678765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 678927 679880 gene locus_tag LOCUS_05020 678927 679880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 679897 680664 gene locus_tag LOCUS_05030 679897 680664 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_05030 683215 681068 gene locus_tag LOCUS_05040 683215 681068 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_05040 683970 684584 gene locus_tag LOCUS_05050 683970 684584 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839715.1 protein_id gnl|my_center|LOCUS_05050 685333 684764 gene locus_tag LOCUS_05060 685333 684764 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_05060 686071 685520 gene locus_tag LOCUS_05070 686071 685520 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_05070 688465 686354 gene locus_tag LOCUS_05080 688465 686354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 689049 690569 gene locus_tag LOCUS_05090 689049 690569 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028523746.1 protein_id gnl|my_center|LOCUS_05090 690700 692145 gene locus_tag LOCUS_05100 gene uxaC 690700 692145 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_05100 692421 693305 gene locus_tag LOCUS_05110 692421 693305 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_05110 693371 693928 gene locus_tag LOCUS_05120 693371 693928 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_05120 698135 694524 gene locus_tag LOCUS_05130 698135 694524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 698462 700057 gene locus_tag LOCUS_05140 698462 700057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 700577 701146 gene locus_tag LOCUS_05150 700577 701146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 701151 701981 gene locus_tag LOCUS_05160 701151 701981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 704467 702905 gene locus_tag LOCUS_05170 704467 702905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 705498 708350 gene locus_tag LOCUS_05180 705498 708350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 709356 708433 gene locus_tag LOCUS_05190 709356 708433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 710072 709437 gene locus_tag LOCUS_05200 710072 709437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 711406 710534 gene locus_tag LOCUS_05210 711406 710534 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_05210 712189 714228 gene locus_tag LOCUS_05220 712189 714228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05220 714339 715286 gene locus_tag LOCUS_05230 714339 715286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05230 715298 717142 gene locus_tag LOCUS_05240 715298 717142 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_05240 717152 717832 gene locus_tag LOCUS_05250 717152 717832 CDS product DUF3823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053826137.1 protein_id gnl|my_center|LOCUS_05250 718100 719950 gene locus_tag LOCUS_05260 718100 719950 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_05260 720113 720760 gene locus_tag LOCUS_05270 720113 720760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 720987 723455 gene locus_tag LOCUS_05280 720987 723455 CDS product DUF4965 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658082.1 protein_id gnl|my_center|LOCUS_05280 723884 725530 gene locus_tag LOCUS_05290 gene araD 723884 725530 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_05290 725840 727156 gene locus_tag LOCUS_05300 gene gntT 725840 727156 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131761.1 protein_id gnl|my_center|LOCUS_05300 727171 727587 gene locus_tag LOCUS_05310 727171 727587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 727649 728665 gene locus_tag LOCUS_05320 727649 728665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 728822 730435 gene locus_tag LOCUS_05330 728822 730435 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109097.1 protein_id gnl|my_center|LOCUS_05330 730686 732611 gene locus_tag LOCUS_05340 730686 732611 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_05340 732635 733843 gene locus_tag LOCUS_05350 732635 733843 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_05350 734572 734069 gene locus_tag LOCUS_05360 734572 734069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 734743 735738 gene locus_tag LOCUS_05370 734743 735738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 736868 736005 gene locus_tag LOCUS_05380 736868 736005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 737917 736916 gene locus_tag LOCUS_05390 737917 736916 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_05390 741667 737927 gene locus_tag LOCUS_05400 741667 737927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 743104 741779 gene locus_tag LOCUS_05410 743104 741779 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_05410 743829 743119 gene locus_tag LOCUS_05420 743829 743119 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_05420 744093 745391 gene locus_tag LOCUS_05430 744093 745391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 745641 746078 gene locus_tag LOCUS_05440 745641 746078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 747153 746812 gene locus_tag LOCUS_05450 747153 746812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 747212 747949 gene locus_tag LOCUS_05460 747212 747949 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_05460 747952 748926 gene locus_tag LOCUS_05470 747952 748926 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_05470 748959 749561 gene locus_tag LOCUS_05480 748959 749561 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_05480 750528 749650 gene locus_tag LOCUS_05490 750528 749650 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_05490 751311 750583 gene locus_tag LOCUS_05500 751311 750583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_05500 751406 752119 gene locus_tag LOCUS_05510 751406 752119 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_05510 752432 753343 gene locus_tag LOCUS_05520 gene gldA 752432 753343 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_05520 753540 754268 gene locus_tag LOCUS_05530 gene gldF 753540 754268 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_05530 754262 755965 gene locus_tag LOCUS_05540 gene gldG 754262 755965 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_05540 756319 757443 gene locus_tag LOCUS_05550 gene dnaN 756319 757443 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_05550 757637 757969 gene locus_tag LOCUS_05560 gene gldC 757637 757969 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_05560 758479 758024 gene locus_tag LOCUS_05570 758479 758024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 759612 759076 gene locus_tag LOCUS_05580 gene dcd 759612 759076 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_05580 761014 759719 gene locus_tag LOCUS_05590 gene hemL 761014 759719 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933753.1 protein_id gnl|my_center|LOCUS_05590 762727 761042 gene locus_tag LOCUS_05600 762727 761042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 764724 763195 gene locus_tag LOCUS_05610 gene guaA 764724 763195 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_05610 766312 764798 gene locus_tag LOCUS_05620 766312 764798 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889464.1 protein_id gnl|my_center|LOCUS_05620 766491 767810 gene locus_tag LOCUS_05630 766491 767810 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_05630 768055 768711 gene locus_tag LOCUS_05640 gene fsa 768055 768711 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_05640 768815 769018 gene locus_tag LOCUS_05650 768815 769018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 769021 769737 gene locus_tag LOCUS_05660 769021 769737 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_05660 769727 770635 gene locus_tag LOCUS_05670 769727 770635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 771703 770750 gene locus_tag LOCUS_05680 771703 770750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 771810 772946 gene locus_tag LOCUS_05690 771810 772946 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_05690 773055 774047 gene locus_tag LOCUS_05700 773055 774047 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_05700 775552 774071 gene locus_tag LOCUS_05710 775552 774071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 776931 775597 gene locus_tag LOCUS_05720 776931 775597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 778229 776934 gene locus_tag LOCUS_05730 778229 776934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 779269 778229 gene locus_tag LOCUS_05740 gene pseI 779269 778229 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_05740 780755 779295 gene locus_tag LOCUS_05750 gene pseG 780755 779295 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707836.1 protein_id gnl|my_center|LOCUS_05750 781722 781009 gene locus_tag LOCUS_05760 781722 781009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870576.1 protein_id gnl|my_center|LOCUS_05760 782915 781740 gene locus_tag LOCUS_05770 gene pseC 782915 781740 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_05770 784120 783101 gene locus_tag LOCUS_05780 gene pseB 784120 783101 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_05780 784291 785391 gene locus_tag LOCUS_05790 784291 785391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 786869 785547 gene locus_tag LOCUS_05800 786869 785547 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_05800 787023 788351 gene locus_tag LOCUS_05810 gene ffh 787023 788351 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_05810 789610 789131 gene locus_tag LOCUS_05820 789610 789131 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_05820 790118 789750 gene locus_tag LOCUS_05830 790118 789750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 790470 790931 gene locus_tag LOCUS_05840 790470 790931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 791054 792352 gene locus_tag LOCUS_05850 791054 792352 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_05850 792368 793420 gene locus_tag LOCUS_05860 792368 793420 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_05860 793460 796633 gene locus_tag LOCUS_05870 793460 796633 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_05870 796908 797441 gene locus_tag LOCUS_05880 796908 797441 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_05880 798369 797590 gene locus_tag LOCUS_05890 798369 797590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 799165 803568 gene locus_tag LOCUS_05900 799165 803568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 804079 805614 gene locus_tag LOCUS_05910 804079 805614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 806206 806769 gene locus_tag LOCUS_05920 806206 806769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 807042 807395 gene locus_tag LOCUS_05930 807042 807395 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546328.1 protein_id gnl|my_center|LOCUS_05930 807978 807697 gene locus_tag LOCUS_05940 807978 807697 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036600.1 protein_id gnl|my_center|LOCUS_05940 808492 808175 gene locus_tag LOCUS_05950 808492 808175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 808761 809828 gene locus_tag LOCUS_05960 808761 809828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 809920 810255 gene locus_tag LOCUS_05970 809920 810255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 811240 810395 gene locus_tag LOCUS_05980 811240 810395 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405476.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05980 811962 811890 gene locus_tag LOCUS_t00090 811962 811890 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 812927 812055 gene locus_tag LOCUS_05990 812927 812055 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989536.1 protein_id gnl|my_center|LOCUS_05990 813714 812980 gene locus_tag LOCUS_06000 813714 812980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 814471 813938 gene locus_tag LOCUS_06010 814471 813938 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971128.1 protein_id gnl|my_center|LOCUS_06010 816520 815162 gene locus_tag LOCUS_06020 816520 815162 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_06020 817707 816595 gene locus_tag LOCUS_06030 817707 816595 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_06030 817975 818985 gene locus_tag LOCUS_06040 817975 818985 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_06040 820813 819734 gene locus_tag LOCUS_06050 820813 819734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 822162 821014 gene locus_tag LOCUS_06060 822162 821014 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_06060 825756 822253 gene locus_tag LOCUS_06070 825756 822253 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184173497.1 protein_id gnl|my_center|LOCUS_06070 827677 826145 gene locus_tag LOCUS_06080 827677 826145 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_06080 830808 827719 gene locus_tag LOCUS_06090 830808 827719 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_06090 831393 832865 gene locus_tag LOCUS_06100 831393 832865 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528002.1 protein_id gnl|my_center|LOCUS_06100 833688 833440 gene locus_tag LOCUS_06110 833688 833440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 833961 833755 gene locus_tag LOCUS_06120 833961 833755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 834041 834772 gene locus_tag LOCUS_06130 834041 834772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 836774 835443 gene locus_tag LOCUS_06140 gene kynU 836774 835443 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_06140 837338 838540 gene locus_tag LOCUS_06150 837338 838540 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525271.1 protein_id gnl|my_center|LOCUS_06150 838794 840143 gene locus_tag LOCUS_06160 838794 840143 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_06160 841032 840265 gene locus_tag LOCUS_06170 841032 840265 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_06170 842126 841032 gene locus_tag LOCUS_06180 842126 841032 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_06180 842642 842163 gene locus_tag LOCUS_06190 842642 842163 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_06190 842991 844178 gene locus_tag LOCUS_06200 842991 844178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 844416 844652 gene locus_tag LOCUS_06210 844416 844652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 844765 845208 gene locus_tag LOCUS_06220 844765 845208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 845708 846004 gene locus_tag LOCUS_06230 845708 846004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 846698 846093 gene locus_tag LOCUS_06240 846698 846093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 848380 846857 gene locus_tag LOCUS_06250 gene rpoN 848380 846857 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_06250 848616 850028 gene locus_tag LOCUS_06260 gene asnS 848616 850028 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_06260 851520 850186 gene locus_tag LOCUS_06270 851520 850186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 851755 852534 gene locus_tag LOCUS_06280 gene paaG 851755 852534 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_06280 852621 853247 gene locus_tag LOCUS_06290 852621 853247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 853906 853610 gene locus_tag LOCUS_06300 853906 853610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 857256 854359 gene locus_tag LOCUS_06310 gene uvrA 857256 854359 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_06310 857501 858586 gene locus_tag LOCUS_06320 857501 858586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 859547 858630 gene locus_tag LOCUS_06330 859547 858630 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_06330 860031 859678 gene locus_tag LOCUS_06340 860031 859678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 860261 860028 gene locus_tag LOCUS_06350 860261 860028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 861250 860387 gene locus_tag LOCUS_06360 861250 860387 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_06360 861883 861656 gene locus_tag LOCUS_06370 861883 861656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 862362 861901 gene locus_tag LOCUS_06380 862362 861901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 863740 862493 gene locus_tag LOCUS_06390 863740 862493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_06390 863861 864907 gene locus_tag LOCUS_06400 gene queA 863861 864907 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_06400 865040 865723 gene locus_tag LOCUS_06410 865040 865723 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_06410 866840 865761 gene locus_tag LOCUS_06420 gene dinB 866840 865761 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404287.1 protein_id gnl|my_center|LOCUS_06420 867049 868854 gene locus_tag LOCUS_06430 867049 868854 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_06430 868957 869517 gene locus_tag LOCUS_06440 868957 869517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 869628 869870 gene locus_tag LOCUS_06450 869628 869870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 869956 871050 gene locus_tag LOCUS_06460 869956 871050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 872512 871379 gene locus_tag LOCUS_06470 872512 871379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_06470 872674 873708 gene locus_tag LOCUS_06480 gene recA 872674 873708 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_06480 873868 874665 gene locus_tag LOCUS_06490 873868 874665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 874898 875563 gene locus_tag LOCUS_06500 874898 875563 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_06500 875570 876607 gene locus_tag LOCUS_06510 875570 876607 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_06510 876776 877489 gene locus_tag LOCUS_06520 876776 877489 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_06520 877798 878868 gene locus_tag LOCUS_06530 877798 878868 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072678.1 protein_id gnl|my_center|LOCUS_06530 880218 878893 gene locus_tag LOCUS_06540 gene dacB 880218 878893 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 protein_id gnl|my_center|LOCUS_06540 880538 881770 gene locus_tag LOCUS_06550 880538 881770 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_06550 881784 882242 gene locus_tag LOCUS_06560 881784 882242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 882280 882855 gene locus_tag LOCUS_06570 gene pnuC 882280 882855 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_06570 883524 882856 gene locus_tag LOCUS_06580 883524 882856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_06580 885715 883802 gene locus_tag LOCUS_06590 885715 883802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_06590 886815 886069 gene locus_tag LOCUS_06600 gene fabG 886815 886069 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_06600 887365 887541 gene locus_tag LOCUS_06610 887365 887541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 888905 890125 gene locus_tag LOCUS_06620 888905 890125 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953461.1 protein_id gnl|my_center|LOCUS_06620 891099 890392 gene locus_tag LOCUS_06630 891099 890392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 891383 892777 gene locus_tag LOCUS_06640 gene lpdA 891383 892777 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_06640 894321 893068 gene locus_tag LOCUS_06650 894321 893068 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_06650 894656 895927 gene locus_tag LOCUS_06660 894656 895927 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_06660 896077 897843 gene locus_tag LOCUS_06670 gene sppA 896077 897843 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_06670 897971 898807 gene locus_tag LOCUS_06680 897971 898807 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_06680 899401 903954 gene locus_tag LOCUS_06690 gene gltB 899401 903954 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227769.1 protein_id gnl|my_center|LOCUS_06690 903947 905428 gene locus_tag LOCUS_06700 903947 905428 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_06700 906575 905715 gene locus_tag LOCUS_06710 906575 905715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 907213 906644 gene locus_tag LOCUS_06720 907213 906644 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_06720 908158 907334 gene locus_tag LOCUS_06730 908158 907334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 910477 908165 gene locus_tag LOCUS_06740 910477 908165 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_06740 912603 910756 gene locus_tag LOCUS_06750 912603 910756 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_06750 912921 913529 gene locus_tag LOCUS_06760 912921 913529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 913669 914046 gene locus_tag LOCUS_06770 913669 914046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 914562 914107 gene locus_tag LOCUS_06780 914562 914107 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071088.1 protein_id gnl|my_center|LOCUS_06780 914914 915084 gene locus_tag LOCUS_06790 914914 915084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 915740 915144 gene locus_tag LOCUS_06800 915740 915144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 916189 915947 gene locus_tag LOCUS_06810 916189 915947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 916764 916282 gene locus_tag LOCUS_06820 916764 916282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 919579 917183 gene locus_tag LOCUS_06830 919579 917183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_06830 920090 921466 gene locus_tag LOCUS_06840 920090 921466 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_06840 921456 922823 gene locus_tag LOCUS_06850 921456 922823 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_06850 923303 922902 gene locus_tag LOCUS_06860 923303 922902 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_06860 924663 923317 gene locus_tag LOCUS_06870 924663 923317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 924959 925195 gene locus_tag LOCUS_06880 924959 925195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06880 926276 925431 gene locus_tag LOCUS_06890 926276 925431 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640183.1 protein_id gnl|my_center|LOCUS_06890 926979 926662 gene locus_tag LOCUS_06900 gene trxA 926979 926662 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_06900 927195 927746 gene locus_tag LOCUS_06910 927195 927746 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_06910 928557 927865 gene locus_tag LOCUS_06920 928557 927865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 929210 928779 gene locus_tag LOCUS_06930 929210 928779 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972923.1 protein_id gnl|my_center|LOCUS_06930 929421 930161 gene locus_tag LOCUS_06940 929421 930161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 930397 931434 gene locus_tag LOCUS_06950 930397 931434 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266144.1 protein_id gnl|my_center|LOCUS_06950 931561 932106 gene locus_tag LOCUS_06960 931561 932106 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_06960 932236 933357 gene locus_tag LOCUS_06970 932236 933357 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_06970 933686 934759 gene locus_tag LOCUS_06980 933686 934759 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_06980 934976 936442 gene locus_tag LOCUS_06990 934976 936442 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_06990 937137 936733 gene locus_tag LOCUS_07000 937137 936733 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895688.1 protein_id gnl|my_center|LOCUS_07000 937657 937304 gene locus_tag LOCUS_07010 937657 937304 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_07010 938470 937982 gene locus_tag LOCUS_07020 938470 937982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 941079 938485 gene locus_tag LOCUS_07030 941079 938485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 941755 941153 gene locus_tag LOCUS_07040 941755 941153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 942530 942354 gene locus_tag LOCUS_07050 942530 942354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 944368 943139 gene locus_tag LOCUS_07060 944368 943139 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113740.1 protein_id gnl|my_center|LOCUS_07060 945197 944706 gene locus_tag LOCUS_07070 945197 944706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 945580 947004 gene locus_tag LOCUS_07080 945580 947004 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_07080 947336 947881 gene locus_tag LOCUS_07090 gene bstA 947336 947881 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_07090 948070 948438 gene locus_tag LOCUS_07100 948070 948438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 948638 949783 gene locus_tag LOCUS_07110 948638 949783 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_07110 949808 950569 gene locus_tag LOCUS_07120 949808 950569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 950645 950875 gene locus_tag LOCUS_07130 950645 950875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 951122 951523 gene locus_tag LOCUS_07140 951122 951523 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_07140 952373 951576 gene locus_tag LOCUS_07150 952373 951576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07150 952804 952313 gene locus_tag LOCUS_07160 952804 952313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07160 953282 954823 gene locus_tag LOCUS_07170 953282 954823 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503887.1 protein_id gnl|my_center|LOCUS_07170 955422 954931 gene locus_tag LOCUS_07180 955422 954931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 955716 955453 gene locus_tag LOCUS_07190 955716 955453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 956158 955886 gene locus_tag LOCUS_07200 956158 955886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 956373 956867 gene locus_tag LOCUS_07210 956373 956867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 957414 957094 gene locus_tag LOCUS_07220 957414 957094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07220 958820 957510 gene locus_tag LOCUS_07230 958820 957510 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_07230 959722 959024 gene locus_tag LOCUS_07240 959722 959024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 959839 960564 gene locus_tag LOCUS_07250 959839 960564 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_07250 960675 961079 gene locus_tag LOCUS_07260 960675 961079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 961376 962449 gene locus_tag LOCUS_07270 961376 962449 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_07270 962440 963048 gene locus_tag LOCUS_07280 gene sigW 962440 963048 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_07280 963218 963838 gene locus_tag LOCUS_07290 gene rsmG 963218 963838 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_07290 964028 964597 gene locus_tag LOCUS_07300 964028 964597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 964760 965671 gene locus_tag LOCUS_07310 964760 965671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 965871 966524 gene locus_tag LOCUS_07320 965871 966524 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_07320 966709 967077 gene locus_tag LOCUS_07330 966709 967077 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035971.1 protein_id gnl|my_center|LOCUS_07330 967215 967586 gene locus_tag LOCUS_07340 967215 967586 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097074.1 protein_id gnl|my_center|LOCUS_07340 967934 968881 gene locus_tag LOCUS_07350 967934 968881 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183508.1 protein_id gnl|my_center|LOCUS_07350 969081 969989 gene locus_tag LOCUS_07360 969081 969989 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967904.1 protein_id gnl|my_center|LOCUS_07360 969993 970451 gene locus_tag LOCUS_07370 969993 970451 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325590.1 protein_id gnl|my_center|LOCUS_07370 970847 973843 gene locus_tag LOCUS_07380 970847 973843 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_07380 974016 974621 gene locus_tag LOCUS_07390 974016 974621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 974722 975267 gene locus_tag LOCUS_07400 974722 975267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 976173 975319 gene locus_tag LOCUS_07410 976173 975319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 977225 976431 gene locus_tag LOCUS_07420 977225 976431 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_07420 977621 977250 gene locus_tag LOCUS_07430 977621 977250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 978882 977716 gene locus_tag LOCUS_07440 978882 977716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 979235 979999 gene locus_tag LOCUS_07450 979235 979999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 980113 980541 gene locus_tag LOCUS_07460 980113 980541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 981222 980608 gene locus_tag LOCUS_07470 981222 980608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 981764 981219 gene locus_tag LOCUS_07480 981764 981219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 982517 983659 gene locus_tag LOCUS_07490 982517 983659 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_07490 984410 983943 gene locus_tag LOCUS_07500 984410 983943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 985330 984848 gene locus_tag LOCUS_07510 985330 984848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 985849 987255 gene locus_tag LOCUS_07520 985849 987255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 987307 990546 gene locus_tag LOCUS_07530 987307 990546 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_07530 990536 991675 gene locus_tag LOCUS_07540 990536 991675 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_07540 992761 991823 gene locus_tag LOCUS_07550 992761 991823 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074942.1 protein_id gnl|my_center|LOCUS_07550 993182 993709 gene locus_tag LOCUS_07560 993182 993709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 993811 994686 gene locus_tag LOCUS_07570 993811 994686 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_07570 995122 994868 gene locus_tag LOCUS_07580 995122 994868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 995523 997883 gene locus_tag LOCUS_07590 995523 997883 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_07590 998183 999340 gene locus_tag LOCUS_07600 998183 999340 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_07600 999501 999887 gene locus_tag LOCUS_07610 999501 999887 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_07610 1000104 1001144 gene locus_tag LOCUS_07620 gene ruvB 1000104 1001144 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_07620 1001326 1002261 gene locus_tag LOCUS_07630 gene queG 1001326 1002261 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_07630 1002454 1002266 gene locus_tag LOCUS_07640 1002454 1002266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1003571 1002732 gene locus_tag LOCUS_07650 1003571 1002732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1004361 1003594 gene locus_tag LOCUS_07660 1004361 1003594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1004664 1006103 gene locus_tag LOCUS_07670 1004664 1006103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 1006108 1007187 gene locus_tag LOCUS_07680 gene aroC 1006108 1007187 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_07680 1007453 1008541 gene locus_tag LOCUS_07690 1007453 1008541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1010119 1008749 gene locus_tag LOCUS_07700 1010119 1008749 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_07700 1010343 1010963 gene locus_tag LOCUS_07710 1010343 1010963 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083622.1 protein_id gnl|my_center|LOCUS_07710 1014117 1011049 gene locus_tag LOCUS_07720 gene secDF 1014117 1011049 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_07720 1015335 1014703 gene locus_tag LOCUS_07730 gene udk 1015335 1014703 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640313.1 protein_id gnl|my_center|LOCUS_07730 1016198 1015425 gene locus_tag LOCUS_07740 1016198 1015425 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_07740 1016292 1017317 gene locus_tag LOCUS_07750 1016292 1017317 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_07750 1017453 1017881 gene locus_tag LOCUS_07760 1017453 1017881 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 protein_id gnl|my_center|LOCUS_07760 1018298 1020001 gene locus_tag LOCUS_07770 1018298 1020001 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_07770 1020215 1020988 gene locus_tag LOCUS_07780 1020215 1020988 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_07780 1021029 1021496 gene locus_tag LOCUS_07790 1021029 1021496 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_07790 1021510 1022412 gene locus_tag LOCUS_07800 1021510 1022412 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_07800 1022650 1022814 gene locus_tag LOCUS_07810 1022650 1022814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1022983 1023498 gene locus_tag LOCUS_07820 1022983 1023498 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_07820 1023528 1025009 gene locus_tag LOCUS_07830 gene crtI 1023528 1025009 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_07830 1025109 1025942 gene locus_tag LOCUS_07840 1025109 1025942 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_07840 1025972 1026472 gene locus_tag LOCUS_07850 1025972 1026472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1026472 1027170 gene locus_tag LOCUS_07860 1026472 1027170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1027176 1028021 gene locus_tag LOCUS_07870 1027176 1028021 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_07870 1028031 1028717 gene locus_tag LOCUS_07880 1028031 1028717 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530149.1 protein_id gnl|my_center|LOCUS_07880 1029188 1028826 gene locus_tag LOCUS_07890 1029188 1028826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1031499 1029265 gene locus_tag LOCUS_07900 1031499 1029265 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_07900 1032010 1031591 gene locus_tag LOCUS_07910 1032010 1031591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1032344 1032811 gene locus_tag LOCUS_07920 gene mraZ 1032344 1032811 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_07920 1032812 1033717 gene locus_tag LOCUS_07930 gene rsmH 1032812 1033717 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_07930 1033829 1034263 gene locus_tag LOCUS_07940 1033829 1034263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1034247 1036343 gene locus_tag LOCUS_07950 1034247 1036343 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_07950 1036343 1037806 gene locus_tag LOCUS_07960 1036343 1037806 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_07960 1037941 1039158 gene locus_tag LOCUS_07970 gene mraY 1037941 1039158 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_07970 1039242 1039571 gene locus_tag LOCUS_07980 1039242 1039571 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963769.1 protein_id gnl|my_center|LOCUS_07980 1039590 1040945 gene locus_tag LOCUS_07990 gene murD 1039590 1040945 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_07990 1041024 1042196 gene locus_tag LOCUS_08000 1041024 1042196 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_08000 1042186 1043295 gene locus_tag LOCUS_08010 gene murG 1042186 1043295 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_08010 1043292 1045454 gene locus_tag LOCUS_08020 1043292 1045454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 1045464 1046786 gene locus_tag LOCUS_08030 gene ftsA 1045464 1046786 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_08030 1046811 1048349 gene locus_tag LOCUS_08040 1046811 1048349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1048842 1048543 gene locus_tag LOCUS_08050 1048842 1048543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1049315 1050889 gene locus_tag LOCUS_08060 1049315 1050889 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_08060 1051008 1051565 gene locus_tag LOCUS_08070 1051008 1051565 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142184.1 protein_id gnl|my_center|LOCUS_08070 1051558 1052103 gene locus_tag LOCUS_08080 1051558 1052103 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143387867.1 protein_id gnl|my_center|LOCUS_08080 1052573 1052214 gene locus_tag LOCUS_08090 1052573 1052214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1052802 1053218 gene locus_tag LOCUS_08100 1052802 1053218 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_08100 1054571 1053381 gene locus_tag LOCUS_08110 gene sucC 1054571 1053381 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_08110 1055877 1054795 gene locus_tag LOCUS_08120 1055877 1054795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_08120 1056127 1056780 gene locus_tag LOCUS_08130 1056127 1056780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_08130 1057340 1058146 gene locus_tag LOCUS_08140 1057340 1058146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1060569 1058281 gene locus_tag LOCUS_08150 1060569 1058281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1062042 1061794 gene locus_tag LOCUS_08160 1062042 1061794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1062222 1063910 gene locus_tag LOCUS_08170 1062222 1063910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812205.1 protein_id gnl|my_center|LOCUS_08170 1064644 1064030 gene locus_tag LOCUS_08180 1064644 1064030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1066102 1065191 gene locus_tag LOCUS_08190 1066102 1065191 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113810.1 protein_id gnl|my_center|LOCUS_08190 1066977 1066156 gene locus_tag LOCUS_08200 1066977 1066156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1067859 1068236 gene locus_tag LOCUS_08210 1067859 1068236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1069218 1068754 gene locus_tag LOCUS_08220 1069218 1068754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1069181 1069438 gene locus_tag LOCUS_08230 1069181 1069438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1069866 1069645 gene locus_tag LOCUS_08240 1069866 1069645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1070178 1069924 gene locus_tag LOCUS_08250 gene yoeB 1070178 1069924 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_08250 1070441 1070175 gene locus_tag LOCUS_08260 1070441 1070175 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 protein_id gnl|my_center|LOCUS_08260 1070677 1070603 gene locus_tag LOCUS_t00100 1070677 1070603 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1072532 1070778 gene locus_tag LOCUS_08270 1072532 1070778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_08270 1073143 1074282 gene locus_tag LOCUS_08280 gene nusB 1073143 1074282 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768080.1 protein_id gnl|my_center|LOCUS_08280 1074367 1074678 gene locus_tag LOCUS_08290 1074367 1074678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1074789 1075790 gene locus_tag LOCUS_08300 1074789 1075790 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404422.1 protein_id gnl|my_center|LOCUS_08300 1075900 1076427 gene locus_tag LOCUS_08310 1075900 1076427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1076436 1076744 gene locus_tag LOCUS_08320 gene yajC 1076436 1076744 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_08320 1076746 1077744 gene locus_tag LOCUS_08330 1076746 1077744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1077746 1078363 gene locus_tag LOCUS_08340 gene coaE 1077746 1078363 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_08340 1079670 1078453 gene locus_tag LOCUS_08350 gene uxuA 1079670 1078453 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_08350 1079966 1082134 gene locus_tag LOCUS_08360 1079966 1082134 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 protein_id gnl|my_center|LOCUS_08360 1082205 1083329 gene locus_tag LOCUS_08370 1082205 1083329 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_08370 1085706 1083373 gene locus_tag LOCUS_08380 1085706 1083373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1086414 1086160 gene locus_tag LOCUS_08390 1086414 1086160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1086720 1086472 gene locus_tag LOCUS_08400 1086720 1086472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1089339 1086835 gene locus_tag LOCUS_08410 1089339 1086835 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_08410 1090559 1089990 gene locus_tag LOCUS_08420 1090559 1089990 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_08420 1091093 1092232 gene locus_tag LOCUS_08430 1091093 1092232 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_08430 1093193 1092444 gene locus_tag LOCUS_08440 1093193 1092444 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_08440 1093704 1094240 gene locus_tag LOCUS_08450 1093704 1094240 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_08450 1094311 1095246 gene locus_tag LOCUS_08460 1094311 1095246 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339003.1 protein_id gnl|my_center|LOCUS_08460 1097918 1095477 gene locus_tag LOCUS_08470 1097918 1095477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1098177 1098252 gene locus_tag LOCUS_t00110 1098177 1098252 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1098560 1099351 gene locus_tag LOCUS_08480 gene cas6 1098560 1099351 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_08480 1099455 1099724 gene locus_tag LOCUS_08490 1099455 1099724 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_08490 1099813 1100154 gene locus_tag LOCUS_08500 1099813 1100154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1100376 1101767 gene locus_tag LOCUS_08510 gene cas8a1 1100376 1101767 CDS product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023575.1 protein_id gnl|my_center|LOCUS_08510 1101895 1102869 gene locus_tag LOCUS_08520 gene cas7i 1101895 1102869 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_08520 1102869 1103546 gene locus_tag LOCUS_08530 gene cas5b 1102869 1103546 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023573.1 protein_id gnl|my_center|LOCUS_08530 1103539 1105860 gene locus_tag LOCUS_08540 1103539 1105860 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065767.1 protein_id gnl|my_center|LOCUS_08540 1105894 1106397 gene locus_tag LOCUS_08550 gene cas4 1105894 1106397 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_08550 1106450 1107454 gene locus_tag LOCUS_08560 gene cas1b 1106450 1107454 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_08560 1107458 1107721 gene locus_tag LOCUS_08570 gene cas2 1107458 1107721 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 protein_id gnl|my_center|LOCUS_08570 1107936 1111477 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctttaatcgcactatgttagaattgaaat 1111732 1111541 gene locus_tag LOCUS_08580 1111732 1111541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1112765 1112142 gene locus_tag LOCUS_08590 1112765 1112142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1113209 1112919 gene locus_tag LOCUS_08600 1113209 1112919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1113912 1114202 gene locus_tag LOCUS_08610 1113912 1114202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1114903 1115394 gene locus_tag LOCUS_08620 1114903 1115394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1115403 1115894 gene locus_tag LOCUS_08630 1115403 1115894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1115991 1116599 gene locus_tag LOCUS_08640 1115991 1116599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1117020 1116562 gene locus_tag LOCUS_08650 1117020 1116562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1119775 1117028 gene locus_tag LOCUS_08660 1119775 1117028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1121136 1120093 gene locus_tag LOCUS_08670 1121136 1120093 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085648.1 protein_id gnl|my_center|LOCUS_08670 1121513 1121136 gene locus_tag LOCUS_08680 1121513 1121136 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085647.1 protein_id gnl|my_center|LOCUS_08680 1122879 1121557 gene locus_tag LOCUS_08690 1122879 1121557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1125195 1122958 gene locus_tag LOCUS_08700 1125195 1122958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1127335 1125740 gene locus_tag LOCUS_08710 1127335 1125740 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083762.1 protein_id gnl|my_center|LOCUS_08710 1128081 1127464 gene locus_tag LOCUS_08720 1128081 1127464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1128749 1128078 gene locus_tag LOCUS_08730 gene modB 1128749 1128078 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349469.1 protein_id gnl|my_center|LOCUS_08730 1129517 1128768 gene locus_tag LOCUS_08740 gene modA 1129517 1128768 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_08740 1130041 1129532 gene locus_tag LOCUS_08750 1130041 1129532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1131594 1130476 gene locus_tag LOCUS_08760 1131594 1130476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_08760 1132616 1131591 gene locus_tag LOCUS_08770 1132616 1131591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_08770 1133922 1133179 gene locus_tag LOCUS_08780 1133922 1133179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1134859 1133933 gene locus_tag LOCUS_08790 1134859 1133933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1135800 1134856 gene locus_tag LOCUS_08800 1135800 1134856 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_08800 1137083 1135812 gene locus_tag LOCUS_08810 1137083 1135812 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692557.1 protein_id gnl|my_center|LOCUS_08810 1137722 1137108 gene locus_tag LOCUS_08820 1137722 1137108 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_08820 1138640 1138329 gene locus_tag LOCUS_08830 1138640 1138329 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_08830 1139068 1138637 gene locus_tag LOCUS_08840 1139068 1138637 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_08840 1140329 1139079 gene locus_tag LOCUS_08850 1140329 1139079 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767609.1 protein_id gnl|my_center|LOCUS_08850 1141680 1140334 gene locus_tag LOCUS_08860 gene sufD 1141680 1140334 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194301.1 protein_id gnl|my_center|LOCUS_08860 1142449 1141682 gene locus_tag LOCUS_08870 gene sufC 1142449 1141682 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_08870 1143914 1142469 gene locus_tag LOCUS_08880 gene sufB 1143914 1142469 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_08880 1144138 1143938 gene locus_tag LOCUS_08890 1144138 1143938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08890 1144611 1145276 gene locus_tag LOCUS_08900 1144611 1145276 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817450.1 protein_id gnl|my_center|LOCUS_08900 1145856 1145536 gene locus_tag LOCUS_08910 1145856 1145536 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_08910 1146875 1145871 gene locus_tag LOCUS_08920 1146875 1145871 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_08920 1147443 1147880 gene locus_tag LOCUS_08930 1147443 1147880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_08930 1148450 1148692 gene locus_tag LOCUS_08940 1148450 1148692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1149683 1148910 gene locus_tag LOCUS_08950 1149683 1148910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1150576 1149683 gene locus_tag LOCUS_08960 1150576 1149683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_08960 1153014 1151281 gene locus_tag LOCUS_08970 1153014 1151281 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_08970 1154417 1153383 gene locus_tag LOCUS_08980 1154417 1153383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1154953 1156947 gene locus_tag LOCUS_08990 1154953 1156947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1157982 1157128 gene locus_tag LOCUS_09000 1157982 1157128 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837168.1 protein_id gnl|my_center|LOCUS_09000 1158247 1158894 gene locus_tag LOCUS_09010 1158247 1158894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1159528 1159100 gene locus_tag LOCUS_09020 1159528 1159100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1160186 1159677 gene locus_tag LOCUS_09030 1160186 1159677 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948144.1 protein_id gnl|my_center|LOCUS_09030 1160500 1161645 gene locus_tag LOCUS_09040 1160500 1161645 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_09040 1161752 1162174 gene locus_tag LOCUS_09050 1161752 1162174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09050 1163656 1162766 gene locus_tag LOCUS_09060 1163656 1162766 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_09060 1163748 1164110 gene locus_tag LOCUS_09070 1163748 1164110 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_09070 1164449 1165333 gene locus_tag LOCUS_09080 1164449 1165333 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_09080 1166538 1165654 gene locus_tag LOCUS_09090 1166538 1165654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1167795 1166842 gene locus_tag LOCUS_09100 1167795 1166842 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 protein_id gnl|my_center|LOCUS_09100 1168890 1167970 gene locus_tag LOCUS_09110 1168890 1167970 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014113.1 protein_id gnl|my_center|LOCUS_09110 1170236 1169526 gene locus_tag LOCUS_09120 1170236 1169526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1170898 1171659 gene locus_tag LOCUS_09130 1170898 1171659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1173605 1171872 gene locus_tag LOCUS_09140 1173605 1171872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1174052 1174543 gene locus_tag LOCUS_09150 1174052 1174543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1174545 1175024 gene locus_tag LOCUS_09160 1174545 1175024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1176174 1176686 gene locus_tag LOCUS_09170 1176174 1176686 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_09170 1178803 1177358 gene locus_tag LOCUS_09180 1178803 1177358 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_09180 1181337 1178806 gene locus_tag LOCUS_09190 1181337 1178806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1181522 1181334 gene locus_tag LOCUS_09200 1181522 1181334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1182934 1181519 gene locus_tag LOCUS_09210 1182934 1181519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1183626 1182934 gene locus_tag LOCUS_09220 1183626 1182934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_09220 1184140 1183619 gene locus_tag LOCUS_09230 1184140 1183619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_09230 1184401 1186845 gene locus_tag LOCUS_09240 gene hrpB 1184401 1186845 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_09240 1187140 1187571 gene locus_tag LOCUS_09250 1187140 1187571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1188019 1188534 gene locus_tag LOCUS_09260 1188019 1188534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1189106 1188621 gene locus_tag LOCUS_09270 1189106 1188621 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771208.1 protein_id gnl|my_center|LOCUS_09270 1190318 1189275 gene locus_tag LOCUS_09280 1190318 1189275 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_09280 1190516 1191178 gene locus_tag LOCUS_09290 1190516 1191178 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_09290 1193445 1191322 gene locus_tag LOCUS_09300 1193445 1191322 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_09300 1194432 1193740 gene locus_tag LOCUS_09310 1194432 1193740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1195006 1194425 gene locus_tag LOCUS_09320 1195006 1194425 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_09320 1195218 1196042 gene locus_tag LOCUS_09330 1195218 1196042 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_09330 1196893 1196135 gene locus_tag LOCUS_09340 1196893 1196135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1199108 1197918 gene locus_tag LOCUS_09350 1199108 1197918 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_09350 1199378 1200415 gene locus_tag LOCUS_09360 gene aroB 1199378 1200415 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_09360 1200412 1201653 gene locus_tag LOCUS_09370 gene aroA 1200412 1201653 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_09370 1202443 1201754 gene locus_tag LOCUS_09380 1202443 1201754 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132220.1 protein_id gnl|my_center|LOCUS_09380 1203442 1202651 gene locus_tag LOCUS_09390 1203442 1202651 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_09390 1204614 1203544 gene locus_tag LOCUS_09400 1204614 1203544 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_09400 1206310 1204751 gene locus_tag LOCUS_09410 1206310 1204751 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_09410 1209032 1206450 gene locus_tag LOCUS_09420 1209032 1206450 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_09420 1209746 1209150 gene locus_tag LOCUS_09430 1209746 1209150 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_09430 1209841 1210335 gene locus_tag LOCUS_09440 1209841 1210335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09440 1210344 1210739 gene locus_tag LOCUS_09450 1210344 1210739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09450 1211497 1210910 gene locus_tag LOCUS_09460 1211497 1210910 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_09460 1211825 1215478 gene locus_tag LOCUS_09470 1211825 1215478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1215761 1216819 gene locus_tag LOCUS_09480 gene mltG 1215761 1216819 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_09480 1216964 1217371 gene locus_tag LOCUS_09490 1216964 1217371 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_09490 1217375 1218310 gene locus_tag LOCUS_09500 1217375 1218310 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_09500 1218567 1218652 gene locus_tag LOCUS_t00120 1218567 1218652 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1218831 1220408 gene locus_tag LOCUS_09510 1218831 1220408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1220692 1220877 gene locus_tag LOCUS_09520 1220692 1220877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1221589 1221158 gene locus_tag LOCUS_09530 1221589 1221158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1222450 1221734 gene locus_tag LOCUS_09540 1222450 1221734 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_09540 1224502 1222769 gene locus_tag LOCUS_09550 1224502 1222769 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_09550 1225032 1225430 gene locus_tag LOCUS_09560 1225032 1225430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1226063 1229188 gene locus_tag LOCUS_09570 1226063 1229188 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_09570 1229195 1230721 gene locus_tag LOCUS_09580 1229195 1230721 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150090626.1 protein_id gnl|my_center|LOCUS_09580 1230897 1231862 gene locus_tag LOCUS_09590 1230897 1231862 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083209.1 protein_id gnl|my_center|LOCUS_09590 1231901 1233193 gene locus_tag LOCUS_09600 1231901 1233193 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_09600 1233372 1234871 gene locus_tag LOCUS_09610 1233372 1234871 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_09610 1234993 1236123 gene locus_tag LOCUS_09620 1234993 1236123 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 protein_id gnl|my_center|LOCUS_09620 1236191 1236622 gene locus_tag LOCUS_09630 1236191 1236622 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622221.1 protein_id gnl|my_center|LOCUS_09630 1236678 1237610 gene locus_tag LOCUS_09640 1236678 1237610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1237793 1238725 gene locus_tag LOCUS_09650 1237793 1238725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1239036 1240250 gene locus_tag LOCUS_09660 1239036 1240250 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037193.1 protein_id gnl|my_center|LOCUS_09660 1243087 1240517 gene locus_tag LOCUS_09670 1243087 1240517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1243811 1245298 gene locus_tag LOCUS_09680 1243811 1245298 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_09680 1246090 1246494 gene locus_tag LOCUS_09690 1246090 1246494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1246559 1246900 gene locus_tag LOCUS_09700 1246559 1246900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1247607 1247002 gene locus_tag LOCUS_09710 1247607 1247002 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_09710 1248033 1247617 gene locus_tag LOCUS_09720 1248033 1247617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1248532 1248140 gene locus_tag LOCUS_09730 1248532 1248140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1249322 1248630 gene locus_tag LOCUS_09740 1249322 1248630 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_09740 1250410 1249421 gene locus_tag LOCUS_09750 1250410 1249421 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_09750 1251244 1250522 gene locus_tag LOCUS_09760 1251244 1250522 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_09760 1251763 1251272 gene locus_tag LOCUS_09770 1251763 1251272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1252672 1251770 gene locus_tag LOCUS_09780 1252672 1251770 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_09780 1253197 1253006 gene locus_tag LOCUS_09790 1253197 1253006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1253481 1254572 gene locus_tag LOCUS_09800 1253481 1254572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1254594 1255805 gene locus_tag LOCUS_09810 1254594 1255805 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234465.1 protein_id gnl|my_center|LOCUS_09810 1256304 1257410 gene locus_tag LOCUS_09820 1256304 1257410 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_09820 1258274 1257621 gene locus_tag LOCUS_09830 1258274 1257621 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268743.1 protein_id gnl|my_center|LOCUS_09830 1259284 1258274 gene locus_tag LOCUS_09840 1259284 1258274 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_09840 1260044 1259271 gene locus_tag LOCUS_09850 1260044 1259271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1260542 1260114 gene locus_tag LOCUS_09860 gene mscL 1260542 1260114 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547170.1 protein_id gnl|my_center|LOCUS_09860 1262044 1261070 gene locus_tag LOCUS_09870 gene trpS 1262044 1261070 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_09870 1262872 1262258 gene locus_tag LOCUS_09880 1262872 1262258 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_09880 1264486 1263569 gene locus_tag LOCUS_09890 1264486 1263569 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_09890 1264884 1264507 gene locus_tag LOCUS_09900 1264884 1264507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1265901 1264969 gene locus_tag LOCUS_09910 1265901 1264969 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963218.1 protein_id gnl|my_center|LOCUS_09910 1267358 1266210 gene locus_tag LOCUS_09920 gene lysA 1267358 1266210 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_09920 1268682 1267351 gene locus_tag LOCUS_09930 1268682 1267351 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_09930 1269016 1269474 gene locus_tag LOCUS_09940 1269016 1269474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1270832 1269621 gene locus_tag LOCUS_09950 1270832 1269621 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_09950 1272096 1270819 gene locus_tag LOCUS_09960 gene bioA 1272096 1270819 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_09960 1272710 1272093 gene locus_tag LOCUS_09970 gene bioD 1272710 1272093 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_09970 1273833 1272715 gene locus_tag LOCUS_09980 1273833 1272715 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_09980 1274829 1273837 gene locus_tag LOCUS_09990 gene bioB 1274829 1273837 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_09990 1276788 1275481 gene locus_tag LOCUS_10000 gene murA 1276788 1275481 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964114.1 protein_id gnl|my_center|LOCUS_10000 1277726 1277043 gene locus_tag LOCUS_10010 1277726 1277043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1280082 1277854 gene locus_tag LOCUS_10020 1280082 1277854 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_10020 1280297 1280665 gene locus_tag LOCUS_10030 1280297 1280665 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791717.1 protein_id gnl|my_center|LOCUS_10030 1280742 1281125 gene locus_tag LOCUS_10040 1280742 1281125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1281219 1281434 gene locus_tag LOCUS_10050 1281219 1281434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1282055 1281519 gene locus_tag LOCUS_10060 1282055 1281519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1282430 1283809 gene locus_tag LOCUS_10070 1282430 1283809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1286478 1283872 gene locus_tag LOCUS_10080 1286478 1283872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1288498 1287077 gene locus_tag LOCUS_10090 1288498 1287077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1290020 1288770 gene locus_tag LOCUS_10100 1290020 1288770 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_10100 1290479 1291558 gene locus_tag LOCUS_10110 1290479 1291558 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404739.1 protein_id gnl|my_center|LOCUS_10110 1291737 1292222 gene locus_tag LOCUS_10120 1291737 1292222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1294672 1292501 gene locus_tag LOCUS_10130 1294672 1292501 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_10130 1295173 1294685 gene locus_tag LOCUS_10140 1295173 1294685 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257597.1 protein_id gnl|my_center|LOCUS_10140 1296320 1295559 gene locus_tag LOCUS_10150 1296320 1295559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1296981 1296697 gene locus_tag LOCUS_10160 1296981 1296697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1298419 1297019 gene locus_tag LOCUS_10170 1298419 1297019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1300491 1298716 gene locus_tag LOCUS_10180 1300491 1298716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1303259 1300503 gene locus_tag LOCUS_10190 1303259 1300503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1304726 1305703 gene locus_tag LOCUS_10200 1304726 1305703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1305708 1309223 gene locus_tag LOCUS_10210 1305708 1309223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1309225 1312587 gene locus_tag LOCUS_10220 1309225 1312587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1312605 1318307 gene locus_tag LOCUS_10230 1312605 1318307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1318309 1320177 gene locus_tag LOCUS_10240 1318309 1320177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1321754 1321053 gene locus_tag LOCUS_10250 1321754 1321053 CDS product SMUG2 DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 protein_id gnl|my_center|LOCUS_10250 1322036 1323379 gene locus_tag LOCUS_10260 1322036 1323379 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_10260 1323541 1324323 gene locus_tag LOCUS_10270 1323541 1324323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1324415 1325158 gene locus_tag LOCUS_10280 1324415 1325158 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038619.1 protein_id gnl|my_center|LOCUS_10280 1326092 1325163 gene locus_tag LOCUS_10290 gene uvsE 1326092 1325163 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 protein_id gnl|my_center|LOCUS_10290 1326439 1327140 gene locus_tag LOCUS_10300 1326439 1327140 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084101.1 protein_id gnl|my_center|LOCUS_10300 1327185 1327835 gene locus_tag LOCUS_10310 1327185 1327835 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764706.1 protein_id gnl|my_center|LOCUS_10310 1328945 1329613 gene locus_tag LOCUS_10320 1328945 1329613 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123567.1 protein_id gnl|my_center|LOCUS_10320 1329819 1332695 gene locus_tag LOCUS_10330 1329819 1332695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1333844 1332885 gene locus_tag LOCUS_10340 1333844 1332885 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396053.1 protein_id gnl|my_center|LOCUS_10340 1334419 1334207 gene locus_tag LOCUS_10350 1334419 1334207 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_10350 1334731 1335645 gene locus_tag LOCUS_10360 1334731 1335645 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921014.1 protein_id gnl|my_center|LOCUS_10360 1336167 1335898 gene locus_tag LOCUS_10370 1336167 1335898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1337021 1336311 gene locus_tag LOCUS_10380 1337021 1336311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1337510 1337148 gene locus_tag LOCUS_10390 1337510 1337148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1338100 1337726 gene locus_tag LOCUS_10400 1338100 1337726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1338655 1338188 gene locus_tag LOCUS_10410 1338655 1338188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1339333 1338785 gene locus_tag LOCUS_10420 1339333 1338785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1340535 1339519 gene locus_tag LOCUS_10430 1340535 1339519 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_10430 1340975 1340472 gene locus_tag LOCUS_10440 1340975 1340472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1341222 1341464 gene locus_tag LOCUS_10450 1341222 1341464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1343327 1341648 gene locus_tag LOCUS_10460 1343327 1341648 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336878.1 protein_id gnl|my_center|LOCUS_10460 1343862 1344791 gene locus_tag LOCUS_10470 1343862 1344791 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_10470 1345210 1346058 gene locus_tag LOCUS_10480 1345210 1346058 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228547.1 protein_id gnl|my_center|LOCUS_10480 1346543 1349956 gene locus_tag LOCUS_10490 1346543 1349956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1350302 1351513 gene locus_tag LOCUS_10500 1350302 1351513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1353871 1351697 gene locus_tag LOCUS_10510 1353871 1351697 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_10510 1355138 1354431 gene locus_tag LOCUS_10520 1355138 1354431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1355863 1355327 gene locus_tag LOCUS_10530 1355863 1355327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1356047 1356907 gene locus_tag LOCUS_10540 1356047 1356907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1357444 1358007 gene locus_tag LOCUS_10550 1357444 1358007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1359432 1358410 gene locus_tag LOCUS_10560 1359432 1358410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1359831 1361129 gene locus_tag LOCUS_10570 1359831 1361129 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107635.1 protein_id gnl|my_center|LOCUS_10570 1361511 1362191 gene locus_tag LOCUS_10580 1361511 1362191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1362235 1362576 gene locus_tag LOCUS_10590 1362235 1362576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1363103 1362684 gene locus_tag LOCUS_10600 1363103 1362684 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 protein_id gnl|my_center|LOCUS_10600 1363199 1363558 gene locus_tag LOCUS_10610 1363199 1363558 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476381.1 protein_id gnl|my_center|LOCUS_10610 1364499 1363873 gene locus_tag LOCUS_10620 1364499 1363873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1365209 1367089 gene locus_tag LOCUS_10630 1365209 1367089 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_10630 1368189 1367359 gene locus_tag LOCUS_10640 1368189 1367359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1368331 1368137 gene locus_tag LOCUS_10650 1368331 1368137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1368783 1368637 gene locus_tag LOCUS_10660 1368783 1368637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1368983 1370002 gene locus_tag LOCUS_10670 1368983 1370002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1370055 1374776 gene locus_tag LOCUS_10680 1370055 1374776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1374770 1381582 gene locus_tag LOCUS_10690 1374770 1381582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1382434 1383369 gene locus_tag LOCUS_10700 1382434 1383369 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_10700 1383717 1385186 gene locus_tag LOCUS_10710 1383717 1385186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1385948 1385565 gene locus_tag LOCUS_10720 1385948 1385565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1386875 1386054 gene locus_tag LOCUS_10730 1386875 1386054 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975928.1 protein_id gnl|my_center|LOCUS_10730 1388816 1387935 gene locus_tag LOCUS_10740 1388816 1387935 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_10740 1388965 1390989 gene locus_tag LOCUS_10750 1388965 1390989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10750 1391104 1392207 gene locus_tag LOCUS_10760 1391104 1392207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10760 1392213 1393730 gene locus_tag LOCUS_10770 1392213 1393730 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_10770 1394166 1393840 gene locus_tag LOCUS_10780 1394166 1393840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1394050 1394736 gene locus_tag LOCUS_10790 1394050 1394736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10790 1395596 1396246 gene locus_tag LOCUS_10800 1395596 1396246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 1396339 1397238 gene locus_tag LOCUS_10810 1396339 1397238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 1397301 1398629 gene locus_tag LOCUS_10820 1397301 1398629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10820 1398644 1400353 gene locus_tag LOCUS_10830 1398644 1400353 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_10830 1400518 1401321 gene locus_tag LOCUS_10840 1400518 1401321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10840 1401390 1402988 gene locus_tag LOCUS_10850 1401390 1402988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10850 1403124 1403774 gene locus_tag LOCUS_10860 1403124 1403774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10860 1403717 1404034 gene locus_tag LOCUS_10870 1403717 1404034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10870 1404049 1404858 gene locus_tag LOCUS_10880 1404049 1404858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10880 1405211 1406101 gene locus_tag LOCUS_10890 1405211 1406101 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_10890 1406377 1407276 gene locus_tag LOCUS_10900 1406377 1407276 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 1408478 1407936 gene locus_tag LOCUS_10910 1408478 1407936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1409674 1408610 gene locus_tag LOCUS_10920 1409674 1408610 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_10920 1411501 1409927 gene locus_tag LOCUS_10930 1411501 1409927 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_10930 1414086 1411573 gene locus_tag LOCUS_10940 1414086 1411573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1415829 1414702 gene locus_tag LOCUS_10950 1415829 1414702 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_10950 1416452 1417231 gene locus_tag LOCUS_10960 1416452 1417231 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_10960 1418209 1417289 gene locus_tag LOCUS_10970 1418209 1417289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1420524 1418179 gene locus_tag LOCUS_10980 1420524 1418179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10980 1422708 1421545 gene locus_tag LOCUS_10990 1422708 1421545 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_10990 1423778 1422714 gene locus_tag LOCUS_11000 1423778 1422714 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_11000 1425387 1424164 gene locus_tag LOCUS_11010 1425387 1424164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_11010 1426421 1425402 gene locus_tag LOCUS_11020 1426421 1425402 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_11020 1428258 1426651 gene locus_tag LOCUS_11030 1428258 1426651 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_11030 1431439 1428335 gene locus_tag LOCUS_11040 1431439 1428335 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_11040 1433591 1432269 gene locus_tag LOCUS_11050 1433591 1432269 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973088.1 protein_id gnl|my_center|LOCUS_11050 1435137 1433854 gene locus_tag LOCUS_11060 gene rhaI 1435137 1433854 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327306.1 protein_id gnl|my_center|LOCUS_11060 1437930 1435804 gene locus_tag LOCUS_11070 1437930 1435804 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_11070 1439254 1438184 gene locus_tag LOCUS_11080 gene rhaT 1439254 1438184 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_11080 1439778 1440341 gene locus_tag LOCUS_11090 1439778 1440341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1441432 1440359 gene locus_tag LOCUS_11100 1441432 1440359 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474082.1 protein_id gnl|my_center|LOCUS_11100 1441962 1445297 gene locus_tag LOCUS_11110 1441962 1445297 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_11110 1445330 1446922 gene locus_tag LOCUS_11120 1445330 1446922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1449526 1447934 gene locus_tag LOCUS_11130 1449526 1447934 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_11130 1452191 1449531 gene locus_tag LOCUS_11140 1452191 1449531 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714627.1 protein_id gnl|my_center|LOCUS_11140 1452604 1452227 gene locus_tag LOCUS_11150 1452604 1452227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11150 1453545 1454984 gene locus_tag LOCUS_11160 1453545 1454984 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_11160 1455088 1455969 gene locus_tag LOCUS_11170 1455088 1455969 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548276.1 protein_id gnl|my_center|LOCUS_11170 1455995 1457113 gene locus_tag LOCUS_11180 1455995 1457113 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_11180 1457507 1458511 gene locus_tag LOCUS_11190 1457507 1458511 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_11190 1459023 1459445 gene locus_tag LOCUS_11200 1459023 1459445 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_11200 1460341 1459442 gene locus_tag LOCUS_11210 1460341 1459442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_11210 1461291 1460506 gene locus_tag LOCUS_11220 1461291 1460506 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_11220 1462286 1461288 gene locus_tag LOCUS_11230 1462286 1461288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1462876 1462415 gene locus_tag LOCUS_11240 1462876 1462415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1464348 1463248 gene locus_tag LOCUS_11250 1464348 1463248 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_11250 1465310 1464486 gene locus_tag LOCUS_11260 gene menB 1465310 1464486 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_11260 1466112 1465597 gene locus_tag LOCUS_11270 1466112 1465597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1466594 1466157 gene locus_tag LOCUS_11280 1466594 1466157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1468369 1466675 gene locus_tag LOCUS_11290 gene menD 1468369 1466675 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_11290 1469619 1468366 gene locus_tag LOCUS_11300 1469619 1468366 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_11300 1470242 1469817 gene locus_tag LOCUS_11310 1470242 1469817 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_11310 1470241 1470927 gene locus_tag LOCUS_11320 1470241 1470927 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_11320 1471170 1472939 gene locus_tag LOCUS_11330 1471170 1472939 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_11330 1473107 1473661 gene locus_tag LOCUS_11340 1473107 1473661 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396586.1 protein_id gnl|my_center|LOCUS_11340 1474333 1473827 gene locus_tag LOCUS_11350 1474333 1473827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1474727 1475275 gene locus_tag LOCUS_11360 gene hslV 1474727 1475275 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_11360 1475402 1476373 gene locus_tag LOCUS_11370 1475402 1476373 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_11370 1476486 1477787 gene locus_tag LOCUS_11380 1476486 1477787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1478095 1479315 gene locus_tag LOCUS_11390 1478095 1479315 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953461.1 protein_id gnl|my_center|LOCUS_11390 1479701 1480984 gene locus_tag LOCUS_11400 1479701 1480984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1481745 1481194 gene locus_tag LOCUS_11410 1481745 1481194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1482021 1483970 gene locus_tag LOCUS_11420 1482021 1483970 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405513.1 protein_id gnl|my_center|LOCUS_11420 1484023 1485375 gene locus_tag LOCUS_11430 1484023 1485375 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_11430 1485492 1487156 gene locus_tag LOCUS_11440 1485492 1487156 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_11440 1487693 1487298 gene locus_tag LOCUS_11450 1487693 1487298 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483188.1 protein_id gnl|my_center|LOCUS_11450 1488019 1489725 gene locus_tag LOCUS_11460 1488019 1489725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1491030 1489933 gene locus_tag LOCUS_11470 gene ychF 1491030 1489933 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_11470 1491709 1491272 gene locus_tag LOCUS_11480 1491709 1491272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1492267 1491941 gene locus_tag LOCUS_11490 1492267 1491941 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_11490 1492485 1493402 gene locus_tag LOCUS_11500 1492485 1493402 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_11500 1494224 1493643 gene locus_tag LOCUS_11510 1494224 1493643 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_11510 1495508 1494483 gene locus_tag LOCUS_11520 1495508 1494483 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_11520 1495681 1495920 gene locus_tag LOCUS_11530 1495681 1495920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1496542 1496033 gene locus_tag LOCUS_11540 1496542 1496033 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_11540 1497352 1496705 gene locus_tag LOCUS_11550 gene pyrE 1497352 1496705 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_11550 1497465 1498145 gene locus_tag LOCUS_11560 1497465 1498145 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_11560 1498578 1498126 gene locus_tag LOCUS_11570 gene coaD 1498578 1498126 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_11570 1499628 1498741 gene locus_tag LOCUS_11580 1499628 1498741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1500194 1499706 gene locus_tag LOCUS_11590 1500194 1499706 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432565.1 protein_id gnl|my_center|LOCUS_11590 1500193 1500408 gene locus_tag LOCUS_11600 1500193 1500408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1500485 1501891 gene locus_tag LOCUS_11610 1500485 1501891 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_11610 1501972 1502427 gene locus_tag LOCUS_11620 1501972 1502427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1502933 1502544 gene locus_tag LOCUS_11630 1502933 1502544 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 protein_id gnl|my_center|LOCUS_11630 1503616 1502948 gene locus_tag LOCUS_11640 1503616 1502948 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_11640 1504842 1503790 gene locus_tag LOCUS_11650 1504842 1503790 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_11650 1505746 1504826 gene locus_tag LOCUS_11660 1505746 1504826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1506617 1505739 gene locus_tag LOCUS_11670 1506617 1505739 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_11670 1506755 1507033 gene locus_tag LOCUS_11680 1506755 1507033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1507543 1507208 gene locus_tag LOCUS_11690 1507543 1507208 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969865.1 protein_id gnl|my_center|LOCUS_11690 1507679 1509238 gene locus_tag LOCUS_11700 1507679 1509238 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254970.1 protein_id gnl|my_center|LOCUS_11700 1509922 1509326 gene locus_tag LOCUS_11710 1509922 1509326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1511412 1510066 gene locus_tag LOCUS_11720 1511412 1510066 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_11720 1512597 1511488 gene locus_tag LOCUS_11730 1512597 1511488 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_11730 1513602 1512613 gene locus_tag LOCUS_11740 gene egtD 1513602 1512613 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_11740 1514759 1513605 gene locus_tag LOCUS_11750 gene egtB 1514759 1513605 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_11750 1515028 1516107 gene locus_tag LOCUS_11760 1515028 1516107 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202359.1 protein_id gnl|my_center|LOCUS_11760 1517001 1516291 gene locus_tag LOCUS_11770 1517001 1516291 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_11770 1519543 1517105 gene locus_tag LOCUS_11780 gene topA 1519543 1517105 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_11780 1519709 1520203 gene locus_tag LOCUS_11790 1519709 1520203 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 protein_id gnl|my_center|LOCUS_11790 1520331 1521077 gene locus_tag LOCUS_11800 1520331 1521077 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_11800 1521263 1526464 gene locus_tag LOCUS_11810 1521263 1526464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1526467 1526979 gene locus_tag LOCUS_11820 gene cheW 1526467 1526979 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816618.1 protein_id gnl|my_center|LOCUS_11820 1526989 1527408 gene locus_tag LOCUS_11830 1526989 1527408 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_11830 1527681 1529315 gene locus_tag LOCUS_11840 1527681 1529315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1529364 1529990 gene locus_tag LOCUS_11850 1529364 1529990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1530139 1531233 gene locus_tag LOCUS_11860 1530139 1531233 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_11860 1531374 1531712 gene locus_tag LOCUS_11870 1531374 1531712 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_11870 1532103 1531762 gene locus_tag LOCUS_11880 1532103 1531762 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_11880 1532288 1534420 gene locus_tag LOCUS_11890 gene recQ 1532288 1534420 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_11890 1534578 1535402 gene locus_tag LOCUS_11900 1534578 1535402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1535578 1536294 gene locus_tag LOCUS_11910 1535578 1536294 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174799.1 protein_id gnl|my_center|LOCUS_11910 1538224 1536437 gene locus_tag LOCUS_11920 1538224 1536437 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_11920 1539158 1538277 gene locus_tag LOCUS_11930 1539158 1538277 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_11930 1540913 1539561 gene locus_tag LOCUS_11940 1540913 1539561 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_11940 1541960 1541550 gene locus_tag LOCUS_11950 1541960 1541550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1542431 1542751 gene locus_tag LOCUS_11960 1542431 1542751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1545735 1542844 gene locus_tag LOCUS_11970 1545735 1542844 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_11970 1546059 1546805 gene locus_tag LOCUS_11980 1546059 1546805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1546906 1547682 gene locus_tag LOCUS_11990 1546906 1547682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1548715 1547684 gene locus_tag LOCUS_12000 1548715 1547684 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101519.1 protein_id gnl|my_center|LOCUS_12000 1548975 1550015 gene locus_tag LOCUS_12010 1548975 1550015 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192663.1 protein_id gnl|my_center|LOCUS_12010 1552313 1550154 gene locus_tag LOCUS_12020 1552313 1550154 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018575409.1 protein_id gnl|my_center|LOCUS_12020 1555765 1552397 gene locus_tag LOCUS_12030 1555765 1552397 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_12030 1557158 1556112 gene locus_tag LOCUS_12040 1557158 1556112 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969690.1 protein_id gnl|my_center|LOCUS_12040 1557821 1558261 gene locus_tag LOCUS_12050 1557821 1558261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1559803 1558394 gene locus_tag LOCUS_12060 1559803 1558394 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_12060 1560818 1559817 gene locus_tag LOCUS_12070 1560818 1559817 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_12070 1562498 1561041 gene locus_tag LOCUS_12080 1562498 1561041 CDS product beta-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296814.1 protein_id gnl|my_center|LOCUS_12080 1564825 1563065 gene locus_tag LOCUS_12090 1564825 1563065 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_12090 1568017 1564847 gene locus_tag LOCUS_12100 1568017 1564847 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_12100 1568357 1569448 gene locus_tag LOCUS_12110 1568357 1569448 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906005.1 protein_id gnl|my_center|LOCUS_12110 1569627 1569445 gene locus_tag LOCUS_12120 1569627 1569445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1569753 1570721 gene locus_tag LOCUS_12130 1569753 1570721 CDS product IS5-like element ISSod12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074424.1 protein_id gnl|my_center|LOCUS_12130 1571189 1570794 gene locus_tag LOCUS_12140 1571189 1570794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1571712 1574168 gene locus_tag LOCUS_12150 1571712 1574168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767692.1 protein_id gnl|my_center|LOCUS_12150 1577554 1575029 gene locus_tag LOCUS_12160 1577554 1575029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1577881 1579368 gene locus_tag LOCUS_12170 1577881 1579368 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046312529.1 protein_id gnl|my_center|LOCUS_12170 1580821 1581840 gene locus_tag LOCUS_12180 1580821 1581840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_12180 1581869 1582444 gene locus_tag LOCUS_12190 1581869 1582444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1583018 1583632 gene locus_tag LOCUS_12200 1583018 1583632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1583643 1585016 gene locus_tag LOCUS_12210 1583643 1585016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1585093 1589643 gene locus_tag LOCUS_12220 1585093 1589643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1589679 1590161 gene locus_tag LOCUS_12230 1589679 1590161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1590116 1590283 gene locus_tag LOCUS_12240 1590116 1590283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1590346 1591038 gene locus_tag LOCUS_12250 1590346 1591038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1591061 1592416 gene locus_tag LOCUS_12260 1591061 1592416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1593219 1594829 gene locus_tag LOCUS_12270 1593219 1594829 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 protein_id gnl|my_center|LOCUS_12270 1594856 1595287 gene locus_tag LOCUS_12280 1594856 1595287 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_12280 1595383 1595823 gene locus_tag LOCUS_12290 1595383 1595823 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_12290 1596524 1597240 gene locus_tag LOCUS_12300 1596524 1597240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1597233 1598999 gene locus_tag LOCUS_12310 1597233 1598999 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_12310 1599493 1599783 gene locus_tag LOCUS_12320 1599493 1599783 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_12320 1599787 1600203 gene locus_tag LOCUS_12330 1599787 1600203 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_12330 1600377 1604732 gene locus_tag LOCUS_12340 1600377 1604732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1604971 1608363 gene locus_tag LOCUS_12350 1604971 1608363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1608371 1611166 gene locus_tag LOCUS_12360 1608371 1611166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1611359 1612333 gene locus_tag LOCUS_12370 1611359 1612333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1612890 1614098 gene locus_tag LOCUS_12380 1612890 1614098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1614233 1616734 gene locus_tag LOCUS_12390 1614233 1616734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1618433 1618942 gene locus_tag LOCUS_12400 1618433 1618942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1618893 1619765 gene locus_tag LOCUS_12410 1618893 1619765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12410 1620301 1619915 gene locus_tag LOCUS_12420 1620301 1619915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1620587 1621171 gene locus_tag LOCUS_12430 1620587 1621171 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704887.1 protein_id gnl|my_center|LOCUS_12430 1621247 1621684 gene locus_tag LOCUS_12440 1621247 1621684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1621668 1622231 gene locus_tag LOCUS_12450 1621668 1622231 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_12450 1623347 1622478 gene locus_tag LOCUS_12460 1623347 1622478 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706778.1 protein_id gnl|my_center|LOCUS_12460 1625271 1623631 gene locus_tag LOCUS_12470 1625271 1623631 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_12470 1625706 1626929 gene locus_tag LOCUS_12480 1625706 1626929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1626926 1627528 gene locus_tag LOCUS_12490 1626926 1627528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1627626 1629512 gene locus_tag LOCUS_12500 1627626 1629512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1629646 1630689 gene locus_tag LOCUS_12510 1629646 1630689 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_12510 1630888 1631763 gene locus_tag LOCUS_12520 1630888 1631763 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_12520 1634598 1631917 gene locus_tag LOCUS_12530 1634598 1631917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_12530 1634933 1634595 gene locus_tag LOCUS_12540 1634933 1634595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1635223 1636371 gene locus_tag LOCUS_12550 1635223 1636371 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462089.1 protein_id gnl|my_center|LOCUS_12550 1636560 1638134 gene locus_tag LOCUS_12560 1636560 1638134 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704599.1 protein_id gnl|my_center|LOCUS_12560 1638588 1638187 gene locus_tag LOCUS_12570 1638588 1638187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1640126 1639692 gene locus_tag LOCUS_12580 1640126 1639692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1640587 1640817 gene locus_tag LOCUS_12590 1640587 1640817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1641822 1640914 gene locus_tag LOCUS_12600 1641822 1640914 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_12600 1643368 1642133 gene locus_tag LOCUS_12610 1643368 1642133 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_12610 1645607 1643655 gene locus_tag LOCUS_12620 1645607 1643655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1646075 1647280 gene locus_tag LOCUS_12630 1646075 1647280 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_12630 1647619 1647945 gene locus_tag LOCUS_12640 1647619 1647945 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_12640 1648472 1648257 gene locus_tag LOCUS_12650 1648472 1648257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1649042 1649662 gene locus_tag LOCUS_12660 1649042 1649662 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_12660 1649619 1650611 gene locus_tag LOCUS_12670 1649619 1650611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1651693 1650719 gene locus_tag LOCUS_12680 1651693 1650719 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_12680 1656199 1651976 gene locus_tag LOCUS_12690 1656199 1651976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1658298 1656460 gene locus_tag LOCUS_12700 gene treZ 1658298 1656460 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_12700 1660609 1658465 gene locus_tag LOCUS_12710 gene glgX 1660609 1658465 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_12710 1661245 1664283 gene locus_tag LOCUS_12720 1661245 1664283 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_12720 1664566 1665855 gene locus_tag LOCUS_12730 1664566 1665855 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_12730 1666803 1665922 gene locus_tag LOCUS_12740 gene rfbA 1666803 1665922 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_12740 1668027 1667023 gene locus_tag LOCUS_12750 1668027 1667023 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_12750 1668659 1668108 gene locus_tag LOCUS_12760 1668659 1668108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1669755 1668709 gene locus_tag LOCUS_12770 gene rfbB 1669755 1668709 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932000.1 protein_id gnl|my_center|LOCUS_12770 1670879 1669839 gene locus_tag LOCUS_12780 gene galE 1670879 1669839 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_12780 1672545 1671256 gene locus_tag LOCUS_12790 1672545 1671256 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_12790 1673138 1672554 gene locus_tag LOCUS_12800 1673138 1672554 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_12800 1674205 1673276 gene locus_tag LOCUS_12810 gene prmC 1674205 1673276 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_12810 1674282 1675319 gene locus_tag LOCUS_12820 gene ribD 1674282 1675319 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_12820 1675441 1675923 gene locus_tag LOCUS_12830 1675441 1675923 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_12830 1676377 1676009 gene locus_tag LOCUS_12840 1676377 1676009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1677142 1676462 gene locus_tag LOCUS_12850 1677142 1676462 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_12850 1678303 1677467 gene locus_tag LOCUS_12860 1678303 1677467 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_12860 1679724 1678558 gene locus_tag LOCUS_12870 1679724 1678558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1679615 1680553 gene locus_tag LOCUS_12880 gene dusB 1679615 1680553 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_12880 1681171 1681938 gene locus_tag LOCUS_12890 1681171 1681938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1682154 1684820 gene locus_tag LOCUS_12900 1682154 1684820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1685537 1688881 gene locus_tag LOCUS_12910 1685537 1688881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1689280 1689035 gene locus_tag LOCUS_12920 1689280 1689035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1689580 1689284 gene locus_tag LOCUS_12930 1689580 1689284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1690176 1689649 gene locus_tag LOCUS_12940 1690176 1689649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1690293 1690484 gene locus_tag LOCUS_12950 1690293 1690484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1691172 1691462 gene locus_tag LOCUS_12960 1691172 1691462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1691967 1692176 gene locus_tag LOCUS_12970 1691967 1692176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1693066 1694187 gene locus_tag LOCUS_12980 1693066 1694187 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_12980 1694406 1695149 gene locus_tag LOCUS_12990 gene bla2 1694406 1695149 CDS product BcII family subclass B1 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799227.1 protein_id gnl|my_center|LOCUS_12990 1695353 1696354 gene locus_tag LOCUS_13000 1695353 1696354 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_13000 1696418 1697338 gene locus_tag LOCUS_13010 1696418 1697338 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_13010 1697881 1697543 gene locus_tag LOCUS_13020 1697881 1697543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1698399 1699415 gene locus_tag LOCUS_13030 1698399 1699415 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_13030 1699624 1700658 gene locus_tag LOCUS_13040 1699624 1700658 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965860.1 protein_id gnl|my_center|LOCUS_13040 1704018 1701199 gene locus_tag LOCUS_13050 1704018 1701199 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_13050 1704423 1704112 gene locus_tag LOCUS_13060 gene rhaM 1704423 1704112 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_13060 1705100 1707835 gene locus_tag LOCUS_13070 1705100 1707835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1708475 1710235 gene locus_tag LOCUS_13080 1708475 1710235 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_13080 1710689 1711609 gene locus_tag LOCUS_13090 1710689 1711609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1715935 1712528 gene locus_tag LOCUS_13100 1715935 1712528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1716937 1719636 gene locus_tag LOCUS_13110 1716937 1719636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1719882 1721378 gene locus_tag LOCUS_13120 1719882 1721378 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_13120 1721598 1722128 gene locus_tag LOCUS_13130 1721598 1722128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1722451 1723107 gene locus_tag LOCUS_13140 1722451 1723107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1723191 1723397 gene locus_tag LOCUS_13150 1723191 1723397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1723419 1723769 gene locus_tag LOCUS_13160 1723419 1723769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13160 1723906 1724340 gene locus_tag LOCUS_13170 1723906 1724340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1725224 1724427 gene locus_tag LOCUS_13180 1725224 1724427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1725961 1725377 gene locus_tag LOCUS_13190 1725961 1725377 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964094.1 protein_id gnl|my_center|LOCUS_13190 1726432 1726830 gene locus_tag LOCUS_13200 1726432 1726830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1726938 1727513 gene locus_tag LOCUS_13210 1726938 1727513 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795589.1 protein_id gnl|my_center|LOCUS_13210 1727583 1728020 gene locus_tag LOCUS_13220 1727583 1728020 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229298.1 protein_id gnl|my_center|LOCUS_13220 1728795 1728172 gene locus_tag LOCUS_13230 1728795 1728172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1730192 1728903 gene locus_tag LOCUS_13240 1730192 1728903 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185271872.1 protein_id gnl|my_center|LOCUS_13240 1732482 1730479 gene locus_tag LOCUS_13250 1732482 1730479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1734540 1732855 gene locus_tag LOCUS_13260 1734540 1732855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1735820 1735239 gene locus_tag LOCUS_13270 1735820 1735239 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_13270 1737897 1736416 gene locus_tag LOCUS_13280 1737897 1736416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1739470 1738289 gene locus_tag LOCUS_13290 1739470 1738289 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_13290 1740561 1740100 gene locus_tag LOCUS_13300 1740561 1740100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1742351 1740822 gene locus_tag LOCUS_13310 1742351 1740822 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_13310 1745704 1742366 gene locus_tag LOCUS_13320 1745704 1742366 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_13320 1747210 1745990 gene locus_tag LOCUS_13330 1747210 1745990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1747563 1747363 gene locus_tag LOCUS_13340 1747563 1747363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1747520 1748401 gene locus_tag LOCUS_13350 1747520 1748401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1748604 1749299 gene locus_tag LOCUS_13360 1748604 1749299 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_13360 1751053 1750445 gene locus_tag LOCUS_13370 1751053 1750445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1751490 1751059 gene locus_tag LOCUS_13380 1751490 1751059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1751530 1752438 gene locus_tag LOCUS_13390 1751530 1752438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1752530 1752994 gene locus_tag LOCUS_13400 1752530 1752994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1753053 1753601 gene locus_tag LOCUS_13410 1753053 1753601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1753712 1754026 gene locus_tag LOCUS_13420 1753712 1754026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1754159 1754488 gene locus_tag LOCUS_13430 1754159 1754488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1756826 1754610 gene locus_tag LOCUS_13440 1756826 1754610 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105101.1 protein_id gnl|my_center|LOCUS_13440 1757818 1756823 gene locus_tag LOCUS_13450 1757818 1756823 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_13450 1758354 1757815 gene locus_tag LOCUS_13460 1758354 1757815 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036293.1 protein_id gnl|my_center|LOCUS_13460 1759839 1758937 gene locus_tag LOCUS_13470 1759839 1758937 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763930.1 protein_id gnl|my_center|LOCUS_13470 1760211 1761596 gene locus_tag LOCUS_13480 1760211 1761596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1761663 1762061 gene locus_tag LOCUS_13490 1761663 1762061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1763487 1762642 gene locus_tag LOCUS_13500 1763487 1762642 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225189.1 protein_id gnl|my_center|LOCUS_13500 1763940 1764431 gene locus_tag LOCUS_13510 1763940 1764431 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_13510 1764444 1765307 gene locus_tag LOCUS_13520 1764444 1765307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1765357 1766253 gene locus_tag LOCUS_13530 1765357 1766253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1766438 1767127 gene locus_tag LOCUS_13540 1766438 1767127 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932742.1 protein_id gnl|my_center|LOCUS_13540 1767369 1767133 gene locus_tag LOCUS_13550 1767369 1767133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1768466 1767378 gene locus_tag LOCUS_13560 1768466 1767378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13560 1769950 1768472 gene locus_tag LOCUS_13570 1769950 1768472 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_13570 1770646 1769954 gene locus_tag LOCUS_13580 1770646 1769954 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_13580 1770742 1771248 gene locus_tag LOCUS_13590 1770742 1771248 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_13590 1771513 1772487 gene locus_tag LOCUS_13600 1771513 1772487 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 protein_id gnl|my_center|LOCUS_13600 1773499 1772489 gene locus_tag LOCUS_13610 1773499 1772489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1773837 1773538 gene locus_tag LOCUS_13620 1773837 1773538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1774089 1773859 gene locus_tag LOCUS_13630 1774089 1773859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1774683 1774381 gene locus_tag LOCUS_13640 1774683 1774381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1775589 1775840 gene locus_tag LOCUS_13650 1775589 1775840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1776079 1778118 gene locus_tag LOCUS_13660 1776079 1778118 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_13660 1778666 1778250 gene locus_tag LOCUS_13670 1778666 1778250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1779925 1778864 gene locus_tag LOCUS_13680 1779925 1778864 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266300.1 protein_id gnl|my_center|LOCUS_13680 1780334 1780582 gene locus_tag LOCUS_13690 1780334 1780582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1784781 1780660 gene locus_tag LOCUS_13700 1784781 1780660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1786687 1785149 gene locus_tag LOCUS_13710 1786687 1785149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1787377 1786787 gene locus_tag LOCUS_13720 1787377 1786787 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177622.1 protein_id gnl|my_center|LOCUS_13720 1789750 1787966 gene locus_tag LOCUS_13730 1789750 1787966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975439.1 protein_id gnl|my_center|LOCUS_13730 1791084 1790056 gene locus_tag LOCUS_13740 1791084 1790056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1792070 1791117 gene locus_tag LOCUS_13750 1792070 1791117 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210221.1 protein_id gnl|my_center|LOCUS_13750 1793773 1792301 gene locus_tag LOCUS_13760 1793773 1792301 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612398.1 protein_id gnl|my_center|LOCUS_13760 1794803 1793778 gene locus_tag LOCUS_13770 1794803 1793778 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398939.1 protein_id gnl|my_center|LOCUS_13770 1794978 1795985 gene locus_tag LOCUS_13780 1794978 1795985 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_13780 1796087 1796899 gene locus_tag LOCUS_13790 1796087 1796899 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969400.1 protein_id gnl|my_center|LOCUS_13790 1797011 1797844 gene locus_tag LOCUS_13800 1797011 1797844 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398949.1 protein_id gnl|my_center|LOCUS_13800 1798254 1799156 gene locus_tag LOCUS_13810 1798254 1799156 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227725.1 protein_id gnl|my_center|LOCUS_13810 1801072 1800173 gene locus_tag LOCUS_13820 1801072 1800173 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747210.1 protein_id gnl|my_center|LOCUS_13820 1802356 1801097 gene locus_tag LOCUS_13830 1802356 1801097 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_13830 1803358 1802732 gene locus_tag LOCUS_13840 1803358 1802732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1803930 1804697 gene locus_tag LOCUS_13850 1803930 1804697 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_13850 1804930 1806948 gene locus_tag LOCUS_13860 gene tkt 1804930 1806948 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_13860 1806953 1807414 gene locus_tag LOCUS_13870 1806953 1807414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1807411 1808538 gene locus_tag LOCUS_13880 1807411 1808538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1808538 1809155 gene locus_tag LOCUS_13890 1808538 1809155 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_13890 1809275 1810690 gene locus_tag LOCUS_13900 gene gndA 1809275 1810690 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_13900 1810883 1812424 gene locus_tag LOCUS_13910 gene zwf 1810883 1812424 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_13910 1812421 1813158 gene locus_tag LOCUS_13920 gene pgl 1812421 1813158 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_13920 1813403 1813864 gene locus_tag LOCUS_13930 1813403 1813864 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_13930 1813867 1816008 gene locus_tag LOCUS_13940 1813867 1816008 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_13940 1816470 1817552 gene locus_tag LOCUS_13950 gene splB 1816470 1817552 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393427.1 protein_id gnl|my_center|LOCUS_13950 1817666 1817857 gene locus_tag LOCUS_13960 1817666 1817857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1818276 1818100 gene locus_tag LOCUS_13970 1818276 1818100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1818650 1819333 gene locus_tag LOCUS_13980 1818650 1819333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13980 1819337 1819681 gene locus_tag LOCUS_13990 1819337 1819681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1820119 1819742 gene locus_tag LOCUS_14000 1820119 1819742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1820523 1820221 gene locus_tag LOCUS_14010 1820523 1820221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1820969 1821271 gene locus_tag LOCUS_14020 gene ureA 1820969 1821271 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186513.1 protein_id gnl|my_center|LOCUS_14020 1821290 1821664 gene locus_tag LOCUS_14030 1821290 1821664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14030 1821661 1823382 gene locus_tag LOCUS_14040 gene ureC 1821661 1823382 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694142.1 protein_id gnl|my_center|LOCUS_14040 1823438 1823953 gene locus_tag LOCUS_14050 gene ureE 1823438 1823953 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688622.1 protein_id gnl|my_center|LOCUS_14050 1823959 1824651 gene locus_tag LOCUS_14060 1823959 1824651 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694141.1 protein_id gnl|my_center|LOCUS_14060 1824685 1825326 gene locus_tag LOCUS_14070 gene ureG 1824685 1825326 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664465.1 protein_id gnl|my_center|LOCUS_14070 1825328 1826140 gene locus_tag LOCUS_14080 1825328 1826140 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995202.1 protein_id gnl|my_center|LOCUS_14080 1826147 1826854 gene locus_tag LOCUS_14090 1826147 1826854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1826958 1827338 gene locus_tag LOCUS_14100 1826958 1827338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1827441 1828253 gene locus_tag LOCUS_14110 1827441 1828253 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267088.1 protein_id gnl|my_center|LOCUS_14110 1828522 1829223 gene locus_tag LOCUS_14120 gene tsaB 1828522 1829223 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_14120 1829220 1829729 gene locus_tag LOCUS_14130 1829220 1829729 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_14130 1830464 1831981 gene locus_tag LOCUS_r00040 1830464 1831981 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1832192 1832266 gene locus_tag LOCUS_t00130 1832192 1832266 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1832279 1832353 gene locus_tag LOCUS_t00140 1832279 1832353 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1832572 1835455 gene locus_tag LOCUS_r00050 1832572 1835455 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1835619 1835725 gene locus_tag LOCUS_r00060 1835619 1835725 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1836631 1835981 gene locus_tag LOCUS_14140 1836631 1835981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_14140 1837434 1836643 gene locus_tag LOCUS_14150 1837434 1836643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1838661 1838227 gene locus_tag LOCUS_14160 1838661 1838227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1839014 1839751 gene locus_tag LOCUS_14170 1839014 1839751 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765472.1 protein_id gnl|my_center|LOCUS_14170 1840655 1840005 gene locus_tag LOCUS_14180 1840655 1840005 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_14180 1841459 1840665 gene locus_tag LOCUS_14190 1841459 1840665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1841800 1841426 gene locus_tag LOCUS_14200 1841800 1841426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1842361 1842110 gene locus_tag LOCUS_14210 1842361 1842110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1843627 1844664 gene locus_tag LOCUS_14220 1843627 1844664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1844932 1845462 gene locus_tag LOCUS_14230 1844932 1845462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1845688 1846971 gene locus_tag LOCUS_14240 1845688 1846971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1847124 1847408 gene locus_tag LOCUS_14250 1847124 1847408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1847416 1847805 gene locus_tag LOCUS_14260 1847416 1847805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1847952 1848284 gene locus_tag LOCUS_14270 1847952 1848284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1848277 1849422 gene locus_tag LOCUS_14280 1848277 1849422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1849438 1850496 gene locus_tag LOCUS_14290 1849438 1850496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1850679 1852802 gene locus_tag LOCUS_14300 1850679 1852802 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921723.1 protein_id gnl|my_center|LOCUS_14300 1854927 1852969 gene locus_tag LOCUS_14310 gene dnaK 1854927 1852969 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963020.1 protein_id gnl|my_center|LOCUS_14310 1855847 1855272 gene locus_tag LOCUS_14320 1855847 1855272 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116956690.1 protein_id gnl|my_center|LOCUS_14320 1858694 1856076 gene locus_tag LOCUS_14330 gene clpB 1858694 1856076 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_14330 1860674 1859586 gene locus_tag LOCUS_14340 1860674 1859586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1861532 1860729 gene locus_tag LOCUS_14350 1861532 1860729 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_14350 1863032 1862355 gene locus_tag LOCUS_14360 gene nfi 1863032 1862355 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_14360 1863236 1863667 gene locus_tag LOCUS_14370 1863236 1863667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1863673 1864281 gene locus_tag LOCUS_14380 1863673 1864281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1864859 1866103 gene locus_tag LOCUS_14390 1864859 1866103 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 1866103 1866381 gene locus_tag LOCUS_14400 1866103 1866381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1866402 1867046 gene locus_tag LOCUS_14410 1866402 1867046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1867718 1867191 gene locus_tag LOCUS_14420 1867718 1867191 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_14420 1868244 1870469 gene locus_tag LOCUS_14430 1868244 1870469 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_14430 1871990 1870920 gene locus_tag LOCUS_14440 1871990 1870920 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_14440 1872968 1871997 gene locus_tag LOCUS_14450 1872968 1871997 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_14450 1873042 1875222 gene locus_tag LOCUS_14460 gene recQ 1873042 1875222 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_14460 1875571 1876863 gene locus_tag LOCUS_14470 gene purD 1875571 1876863 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_14470 1877508 1877086 gene locus_tag LOCUS_14480 1877508 1877086 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_14480 1878041 1879420 gene locus_tag LOCUS_14490 gene eat 1878041 1879420 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388785.1 protein_id gnl|my_center|LOCUS_14490 1879417 1880793 gene locus_tag LOCUS_14500 1879417 1880793 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_14500 1880916 1881689 gene locus_tag LOCUS_14510 gene eutC 1880916 1881689 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114907.1 protein_id gnl|my_center|LOCUS_14510 1882045 1881866 gene locus_tag LOCUS_14520 1882045 1881866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1883463 1882231 gene locus_tag LOCUS_14530 1883463 1882231 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_14530 1883779 1884492 gene locus_tag LOCUS_14540 1883779 1884492 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_14540 1884495 1885397 gene locus_tag LOCUS_14550 1884495 1885397 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_14550 1885646 1886056 gene locus_tag LOCUS_14560 1885646 1886056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1886311 1887018 gene locus_tag LOCUS_14570 1886311 1887018 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_14570 1887125 1888150 gene locus_tag LOCUS_14580 1887125 1888150 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921854.1 protein_id gnl|my_center|LOCUS_14580 1888154 1888957 gene locus_tag LOCUS_14590 1888154 1888957 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_14590 1889128 1890018 gene locus_tag LOCUS_14600 1889128 1890018 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_14600 1891169 1890048 gene locus_tag LOCUS_14610 1891169 1890048 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_14610 1891488 1892555 gene locus_tag LOCUS_14620 1891488 1892555 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 protein_id gnl|my_center|LOCUS_14620 1892705 1892938 gene locus_tag LOCUS_14630 1892705 1892938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1892919 1893242 gene locus_tag LOCUS_14640 1892919 1893242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1894322 1893399 gene locus_tag LOCUS_14650 1894322 1893399 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763945.1 protein_id gnl|my_center|LOCUS_14650 1895860 1894445 gene locus_tag LOCUS_14660 1895860 1894445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1899436 1896470 gene locus_tag LOCUS_14670 1899436 1896470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1899671 1900834 gene locus_tag LOCUS_14680 1899671 1900834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_14680 1901282 1902937 gene locus_tag LOCUS_14690 1901282 1902937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1904290 1903067 gene locus_tag LOCUS_14700 gene argH 1904290 1903067 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_14700 1905572 1904505 gene locus_tag LOCUS_14710 1905572 1904505 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_14710 1906442 1905615 gene locus_tag LOCUS_14720 gene proC 1906442 1905615 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_14720 1907362 1906571 gene locus_tag LOCUS_14730 gene argB 1907362 1906571 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_14730 1908135 1907371 gene locus_tag LOCUS_14740 1908135 1907371 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14740 1908320 1908189 gene locus_tag LOCUS_14750 1908320 1908189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1909459 1908317 gene locus_tag LOCUS_14760 1909459 1908317 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_14760 1910552 1909566 gene locus_tag LOCUS_14770 gene argC 1910552 1909566 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_14770 1911813 1910554 gene locus_tag LOCUS_14780 1911813 1910554 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_14780 1912496 1911846 gene locus_tag LOCUS_14790 1912496 1911846 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_14790 1913103 1913954 gene locus_tag LOCUS_14800 1913103 1913954 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_14800 1914265 1914507 gene locus_tag LOCUS_14810 1914265 1914507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1914569 1917106 gene locus_tag LOCUS_14820 gene gyrA 1914569 1917106 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_14820 1917150 1918286 gene locus_tag LOCUS_14830 1917150 1918286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1918642 1919028 gene locus_tag LOCUS_14840 1918642 1919028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1919153 1920535 gene locus_tag LOCUS_14850 1919153 1920535 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_14850 1920547 1923789 gene locus_tag LOCUS_14860 1920547 1923789 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_14860 1923801 1924982 gene locus_tag LOCUS_14870 1923801 1924982 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14870 1924937 1925248 gene locus_tag LOCUS_14880 1924937 1925248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14880 1925691 1925284 gene locus_tag LOCUS_14890 1925691 1925284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1926374 1925889 gene locus_tag LOCUS_14900 1926374 1925889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1926440 1927027 gene locus_tag LOCUS_14910 1926440 1927027 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_14910 1927041 1929389 gene locus_tag LOCUS_14920 1927041 1929389 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_14920 1930161 1929847 gene locus_tag LOCUS_14930 1930161 1929847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14930 1930392 1930198 gene locus_tag LOCUS_14940 1930392 1930198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14940 1930856 1931908 gene locus_tag LOCUS_14950 1930856 1931908 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799038.1 protein_id gnl|my_center|LOCUS_14950 1931968 1932735 gene locus_tag LOCUS_14960 1931968 1932735 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_14960 1932728 1933432 gene locus_tag LOCUS_14970 1932728 1933432 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_14970 1933472 1935142 gene locus_tag LOCUS_14980 1933472 1935142 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661302.1 protein_id gnl|my_center|LOCUS_14980 1936022 1935129 gene locus_tag LOCUS_14990 1936022 1935129 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 protein_id gnl|my_center|LOCUS_14990 1936414 1936115 gene locus_tag LOCUS_15000 1936414 1936115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1938531 1936690 gene locus_tag LOCUS_15010 1938531 1936690 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117506598.1 protein_id gnl|my_center|LOCUS_15010 1939144 1940022 gene locus_tag LOCUS_15020 1939144 1940022 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_15020 1940636 1942222 gene locus_tag LOCUS_15030 1940636 1942222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1943632 1943216 gene locus_tag LOCUS_15040 1943632 1943216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15040 1944333 1943656 gene locus_tag LOCUS_15050 1944333 1943656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15050 1945832 1944684 gene locus_tag LOCUS_15060 1945832 1944684 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_15060 1947124 1946108 gene locus_tag LOCUS_15070 1947124 1946108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1947354 1948463 gene locus_tag LOCUS_15080 1947354 1948463 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_15080 1948467 1949048 gene locus_tag LOCUS_15090 1948467 1949048 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_15090 1949116 1950135 gene locus_tag LOCUS_15100 1949116 1950135 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_15100 1950601 1950425 gene locus_tag LOCUS_15110 1950601 1950425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1951537 1952256 gene locus_tag LOCUS_15120 1951537 1952256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1952261 1953478 gene locus_tag LOCUS_15130 1952261 1953478 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767224.1 protein_id gnl|my_center|LOCUS_15130 1953641 1954774 gene locus_tag LOCUS_15140 1953641 1954774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1954779 1955822 gene locus_tag LOCUS_15150 gene wecB 1954779 1955822 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_15150 1955839 1957758 gene locus_tag LOCUS_15160 1955839 1957758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1957909 1958553 gene locus_tag LOCUS_15170 1957909 1958553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1958460 1959245 gene locus_tag LOCUS_15180 1958460 1959245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 1959299 1960366 gene locus_tag LOCUS_15190 1959299 1960366 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_15190 1960921 1961253 gene locus_tag LOCUS_15200 1960921 1961253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1961807 1962889 gene locus_tag LOCUS_15210 1961807 1962889 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268293.1 protein_id gnl|my_center|LOCUS_15210 1962962 1963642 gene locus_tag LOCUS_15220 1962962 1963642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1963699 1964235 gene locus_tag LOCUS_15230 1963699 1964235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1964353 1965498 gene locus_tag LOCUS_15240 1964353 1965498 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_15240 1965563 1966945 gene locus_tag LOCUS_15250 1965563 1966945 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_15250 1968000 1967017 gene locus_tag LOCUS_15260 1968000 1967017 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_15260 1968578 1968796 gene locus_tag LOCUS_15270 1968578 1968796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1969923 1968880 gene locus_tag LOCUS_15280 1969923 1968880 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_15280 1970248 1969913 gene locus_tag LOCUS_15290 1970248 1969913 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720893.1 protein_id gnl|my_center|LOCUS_15290 1972271 1970499 gene locus_tag LOCUS_15300 1972271 1970499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1974626 1972665 gene locus_tag LOCUS_15310 1974626 1972665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1975752 1974604 gene locus_tag LOCUS_15320 1975752 1974604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1977136 1975754 gene locus_tag LOCUS_15330 gene hisS 1977136 1975754 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_15330 1978812 1977256 gene locus_tag LOCUS_15340 1978812 1977256 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_15340 1979558 1978902 gene locus_tag LOCUS_15350 1979558 1978902 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 protein_id gnl|my_center|LOCUS_15350 1980014 1979700 gene locus_tag LOCUS_15360 1980014 1979700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15360 1980178 1979957 gene locus_tag LOCUS_15370 1980178 1979957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15370 1980896 1980201 gene locus_tag LOCUS_15380 1980896 1980201 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_15380 1982025 1981090 gene locus_tag LOCUS_15390 1982025 1981090 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_15390 1982707 1982009 gene locus_tag LOCUS_15400 gene truB 1982707 1982009 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_15400 1983548 1982709 gene locus_tag LOCUS_15410 1983548 1982709 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_15410 1983764 1983549 gene locus_tag LOCUS_15420 1983764 1983549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1984173 1983895 gene locus_tag LOCUS_15430 1984173 1983895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1984733 1984227 gene locus_tag LOCUS_15440 1984733 1984227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1989589 1985123 gene locus_tag LOCUS_15450 1989589 1985123 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_15450 1989704 1990708 gene locus_tag LOCUS_15460 gene tsaD 1989704 1990708 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_15460 1991296 1990754 gene locus_tag LOCUS_15470 gene bstA 1991296 1990754 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_15470 1991452 1992033 gene locus_tag LOCUS_15480 1991452 1992033 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_15480 1993609 1992260 gene locus_tag LOCUS_15490 gene accC 1993609 1992260 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_15490 1994315 1993827 gene locus_tag LOCUS_15500 gene accB 1994315 1993827 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_15500 1994882 1994319 gene locus_tag LOCUS_15510 gene efp 1994882 1994319 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_15510 1995981 1994983 gene locus_tag LOCUS_15520 1995981 1994983 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_15520 1996952 1996011 gene locus_tag LOCUS_15530 gene plsX 1996952 1996011 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_15530 1997755 1997186 gene locus_tag LOCUS_15540 1997755 1997186 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_15540 1998813 1997809 gene locus_tag LOCUS_15550 gene pdxA 1998813 1997809 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760044.1 protein_id gnl|my_center|LOCUS_15550 2000399 1998957 gene locus_tag LOCUS_15560 2000399 1998957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2000598 2001428 gene locus_tag LOCUS_15570 gene rsmA 2000598 2001428 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_15570 2001432 2002796 gene locus_tag LOCUS_15580 gene mgtE 2001432 2002796 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_15580 2002830 2003273 gene locus_tag LOCUS_15590 2002830 2003273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15590 2003796 2004260 gene locus_tag LOCUS_15600 2003796 2004260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2004404 2005357 gene locus_tag LOCUS_15610 2004404 2005357 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_15610 2005537 2006010 gene locus_tag LOCUS_15620 gene greA 2005537 2006010 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_15620 2006016 2006408 gene locus_tag LOCUS_15630 2006016 2006408 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_15630 2006540 2007361 gene locus_tag LOCUS_15640 2006540 2007361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970001.1 protein_id gnl|my_center|LOCUS_15640 2008117 2007545 gene locus_tag LOCUS_15650 gene ruvC 2008117 2007545 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_15650 2008232 2008825 gene locus_tag LOCUS_15660 2008232 2008825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2008895 2010010 gene locus_tag LOCUS_15670 2008895 2010010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2010600 2012819 gene locus_tag LOCUS_15680 2010600 2012819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2013111 2014007 gene locus_tag LOCUS_15690 2013111 2014007 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_15690 2015216 2014014 gene locus_tag LOCUS_15700 2015216 2014014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2015889 2015254 gene locus_tag LOCUS_15710 2015889 2015254 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_15710 2016027 2016431 gene locus_tag LOCUS_15720 2016027 2016431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 2016446 2016745 gene locus_tag LOCUS_15730 2016446 2016745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15730 2018146 2016992 gene locus_tag LOCUS_15740 2018146 2016992 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 protein_id gnl|my_center|LOCUS_15740 2019041 2018220 gene locus_tag LOCUS_15750 2019041 2018220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2019644 2019234 gene locus_tag LOCUS_15760 2019644 2019234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2019892 2020962 gene locus_tag LOCUS_15770 2019892 2020962 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_15770 2022500 2021097 gene locus_tag LOCUS_15780 2022500 2021097 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_15780 2023222 2022755 gene locus_tag LOCUS_15790 2023222 2022755 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_15790 2024265 2023321 gene locus_tag LOCUS_15800 2024265 2023321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2024786 2026660 gene locus_tag LOCUS_15810 2024786 2026660 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_15810 2026653 2029379 gene locus_tag LOCUS_15820 2026653 2029379 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_15820 2029401 2030180 gene locus_tag LOCUS_15830 2029401 2030180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2030623 2033115 gene locus_tag LOCUS_15840 2030623 2033115 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_15840 2033371 2034399 gene locus_tag LOCUS_15850 2033371 2034399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2034432 2036372 gene locus_tag LOCUS_15860 gene thrS 2034432 2036372 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963051.1 protein_id gnl|my_center|LOCUS_15860 2036523 2037002 gene locus_tag LOCUS_15870 gene infC 2036523 2037002 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_15870 2037032 2037226 gene locus_tag LOCUS_15880 gene rpmI 2037032 2037226 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_15880 2037404 2037697 gene locus_tag LOCUS_15890 gene rplT 2037404 2037697 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_15890 2038040 2037966 gene locus_tag LOCUS_t00150 2038040 2037966 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2038149 2038550 gene locus_tag LOCUS_15900 2038149 2038550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2038670 2040082 gene locus_tag LOCUS_15910 2038670 2040082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2040189 2040464 gene locus_tag LOCUS_15920 gene rpsO 2040189 2040464 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964145.1 protein_id gnl|my_center|LOCUS_15920 2040580 2042724 gene locus_tag LOCUS_15930 gene pnp 2040580 2042724 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_15930 2042960 2043823 gene locus_tag LOCUS_15940 2042960 2043823 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_15940 2043981 2044919 gene locus_tag LOCUS_15950 gene trxB 2043981 2044919 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_15950 2045248 2046297 gene locus_tag LOCUS_15960 2045248 2046297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2046306 2046911 gene locus_tag LOCUS_15970 gene bshB1 2046306 2046911 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15970 2048604 2047105 gene locus_tag LOCUS_15980 gene accC 2048604 2047105 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_15980 2048802 2050040 gene locus_tag LOCUS_15990 2048802 2050040 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_15990 2050147 2050386 gene locus_tag LOCUS_16000 2050147 2050386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2051330 2050554 gene locus_tag LOCUS_16010 2051330 2050554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16010 2051860 2051213 gene locus_tag LOCUS_16020 2051860 2051213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16020 2051859 2052041 gene locus_tag LOCUS_16030 2051859 2052041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2052004 2053047 gene locus_tag LOCUS_16040 gene holA 2052004 2053047 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_16040 2053237 2056308 gene locus_tag LOCUS_16050 2053237 2056308 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108497.1 protein_id gnl|my_center|LOCUS_16050 2056308 2057975 gene locus_tag LOCUS_16060 2056308 2057975 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765321.1 protein_id gnl|my_center|LOCUS_16060 2057987 2059411 gene locus_tag LOCUS_16070 2057987 2059411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2059413 2060105 gene locus_tag LOCUS_16080 2059413 2060105 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_16080 2060109 2060510 gene locus_tag LOCUS_16090 2060109 2060510 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_16090 2060518 2061393 gene locus_tag LOCUS_16100 2060518 2061393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2061420 2062715 gene locus_tag LOCUS_16110 2061420 2062715 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_16110 2062722 2063375 gene locus_tag LOCUS_16120 gene trmB 2062722 2063375 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_16120 2064131 2063508 gene locus_tag LOCUS_16130 2064131 2063508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139517245.1 protein_id gnl|my_center|LOCUS_16130 2064363 2065466 gene locus_tag LOCUS_16140 gene mnmA 2064363 2065466 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_16140 2065518 2066216 gene locus_tag LOCUS_16150 2065518 2066216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2066223 2067899 gene locus_tag LOCUS_16160 2066223 2067899 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_16160 2067957 2068613 gene locus_tag LOCUS_16170 gene rpe 2067957 2068613 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_16170 2068662 2071079 gene locus_tag LOCUS_16180 2068662 2071079 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_16180 2072334 2071453 gene locus_tag LOCUS_16190 2072334 2071453 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_16190 2072798 2073649 gene locus_tag LOCUS_16200 gene hisG 2072798 2073649 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_16200 2073649 2074941 gene locus_tag LOCUS_16210 gene hisD 2073649 2074941 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_16210 2074934 2075986 gene locus_tag LOCUS_16220 gene hisC 2074934 2075986 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_16220 2076075 2077169 gene locus_tag LOCUS_16230 gene hisB 2076075 2077169 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_16230 2077169 2077750 gene locus_tag LOCUS_16240 gene hisH 2077169 2077750 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_16240 2077747 2078469 gene locus_tag LOCUS_16250 gene hisA 2077747 2078469 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_16250 2078463 2079224 gene locus_tag LOCUS_16260 gene hisF 2078463 2079224 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_16260 2079215 2079841 gene locus_tag LOCUS_16270 gene hisIE 2079215 2079841 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_16270 2080733 2079870 gene locus_tag LOCUS_16280 2080733 2079870 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_16280 2081372 2080800 gene locus_tag LOCUS_16290 2081372 2080800 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040162.1 protein_id gnl|my_center|LOCUS_16290 2081512 2082318 gene locus_tag LOCUS_16300 2081512 2082318 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977223.1 protein_id gnl|my_center|LOCUS_16300 2084774 2082399 gene locus_tag LOCUS_16310 2084774 2082399 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_16310 2085471 2086325 gene locus_tag LOCUS_16320 2085471 2086325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2087811 2086519 gene locus_tag LOCUS_16330 2087811 2086519 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_16330 2088648 2087878 gene locus_tag LOCUS_16340 2088648 2087878 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067370.1 protein_id gnl|my_center|LOCUS_16340 2089983 2088832 gene locus_tag LOCUS_16350 2089983 2088832 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067533.1 protein_id gnl|my_center|LOCUS_16350 2091300 2090077 gene locus_tag LOCUS_16360 2091300 2090077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 2092283 2091453 gene locus_tag LOCUS_16370 2092283 2091453 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532465.1 protein_id gnl|my_center|LOCUS_16370 2093665 2092283 gene locus_tag LOCUS_16380 2093665 2092283 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_16380 2095636 2093762 gene locus_tag LOCUS_16390 2095636 2093762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2096438 2095995 gene locus_tag LOCUS_16400 2096438 2095995 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_16400 2097798 2096563 gene locus_tag LOCUS_16410 2097798 2096563 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_16410 2098652 2097831 gene locus_tag LOCUS_16420 2098652 2097831 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_16420 2099173 2098721 gene locus_tag LOCUS_16430 2099173 2098721 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927170.1 protein_id gnl|my_center|LOCUS_16430 2099349 2099867 gene locus_tag LOCUS_16440 2099349 2099867 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_16440 2100389 2099898 gene locus_tag LOCUS_16450 2100389 2099898 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383691.1 protein_id gnl|my_center|LOCUS_16450 2101938 2100559 gene locus_tag LOCUS_16460 2101938 2100559 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_16460 2102329 2102862 gene locus_tag LOCUS_16470 2102329 2102862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2103715 2103086 gene locus_tag LOCUS_16480 2103715 2103086 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_16480 2104598 2103762 gene locus_tag LOCUS_16490 2104598 2103762 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_16490 2105128 2104748 gene locus_tag LOCUS_16500 2105128 2104748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2105325 2106266 gene locus_tag LOCUS_16510 gene iaaA 2105325 2106266 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030503.1 protein_id gnl|my_center|LOCUS_16510 2107418 2106516 gene locus_tag LOCUS_16520 2107418 2106516 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_16520 2107797 2108291 gene locus_tag LOCUS_16530 2107797 2108291 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388788.1 protein_id gnl|my_center|LOCUS_16530 2110231 2108426 gene locus_tag LOCUS_16540 2110231 2108426 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_16540 2110694 2112370 gene locus_tag LOCUS_16550 2110694 2112370 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_16550 2112605 2112985 gene locus_tag LOCUS_16560 2112605 2112985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2113014 2113172 gene locus_tag LOCUS_16570 2113014 2113172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2113376 2114734 gene locus_tag LOCUS_16580 gene xseA 2113376 2114734 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_16580 2114740 2114958 gene locus_tag LOCUS_16590 2114740 2114958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2115429 2115674 gene locus_tag LOCUS_16600 2115429 2115674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2116530 2115784 gene locus_tag LOCUS_16610 2116530 2115784 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_16610 2117567 2116527 gene locus_tag LOCUS_16620 2117567 2116527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2118504 2117650 gene locus_tag LOCUS_16630 2118504 2117650 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_16630 2121040 2118713 gene locus_tag LOCUS_16640 2121040 2118713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2121693 2123048 gene locus_tag LOCUS_16650 2121693 2123048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2124961 2123417 gene locus_tag LOCUS_16660 2124961 2123417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2126121 2124967 gene locus_tag LOCUS_16670 2126121 2124967 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187247289.1 protein_id gnl|my_center|LOCUS_16670 2126450 2126848 gene locus_tag LOCUS_16680 2126450 2126848 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_16680 2126931 2127455 gene locus_tag LOCUS_16690 2126931 2127455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2128773 2127712 gene locus_tag LOCUS_16700 2128773 2127712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2132177 2129601 gene locus_tag LOCUS_16710 gene ppc 2132177 2129601 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058147.1 protein_id gnl|my_center|LOCUS_16710 2132784 2132434 gene locus_tag LOCUS_16720 2132784 2132434 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_16720 2133583 2132942 gene locus_tag LOCUS_16730 2133583 2132942 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033930894.1 protein_id gnl|my_center|LOCUS_16730 2133831 2133658 gene locus_tag LOCUS_16740 2133831 2133658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2134106 2133807 gene locus_tag LOCUS_16750 2134106 2133807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2137758 2134456 gene locus_tag LOCUS_16760 2137758 2134456 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_16760 2138346 2139212 gene locus_tag LOCUS_16770 2138346 2139212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2140025 2139585 gene locus_tag LOCUS_16780 2140025 2139585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2141203 2140988 gene locus_tag LOCUS_16790 2141203 2140988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2142335 2141436 gene locus_tag LOCUS_16800 2142335 2141436 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224923.1 protein_id gnl|my_center|LOCUS_16800 2142885 2144384 gene locus_tag LOCUS_16810 2142885 2144384 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403298.1 protein_id gnl|my_center|LOCUS_16810 2144889 2145110 gene locus_tag LOCUS_16820 2144889 2145110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2145460 2145384 gene locus_tag LOCUS_t00160 2145460 2145384 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2147993 2145588 gene locus_tag LOCUS_16830 2147993 2145588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2148578 2148027 gene locus_tag LOCUS_16840 2148578 2148027 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_16840 2148859 2149515 gene locus_tag LOCUS_16850 gene pdxH 2148859 2149515 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_16850 2149556 2150854 gene locus_tag LOCUS_16860 2149556 2150854 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_16860 2150883 2151389 gene locus_tag LOCUS_16870 2150883 2151389 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963543.1 protein_id gnl|my_center|LOCUS_16870 2151467 2152438 gene locus_tag LOCUS_16880 2151467 2152438 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_16880 2153616 2152645 gene locus_tag LOCUS_16890 gene arsM 2153616 2152645 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_16890 2154537 2153743 gene locus_tag LOCUS_16900 2154537 2153743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2155859 2154897 gene locus_tag LOCUS_16910 2155859 2154897 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_16910 2155987 2156931 gene locus_tag LOCUS_16920 2155987 2156931 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_16920 2157615 2159096 gene locus_tag LOCUS_16930 2157615 2159096 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_16930 2159118 2160521 gene locus_tag LOCUS_16940 2159118 2160521 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_16940 2160781 2161770 gene locus_tag LOCUS_16950 2160781 2161770 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_16950 2161980 2162684 gene locus_tag LOCUS_16960 2161980 2162684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2162854 2163255 gene locus_tag LOCUS_16970 2162854 2163255 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941967.1 protein_id gnl|my_center|LOCUS_16970 2163258 2164307 gene locus_tag LOCUS_16980 gene arsS 2163258 2164307 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_16980 2164309 2164812 gene locus_tag LOCUS_16990 2164309 2164812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2164805 2165404 gene locus_tag LOCUS_17000 2164805 2165404 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_17000 2166176 2165652 gene locus_tag LOCUS_17010 2166176 2165652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2167055 2166276 gene locus_tag LOCUS_17020 2167055 2166276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2167518 2169098 gene locus_tag LOCUS_17030 2167518 2169098 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_17030 2169261 2169620 gene locus_tag LOCUS_17040 2169261 2169620 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_17040 2169979 2170512 gene locus_tag LOCUS_17050 2169979 2170512 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_17050 2170527 2171354 gene locus_tag LOCUS_17060 2170527 2171354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2171366 2172505 gene locus_tag LOCUS_17070 2171366 2172505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2173432 2172686 gene locus_tag LOCUS_17080 2173432 2172686 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624136.1 protein_id gnl|my_center|LOCUS_17080 2173506 2175899 gene locus_tag LOCUS_17090 2173506 2175899 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_17090 2176779 2178014 gene locus_tag LOCUS_17100 2176779 2178014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17100 2178152 2186443 gene locus_tag LOCUS_17110 2178152 2186443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2186806 2186624 gene locus_tag LOCUS_17120 2186806 2186624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2187061 2187951 gene locus_tag LOCUS_17130 gene hemF 2187061 2187951 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_17130 2188124 2188699 gene locus_tag LOCUS_17140 2188124 2188699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2188726 2189142 gene locus_tag LOCUS_17150 2188726 2189142 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481688.1 protein_id gnl|my_center|LOCUS_17150 2189327 2191684 gene locus_tag LOCUS_17160 2189327 2191684 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_17160 2191687 2192622 gene locus_tag LOCUS_17170 2191687 2192622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2193034 2193300 gene locus_tag LOCUS_17180 2193034 2193300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061339.1 protein_id gnl|my_center|LOCUS_17180 2193996 2193412 gene locus_tag LOCUS_17190 2193996 2193412 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_17190 2194405 2194085 gene locus_tag LOCUS_17200 2194405 2194085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2196027 2194588 gene locus_tag LOCUS_17210 2196027 2194588 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_17210 2196240 2196893 gene locus_tag LOCUS_17220 2196240 2196893 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_17220 2197061 2197600 gene locus_tag LOCUS_17230 2197061 2197600 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_17230 2197658 2198215 gene locus_tag LOCUS_17240 2197658 2198215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2199476 2198352 gene locus_tag LOCUS_17250 2199476 2198352 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_17250 2200998 2199541 gene locus_tag LOCUS_17260 gene gatB 2200998 2199541 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_17260 2204049 2201407 gene locus_tag LOCUS_17270 gene alaS 2204049 2201407 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_17270 2204337 2204675 gene locus_tag LOCUS_17280 2204337 2204675 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_17280 2205447 2205250 gene locus_tag LOCUS_17290 2205447 2205250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2205783 2205989 gene locus_tag LOCUS_17300 2205783 2205989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2206345 2206046 gene locus_tag LOCUS_17310 2206345 2206046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2206877 2207977 gene locus_tag LOCUS_17320 gene dprA 2206877 2207977 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_17320 2208127 2208966 gene locus_tag LOCUS_17330 gene pabC 2208127 2208966 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453968.1 protein_id gnl|my_center|LOCUS_17330 2209049 2210236 gene locus_tag LOCUS_17340 2209049 2210236 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_17340 2215745 2210985 gene locus_tag LOCUS_17350 2215745 2210985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2216030 2217088 gene locus_tag LOCUS_17360 2216030 2217088 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 protein_id gnl|my_center|LOCUS_17360 2218076 2217612 gene locus_tag LOCUS_17370 2218076 2217612 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_17370 2218365 2219057 gene locus_tag LOCUS_17380 2218365 2219057 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338738.1 protein_id gnl|my_center|LOCUS_17380 2219075 2219767 gene locus_tag LOCUS_17390 2219075 2219767 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166537637.1 protein_id gnl|my_center|LOCUS_17390 2221202 2219937 gene locus_tag LOCUS_17400 2221202 2219937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2223387 2222260 gene locus_tag LOCUS_17410 2223387 2222260 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_17410 2224356 2223400 gene locus_tag LOCUS_17420 2224356 2223400 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_17420 2224462 2224851 gene locus_tag LOCUS_17430 2224462 2224851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2224881 2227175 gene locus_tag LOCUS_17440 2224881 2227175 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_17440 2227399 2227956 gene locus_tag LOCUS_17450 2227399 2227956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2228128 2230089 gene locus_tag LOCUS_17460 2228128 2230089 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_17460 2230163 2230675 gene locus_tag LOCUS_17470 2230163 2230675 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_17470 2231541 2230918 gene locus_tag LOCUS_17480 2231541 2230918 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_17480 2231712 2232206 gene locus_tag LOCUS_17490 2231712 2232206 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_17490 2232351 2233115 gene locus_tag LOCUS_17500 2232351 2233115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2233575 2233234 gene locus_tag LOCUS_17510 2233575 2233234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2234614 2233940 gene locus_tag LOCUS_17520 2234614 2233940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2235401 2234844 gene locus_tag LOCUS_17530 2235401 2234844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2237763 2235508 gene locus_tag LOCUS_17540 2237763 2235508 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_17540 2237763 2237957 gene locus_tag LOCUS_17550 2237763 2237957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2240772 2238517 gene locus_tag LOCUS_17560 2240772 2238517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2243137 2241440 gene locus_tag LOCUS_17570 2243137 2241440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2243564 2246332 gene locus_tag LOCUS_17580 gene leuS 2243564 2246332 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_17580 2248132 2246423 gene locus_tag LOCUS_17590 2248132 2246423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2250608 2248167 gene locus_tag LOCUS_17600 2250608 2248167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2250675 2251079 gene locus_tag LOCUS_17610 2250675 2251079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2251701 2251342 gene locus_tag LOCUS_17620 2251701 2251342 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_17620 2254216 2252234 gene locus_tag LOCUS_17630 gene ispG 2254216 2252234 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011576.1 protein_id gnl|my_center|LOCUS_17630 2254405 2254890 gene locus_tag LOCUS_17640 2254405 2254890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2257161 2254969 gene locus_tag LOCUS_17650 2257161 2254969 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_17650 2257409 2259265 gene locus_tag LOCUS_17660 2257409 2259265 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_17660 2259540 2260865 gene locus_tag LOCUS_17670 gene mtaB 2259540 2260865 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_17670 2261560 2261033 gene locus_tag LOCUS_17680 2261560 2261033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2263599 2262049 gene locus_tag LOCUS_17690 2263599 2262049 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_17690 2263598 2263759 gene locus_tag LOCUS_17700 2263598 2263759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2264676 2263813 gene locus_tag LOCUS_17710 2264676 2263813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2265070 2266722 gene locus_tag LOCUS_17720 gene glgP 2265070 2266722 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_17720 2267714 2266869 gene locus_tag LOCUS_17730 2267714 2266869 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102119.1 protein_id gnl|my_center|LOCUS_17730 2268258 2268824 gene locus_tag LOCUS_17740 2268258 2268824 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312245.1 protein_id gnl|my_center|LOCUS_17740 2270160 2268922 gene locus_tag LOCUS_17750 2270160 2268922 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_17750 2270279 2271580 gene locus_tag LOCUS_17760 2270279 2271580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_17760 2271791 2272561 gene locus_tag LOCUS_17770 2271791 2272561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2273210 2272599 gene locus_tag LOCUS_17780 2273210 2272599 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_17780 2275289 2273361 gene locus_tag LOCUS_17790 2275289 2273361 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_17790 2276353 2275292 gene locus_tag LOCUS_17800 gene lpxK 2276353 2275292 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963591.1 protein_id gnl|my_center|LOCUS_17800 2276431 2277528 gene locus_tag LOCUS_17810 2276431 2277528 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_17810 2277536 2278270 gene locus_tag LOCUS_17820 2277536 2278270 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_17820 2278379 2279668 gene locus_tag LOCUS_17830 2278379 2279668 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_17830 2279735 2280376 gene locus_tag LOCUS_17840 2279735 2280376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2280626 2282056 gene locus_tag LOCUS_17850 gene miaB 2280626 2282056 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_17850 2282119 2283381 gene locus_tag LOCUS_17860 2282119 2283381 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_17860 2283410 2283889 gene locus_tag LOCUS_17870 2283410 2283889 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_17870 2284027 2285472 gene locus_tag LOCUS_17880 2284027 2285472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2285476 2285907 gene locus_tag LOCUS_17890 gene secG 2285476 2285907 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_17890 2286128 2286502 gene locus_tag LOCUS_17900 gene groES 2286128 2286502 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_17900 2286570 2288210 gene locus_tag LOCUS_17910 gene groL 2286570 2288210 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_17910 2288505 2288365 gene locus_tag LOCUS_17920 2288505 2288365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2288765 2289256 gene locus_tag LOCUS_17930 2288765 2289256 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142184.1 protein_id gnl|my_center|LOCUS_17930 2289259 2289861 gene locus_tag LOCUS_17940 2289259 2289861 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143387867.1 protein_id gnl|my_center|LOCUS_17940 2291506 2290004 gene locus_tag LOCUS_17950 2291506 2290004 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_17950 2291727 2292443 gene locus_tag LOCUS_17960 2291727 2292443 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_17960 2292505 2293116 gene locus_tag LOCUS_17970 2292505 2293116 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_17970 2293624 2293127 gene locus_tag LOCUS_17980 2293624 2293127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2293814 2297341 gene locus_tag LOCUS_17990 gene smc 2293814 2297341 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092731919.1 protein_id gnl|my_center|LOCUS_17990 2297924 2297463 gene locus_tag LOCUS_18000 2297924 2297463 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_18000 2298986 2298228 gene locus_tag LOCUS_18010 2298986 2298228 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930865.1 protein_id gnl|my_center|LOCUS_18010 2299781 2298990 gene locus_tag LOCUS_18020 2299781 2298990 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_18020 2300943 2299993 gene locus_tag LOCUS_18030 2300943 2299993 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_18030 2301165 2301239 gene locus_tag LOCUS_t00170 2301165 2301239 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2301350 2302264 gene locus_tag LOCUS_18040 2301350 2302264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2305298 2302389 gene locus_tag LOCUS_18050 2305298 2302389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2305825 2305304 gene locus_tag LOCUS_18060 2305825 2305304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2306300 2305932 gene locus_tag LOCUS_18070 2306300 2305932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2306523 2306293 gene locus_tag LOCUS_18080 2306523 2306293 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_18080 2306774 2306523 gene locus_tag LOCUS_18090 2306774 2306523 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_18090 2307084 2306761 gene locus_tag LOCUS_18100 2307084 2306761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2307977 2307180 gene locus_tag LOCUS_18110 2307977 2307180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2308648 2308154 gene locus_tag LOCUS_18120 2308648 2308154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2309625 2308645 gene locus_tag LOCUS_18130 2309625 2308645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2310919 2309627 gene locus_tag LOCUS_18140 2310919 2309627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962943.1 protein_id gnl|my_center|LOCUS_18140 2311212 2310919 gene locus_tag LOCUS_18150 2311212 2310919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2313053 2311578 gene locus_tag LOCUS_18160 2313053 2311578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962949.1 protein_id gnl|my_center|LOCUS_18160 2313570 2313037 gene locus_tag LOCUS_18170 2313570 2313037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2314036 2313722 gene locus_tag LOCUS_18180 2314036 2313722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2314824 2314036 gene locus_tag LOCUS_18190 2314824 2314036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2315708 2315037 gene locus_tag LOCUS_18200 2315708 2315037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2316756 2315800 gene locus_tag LOCUS_18210 2316756 2315800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2318182 2316827 gene locus_tag LOCUS_18220 2318182 2316827 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190275052.1 protein_id gnl|my_center|LOCUS_18220 2318744 2318274 gene locus_tag LOCUS_18230 2318744 2318274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2319430 2318720 gene locus_tag LOCUS_18240 2319430 2318720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2321821 2319437 gene locus_tag LOCUS_18250 2321821 2319437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2323353 2321818 gene locus_tag LOCUS_18260 2323353 2321818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2323979 2323353 gene locus_tag LOCUS_18270 2323979 2323353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2324572 2323979 gene locus_tag LOCUS_18280 2324572 2323979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2326584 2324857 gene locus_tag LOCUS_18290 2326584 2324857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2328390 2326609 gene locus_tag LOCUS_18300 2328390 2326609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2328707 2328390 gene locus_tag LOCUS_18310 2328707 2328390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2328871 2328704 gene locus_tag LOCUS_18320 2328871 2328704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2329310 2328933 gene locus_tag LOCUS_18330 2329310 2328933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2329749 2330321 gene locus_tag LOCUS_18340 2329749 2330321 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_18340 2330543 2330313 gene locus_tag LOCUS_18350 2330543 2330313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2330952 2330725 gene locus_tag LOCUS_18360 2330952 2330725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2331398 2330973 gene locus_tag LOCUS_18370 2331398 2330973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2331605 2331408 gene locus_tag LOCUS_18380 2331605 2331408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2331841 2331605 gene locus_tag LOCUS_18390 2331841 2331605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2332374 2331961 gene locus_tag LOCUS_18400 2332374 2331961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2332664 2332371 gene locus_tag LOCUS_18410 2332664 2332371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2334032 2332668 gene locus_tag LOCUS_18420 2334032 2332668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2334441 2334211 gene locus_tag LOCUS_18430 2334441 2334211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2334713 2334438 gene locus_tag LOCUS_18440 2334713 2334438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2335078 2334713 gene locus_tag LOCUS_18450 2335078 2334713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2335488 2335159 gene locus_tag LOCUS_18460 2335488 2335159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2335631 2336065 gene locus_tag LOCUS_18470 2335631 2336065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2336215 2337375 gene locus_tag LOCUS_18480 2336215 2337375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2337464 2339077 gene locus_tag LOCUS_18490 2337464 2339077 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 protein_id gnl|my_center|LOCUS_18490 2339164 2339382 gene locus_tag LOCUS_18500 2339164 2339382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2339453 2340379 gene locus_tag LOCUS_18510 2339453 2340379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2340474 2340647 gene locus_tag LOCUS_18520 2340474 2340647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2340660 2340878 gene locus_tag LOCUS_18530 2340660 2340878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2341261 2341821 gene locus_tag LOCUS_18540 2341261 2341821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2341854 2343248 gene locus_tag LOCUS_18550 2341854 2343248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2344012 2343590 gene locus_tag LOCUS_18560 2344012 2343590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2344230 2344045 gene locus_tag LOCUS_18570 2344230 2344045 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_18570 2346314 2344494 gene locus_tag LOCUS_18580 2346314 2344494 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 protein_id gnl|my_center|LOCUS_18580 2346738 2348303 gene locus_tag LOCUS_18590 2346738 2348303 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_18590 2348829 2348497 gene locus_tag LOCUS_18600 2348829 2348497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2349158 2349068 gene locus_tag LOCUS_t00180 2349158 2349068 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2349923 2352928 gene locus_tag LOCUS_18610 2349923 2352928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2354222 2353152 gene locus_tag LOCUS_18620 2354222 2353152 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_18620 2354994 2354224 gene locus_tag LOCUS_18630 2354994 2354224 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_18630 2356132 2355038 gene locus_tag LOCUS_18640 2356132 2355038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2356758 2356129 gene locus_tag LOCUS_18650 2356758 2356129 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_18650 2357911 2356769 gene locus_tag LOCUS_18660 2357911 2356769 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889299.1 protein_id gnl|my_center|LOCUS_18660 2359324 2357933 gene locus_tag LOCUS_18670 2359324 2357933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2359677 2360441 gene locus_tag LOCUS_18680 2359677 2360441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2360523 2361674 gene locus_tag LOCUS_18690 2360523 2361674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2362301 2363119 gene locus_tag LOCUS_18700 2362301 2363119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2363626 2364555 gene locus_tag LOCUS_18710 2363626 2364555 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027649.1 protein_id gnl|my_center|LOCUS_18710 2366004 2364775 gene locus_tag LOCUS_18720 2366004 2364775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2367109 2365997 gene locus_tag LOCUS_18730 2367109 2365997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2367447 2367190 gene locus_tag LOCUS_18740 2367447 2367190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2368775 2367675 gene locus_tag LOCUS_18750 2368775 2367675 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_18750 2369021 2370514 gene locus_tag LOCUS_18760 2369021 2370514 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_18760 2370848 2371642 gene locus_tag LOCUS_18770 gene cobA 2370848 2371642 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_18770 2371989 2373026 gene locus_tag LOCUS_18780 2371989 2373026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2375081 2373189 gene locus_tag LOCUS_18790 2375081 2373189 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_18790 2376742 2375216 gene locus_tag LOCUS_18800 2376742 2375216 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141815646.1 protein_id gnl|my_center|LOCUS_18800 2378491 2376752 gene locus_tag LOCUS_18810 2378491 2376752 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_18810 2380722 2378521 gene locus_tag LOCUS_18820 gene nuoL 2380722 2378521 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927227.1 protein_id gnl|my_center|LOCUS_18820 2381040 2380729 gene locus_tag LOCUS_18830 gene nuoK 2381040 2380729 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_18830 2381624 2381145 gene locus_tag LOCUS_18840 2381624 2381145 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_18840 2382335 2381835 gene locus_tag LOCUS_18850 2382335 2381835 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932453.1 protein_id gnl|my_center|LOCUS_18850 2383464 2382412 gene locus_tag LOCUS_18860 gene nuoH 2383464 2382412 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_18860 2383882 2384379 gene locus_tag LOCUS_18870 2383882 2384379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2384424 2384807 gene locus_tag LOCUS_18880 2384424 2384807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2385104 2385322 gene locus_tag LOCUS_18890 2385104 2385322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2385433 2385708 gene locus_tag LOCUS_18900 2385433 2385708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18900 2387058 2385838 gene locus_tag LOCUS_18910 2387058 2385838 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_18910 2387784 2387173 gene locus_tag LOCUS_18920 2387784 2387173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2388745 2387930 gene locus_tag LOCUS_18930 gene murI 2388745 2387930 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_18930 2389122 2389394 gene locus_tag LOCUS_18940 2389122 2389394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2389633 2391522 gene locus_tag LOCUS_18950 2389633 2391522 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_18950 2392475 2391783 gene locus_tag LOCUS_18960 2392475 2391783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2393371 2392619 gene locus_tag LOCUS_18970 2393371 2392619 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370883.1 protein_id gnl|my_center|LOCUS_18970 2393680 2395134 gene locus_tag LOCUS_18980 2393680 2395134 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_18980 2396139 2395222 gene locus_tag LOCUS_18990 2396139 2395222 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819265.1 protein_id gnl|my_center|LOCUS_18990 2396781 2396173 gene locus_tag LOCUS_19000 2396781 2396173 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963538.1 protein_id gnl|my_center|LOCUS_19000 2398786 2396993 gene locus_tag LOCUS_19010 gene argS 2398786 2396993 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_19010 2399557 2399156 gene locus_tag LOCUS_19020 2399557 2399156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19020 2400120 2399557 gene locus_tag LOCUS_19030 2400120 2399557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19030 2400209 2401609 gene locus_tag LOCUS_19040 2400209 2401609 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_19040 2402412 2401897 gene locus_tag LOCUS_19050 gene gmhB 2402412 2401897 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966334.1 protein_id gnl|my_center|LOCUS_19050 2402550 2403281 gene locus_tag LOCUS_19060 2402550 2403281 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_19060 2403356 2404420 gene locus_tag LOCUS_19070 2403356 2404420 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_19070 2405869 2404652 gene locus_tag LOCUS_19080 2405869 2404652 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479768.1 protein_id gnl|my_center|LOCUS_19080 2406668 2406474 gene locus_tag LOCUS_19090 2406668 2406474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2407756 2406944 gene locus_tag LOCUS_19100 2407756 2406944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2407916 2408620 gene locus_tag LOCUS_19110 2407916 2408620 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259732.1 protein_id gnl|my_center|LOCUS_19110 2408638 2409651 gene locus_tag LOCUS_19120 2408638 2409651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_19120 2410008 2411111 gene locus_tag LOCUS_19130 2410008 2411111 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_19130 2411333 2412169 gene locus_tag LOCUS_19140 2411333 2412169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2412166 2413353 gene locus_tag LOCUS_19150 2412166 2413353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2414422 2413580 gene locus_tag LOCUS_19160 2414422 2413580 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083549713.1 protein_id gnl|my_center|LOCUS_19160 2414881 2415492 gene locus_tag LOCUS_19170 2414881 2415492 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355669.1 protein_id gnl|my_center|LOCUS_19170 2415808 2416056 gene locus_tag LOCUS_19180 2415808 2416056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2418102 2416213 gene locus_tag LOCUS_19190 2418102 2416213 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108318.1 protein_id gnl|my_center|LOCUS_19190 2418489 2419838 gene locus_tag LOCUS_19200 gene purB 2418489 2419838 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_19200 2419930 2421045 gene locus_tag LOCUS_19210 2419930 2421045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2422296 2421160 gene locus_tag LOCUS_19220 2422296 2421160 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_19220 2423275 2422289 gene locus_tag LOCUS_19230 2423275 2422289 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_19230 2423824 2423285 gene locus_tag LOCUS_19240 2423824 2423285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2424359 2423847 gene locus_tag LOCUS_19250 2424359 2423847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2425680 2424391 gene locus_tag LOCUS_19260 2425680 2424391 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_19260 2427700 2425682 gene locus_tag LOCUS_19270 2427700 2425682 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_19270 2429341 2428091 gene locus_tag LOCUS_19280 2429341 2428091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2431656 2429296 gene locus_tag LOCUS_19290 2431656 2429296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19290 2436118 2432288 gene locus_tag LOCUS_19300 2436118 2432288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2437354 2436848 gene locus_tag LOCUS_19310 2437354 2436848 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073392055.1 protein_id gnl|my_center|LOCUS_19310 2439554 2437695 gene locus_tag LOCUS_19320 2439554 2437695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2440005 2440598 gene locus_tag LOCUS_19330 2440005 2440598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2440719 2441354 gene locus_tag LOCUS_19340 2440719 2441354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2444787 2441785 gene locus_tag LOCUS_19350 2444787 2441785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2446860 2445157 gene locus_tag LOCUS_19360 2446860 2445157 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_19360 2447840 2447133 gene locus_tag LOCUS_19370 2447840 2447133 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839853.1 protein_id gnl|my_center|LOCUS_19370 2449614 2447872 gene locus_tag LOCUS_19380 2449614 2447872 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_19380 2450051 2450785 gene locus_tag LOCUS_19390 2450051 2450785 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140602.1 protein_id gnl|my_center|LOCUS_19390 2450822 2451667 gene locus_tag LOCUS_19400 2450822 2451667 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_19400 2452122 2451808 gene locus_tag LOCUS_19410 2452122 2451808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2452808 2452113 gene locus_tag LOCUS_19420 2452808 2452113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2455015 2453282 gene locus_tag LOCUS_19430 2455015 2453282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2455680 2455507 gene locus_tag LOCUS_19440 2455680 2455507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19440 2456677 2456997 gene locus_tag LOCUS_19450 2456677 2456997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2457150 2457398 gene locus_tag LOCUS_19460 2457150 2457398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2458024 2459238 gene locus_tag LOCUS_19470 2458024 2459238 CDS product TIGR03118 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928497.1 protein_id gnl|my_center|LOCUS_19470 2460697 2459483 gene locus_tag LOCUS_19480 2460697 2459483 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_19480 2461772 2460981 gene locus_tag LOCUS_19490 2461772 2460981 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_19490 2462631 2461789 gene locus_tag LOCUS_19500 gene kduI 2462631 2461789 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762839.1 protein_id gnl|my_center|LOCUS_19500 2463007 2462771 gene locus_tag LOCUS_19510 2463007 2462771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2463500 2463135 gene locus_tag LOCUS_19520 2463500 2463135 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_19520 2465712 2463634 gene locus_tag LOCUS_19530 2465712 2463634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2466633 2465902 gene locus_tag LOCUS_19540 2466633 2465902 CDS product DUF3823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053826137.1 protein_id gnl|my_center|LOCUS_19540 2468553 2466664 gene locus_tag LOCUS_19550 2468553 2466664 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_19550 2471770 2468558 gene locus_tag LOCUS_19560 2471770 2468558 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291394.1 protein_id gnl|my_center|LOCUS_19560 2473179 2472277 gene locus_tag LOCUS_19570 2473179 2472277 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_19570 2474380 2473235 gene locus_tag LOCUS_19580 2474380 2473235 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_19580 2476963 2474867 gene locus_tag LOCUS_19590 2476963 2474867 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_19590 2477784 2477011 gene locus_tag LOCUS_19600 2477784 2477011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2480366 2477901 gene locus_tag LOCUS_19610 2480366 2477901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 2481382 2480375 gene locus_tag LOCUS_19620 2481382 2480375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19620 2482833 2481658 gene locus_tag LOCUS_19630 2482833 2481658 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_19630 2483321 2484568 gene locus_tag LOCUS_19640 2483321 2484568 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_19640 2484929 2485801 gene locus_tag LOCUS_19650 2484929 2485801 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_19650 2486127 2485903 gene locus_tag LOCUS_19660 2486127 2485903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2486186 2487037 gene locus_tag LOCUS_19670 2486186 2487037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2487195 2487740 gene locus_tag LOCUS_19680 2487195 2487740 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941689.1 protein_id gnl|my_center|LOCUS_19680 2489374 2487986 gene locus_tag LOCUS_19690 2489374 2487986 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402863.1 protein_id gnl|my_center|LOCUS_19690 2490628 2489468 gene locus_tag LOCUS_19700 2490628 2489468 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042596355.1 protein_id gnl|my_center|LOCUS_19700 2491191 2491724 gene locus_tag LOCUS_19710 2491191 2491724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2492699 2492148 gene locus_tag LOCUS_19720 2492699 2492148 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_19720 2493268 2492711 gene locus_tag LOCUS_19730 2493268 2492711 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_19730 2494814 2493546 gene locus_tag LOCUS_19740 2494814 2493546 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_19740 2497587 2494819 gene locus_tag LOCUS_19750 2497587 2494819 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_19750 2498209 2497610 gene locus_tag LOCUS_19760 2498209 2497610 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_19760 2498910 2498425 gene locus_tag LOCUS_19770 2498910 2498425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2502217 2499932 gene locus_tag LOCUS_19780 2502217 2499932 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764319.1 protein_id gnl|my_center|LOCUS_19780 2505453 2503399 gene locus_tag LOCUS_19790 2505453 2503399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2506371 2505493 gene locus_tag LOCUS_19800 2506371 2505493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2507452 2508333 gene locus_tag LOCUS_19810 2507452 2508333 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224863.1 protein_id gnl|my_center|LOCUS_19810 2508428 2509348 gene locus_tag LOCUS_19820 2508428 2509348 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_19820 2509765 2510601 gene locus_tag LOCUS_19830 2509765 2510601 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_19830 2511125 2510826 gene locus_tag LOCUS_19840 2511125 2510826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2512159 2512086 gene locus_tag LOCUS_t00190 2512159 2512086 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2512229 2512963 gene locus_tag LOCUS_19850 2512229 2512963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2513890 2513072 gene locus_tag LOCUS_19860 2513890 2513072 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_19860 2514015 2515424 gene locus_tag LOCUS_19870 gene rlmD 2514015 2515424 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_19870 2515548 2515916 gene locus_tag LOCUS_19880 2515548 2515916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2516368 2517561 gene locus_tag LOCUS_19890 2516368 2517561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2518164 2517619 gene locus_tag LOCUS_19900 2518164 2517619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2519428 2518403 gene locus_tag LOCUS_19910 gene thiL 2519428 2518403 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_19910 2520050 2522392 gene locus_tag LOCUS_19920 2520050 2522392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2522637 2523266 gene locus_tag LOCUS_19930 2522637 2523266 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_19930 2523333 2524064 gene locus_tag LOCUS_19940 2523333 2524064 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_19940 2524139 2525134 gene locus_tag LOCUS_19950 2524139 2525134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2525224 2526777 gene locus_tag LOCUS_19960 2525224 2526777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2527073 2529574 gene locus_tag LOCUS_19970 2527073 2529574 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_19970 2532978 2530381 gene locus_tag LOCUS_19980 2532978 2530381 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_19980 2533511 2535940 gene locus_tag LOCUS_19990 2533511 2535940 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_19990 2536147 2537778 gene locus_tag LOCUS_20000 2536147 2537778 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_20000 2537791 2539599 gene locus_tag LOCUS_20010 gene yidC 2537791 2539599 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_20010 2541480 2539864 gene locus_tag LOCUS_20020 2541480 2539864 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_20020 2541596 2542279 gene locus_tag LOCUS_20030 2541596 2542279 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287133.1 protein_id gnl|my_center|LOCUS_20030 2542304 2543083 gene locus_tag LOCUS_20040 2542304 2543083 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_20040 2543156 2544076 gene locus_tag LOCUS_20050 2543156 2544076 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_20050 2544079 2544732 gene locus_tag LOCUS_20060 2544079 2544732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2544732 2545448 gene locus_tag LOCUS_20070 gene dapB 2544732 2545448 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_20070 2545469 2546566 gene locus_tag LOCUS_20080 2545469 2546566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2547319 2546654 gene locus_tag LOCUS_20090 gene ung 2547319 2546654 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_20090 2547435 2547821 gene locus_tag LOCUS_20100 gene apaG 2547435 2547821 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970890.1 protein_id gnl|my_center|LOCUS_20100 2547832 2548536 gene locus_tag LOCUS_20110 2547832 2548536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20110 2549173 2548616 gene locus_tag LOCUS_20120 2549173 2548616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20120 2549427 2549188 gene locus_tag LOCUS_20130 2549427 2549188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20130 2549966 2550916 gene locus_tag LOCUS_20140 2549966 2550916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2553616 2550992 gene locus_tag LOCUS_20150 gene cphA 2553616 2550992 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 protein_id gnl|my_center|LOCUS_20150 2554563 2553670 gene locus_tag LOCUS_20160 2554563 2553670 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_20160 2555171 2554830 gene locus_tag LOCUS_20170 2555171 2554830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2555592 2556242 gene locus_tag LOCUS_20180 2555592 2556242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 protein_id gnl|my_center|LOCUS_20180 2556411 2556340 gene locus_tag LOCUS_t00200 2556411 2556340 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2558485 2556587 gene locus_tag LOCUS_20190 gene rpsA 2558485 2556587 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_20190 2559194 2558694 gene locus_tag LOCUS_20200 2559194 2558694 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_20200 2560069 2559284 gene locus_tag LOCUS_20210 2560069 2559284 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_20210 2560577 2560209 gene locus_tag LOCUS_20220 gene smpB 2560577 2560209 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_20220 2561554 2561336 gene locus_tag LOCUS_20230 2561554 2561336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2562083 2561874 gene locus_tag LOCUS_20240 2562083 2561874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2562165 2562320 gene locus_tag LOCUS_20250 2562165 2562320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2562560 2563618 gene locus_tag LOCUS_20260 2562560 2563618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2566730 2563785 gene locus_tag LOCUS_20270 2566730 2563785 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_20270 2567014 2567541 gene locus_tag LOCUS_20280 2567014 2567541 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_20280 2568235 2567591 gene locus_tag LOCUS_20290 2568235 2567591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2570908 2568269 gene locus_tag LOCUS_20300 2570908 2568269 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_20300 2572074 2571043 gene locus_tag LOCUS_20310 2572074 2571043 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_20310 2572226 2573032 gene locus_tag LOCUS_20320 2572226 2573032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2573966 2573067 gene locus_tag LOCUS_20330 gene xerD 2573966 2573067 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_20330 2574133 2573969 gene locus_tag LOCUS_20340 2574133 2573969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2574132 2574587 gene locus_tag LOCUS_20350 gene aroQ 2574132 2574587 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_20350 2574642 2575721 gene locus_tag LOCUS_20360 gene serC 2574642 2575721 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_20360 2575763 2576332 gene locus_tag LOCUS_20370 2575763 2576332 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_20370 2576537 2577001 gene locus_tag LOCUS_20380 gene rnhA 2576537 2577001 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_20380 2577010 2577723 gene locus_tag LOCUS_20390 2577010 2577723 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707393.1 protein_id gnl|my_center|LOCUS_20390 2579060 2577720 gene locus_tag LOCUS_20400 2579060 2577720 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_20400 2579427 2579804 gene locus_tag LOCUS_20410 gene cdd 2579427 2579804 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20410 2580236 2579835 gene locus_tag LOCUS_20420 2580236 2579835 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909757.1 protein_id gnl|my_center|LOCUS_20420 2581074 2580328 gene locus_tag LOCUS_20430 2581074 2580328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2581852 2581181 gene locus_tag LOCUS_20440 2581852 2581181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2582607 2581876 gene locus_tag LOCUS_20450 gene ubiE 2582607 2581876 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_20450 2584403 2582811 gene locus_tag LOCUS_20460 2584403 2582811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2584846 2585478 gene locus_tag LOCUS_20470 gene yihA 2584846 2585478 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_20470 2585544 2585948 gene locus_tag LOCUS_20480 2585544 2585948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2585964 2586443 gene locus_tag LOCUS_20490 2585964 2586443 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_20490 2586553 2587815 gene locus_tag LOCUS_20500 2586553 2587815 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_20500 2588271 2589404 gene locus_tag LOCUS_20510 2588271 2589404 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_20510 2589383 2590324 gene locus_tag LOCUS_20520 gene rsgA 2589383 2590324 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_20520 2590495 2591196 gene locus_tag LOCUS_20530 2590495 2591196 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 protein_id gnl|my_center|LOCUS_20530 2591865 2591227 gene locus_tag LOCUS_20540 2591865 2591227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2591978 2592439 gene locus_tag LOCUS_20550 2591978 2592439 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_20550 2593332 2592562 gene locus_tag LOCUS_20560 2593332 2592562 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_20560 2595201 2593675 gene locus_tag LOCUS_20570 2595201 2593675 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_20570 2596561 2595464 gene locus_tag LOCUS_20580 2596561 2595464 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_20580 2597693 2596716 gene locus_tag LOCUS_20590 2597693 2596716 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963293.1 protein_id gnl|my_center|LOCUS_20590 2599574 2597931 gene locus_tag LOCUS_20600 2599574 2597931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2600534 2599599 gene locus_tag LOCUS_20610 2600534 2599599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2601489 2600563 gene locus_tag LOCUS_20620 2601489 2600563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2602646 2601486 gene locus_tag LOCUS_20630 gene wzxE 2602646 2601486 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176202.1 protein_id gnl|my_center|LOCUS_20630 2603729 2602773 gene locus_tag LOCUS_20640 2603729 2602773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2604160 2603732 gene locus_tag LOCUS_20650 2604160 2603732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2604317 2605426 gene locus_tag LOCUS_20660 2604317 2605426 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_20660 2605628 2606218 gene locus_tag LOCUS_20670 2605628 2606218 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_20670 2606312 2607445 gene locus_tag LOCUS_20680 gene corA 2606312 2607445 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_20680 2610180 2607457 gene locus_tag LOCUS_20690 2610180 2607457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2610447 2610896 gene locus_tag LOCUS_20700 gene dtd 2610447 2610896 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_20700 2611130 2611456 gene locus_tag LOCUS_20710 2611130 2611456 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_20710 2612227 2611496 gene locus_tag LOCUS_20720 2612227 2611496 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_20720 2613402 2612308 gene locus_tag LOCUS_20730 gene gcvT 2613402 2612308 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_20730 2613681 2615294 gene locus_tag LOCUS_20740 2613681 2615294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2615341 2615766 gene locus_tag LOCUS_20750 2615341 2615766 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_20750 2616738 2616172 gene locus_tag LOCUS_20760 2616738 2616172 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_20760 2616984 2617298 gene locus_tag LOCUS_20770 2616984 2617298 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545871.1 protein_id gnl|my_center|LOCUS_20770 2617306 2618886 gene locus_tag LOCUS_20780 gene actP 2617306 2618886 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546484.1 protein_id gnl|my_center|LOCUS_20780 2619154 2619639 gene locus_tag LOCUS_20790 2619154 2619639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2620353 2621162 gene locus_tag LOCUS_20800 2620353 2621162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20800 2622219 2624117 gene locus_tag LOCUS_20810 gene acs 2622219 2624117 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_20810 2624447 2624689 gene locus_tag LOCUS_20820 2624447 2624689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2624821 2625474 gene locus_tag LOCUS_20830 2624821 2625474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2625851 2626609 gene locus_tag LOCUS_20840 2625851 2626609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2626596 2627237 gene locus_tag LOCUS_20850 gene degU 2626596 2627237 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_20850 2629030 2627300 gene locus_tag LOCUS_20860 2629030 2627300 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_20860 2630526 2629312 gene locus_tag LOCUS_20870 2630526 2629312 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_20870 2630605 2631303 gene locus_tag LOCUS_20880 2630605 2631303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2631364 2632182 gene locus_tag LOCUS_20890 2631364 2632182 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395337.1 protein_id gnl|my_center|LOCUS_20890 2633729 2632515 gene locus_tag LOCUS_20900 2633729 2632515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_20900 2634133 2635065 gene locus_tag LOCUS_20910 gene fmt 2634133 2635065 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_20910 2635264 2635761 gene locus_tag LOCUS_20920 2635264 2635761 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769725.1 protein_id gnl|my_center|LOCUS_20920 2636386 2636835 gene locus_tag LOCUS_20930 2636386 2636835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2636886 2637725 gene locus_tag LOCUS_20940 2636886 2637725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2641246 2637833 gene locus_tag LOCUS_20950 2641246 2637833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2642016 2641216 gene locus_tag LOCUS_20960 2642016 2641216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2642849 2641929 gene locus_tag LOCUS_20970 2642849 2641929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2643966 2642866 gene locus_tag LOCUS_20980 2643966 2642866 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_20980 2644495 2644836 gene locus_tag LOCUS_20990 2644495 2644836 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_20990 2644833 2647397 gene locus_tag LOCUS_21000 2644833 2647397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2647679 2649238 gene locus_tag LOCUS_21010 2647679 2649238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2650691 2649273 gene locus_tag LOCUS_21020 2650691 2649273 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_21020 2651299 2650898 gene locus_tag LOCUS_21030 gene mce 2651299 2650898 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_21030 2651414 2652577 gene locus_tag LOCUS_21040 2651414 2652577 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_21040 2653505 2652693 gene locus_tag LOCUS_21050 2653505 2652693 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928819.1 protein_id gnl|my_center|LOCUS_21050 2654709 2653906 gene locus_tag LOCUS_21060 2654709 2653906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2654835 2655233 gene locus_tag LOCUS_21070 2654835 2655233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2655760 2655293 gene locus_tag LOCUS_21080 2655760 2655293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2656106 2657722 gene locus_tag LOCUS_21090 2656106 2657722 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_21090 2657803 2658645 gene locus_tag LOCUS_21100 2657803 2658645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2659274 2659122 gene locus_tag LOCUS_21110 2659274 2659122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2659650 2660540 gene locus_tag LOCUS_21120 2659650 2660540 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_21120 2661509 2660694 gene locus_tag LOCUS_21130 2661509 2660694 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_21130 2661563 2662699 gene locus_tag LOCUS_21140 2661563 2662699 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257992.1 protein_id gnl|my_center|LOCUS_21140 2662788 2663789 gene locus_tag LOCUS_21150 2662788 2663789 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_21150 2664001 2664657 gene locus_tag LOCUS_21160 2664001 2664657 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_21160 2664686 2666572 gene locus_tag LOCUS_21170 2664686 2666572 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962257.1 protein_id gnl|my_center|LOCUS_21170 2666718 2667290 gene locus_tag LOCUS_21180 2666718 2667290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2667305 2668690 gene locus_tag LOCUS_21190 gene mnmE 2667305 2668690 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_21190 2669323 2668952 gene locus_tag LOCUS_21200 2669323 2668952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2670570 2671745 gene locus_tag LOCUS_21210 2670570 2671745 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_21210 2671751 2674948 gene locus_tag LOCUS_21220 2671751 2674948 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_21220 2674983 2676398 gene locus_tag LOCUS_21230 2674983 2676398 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_21230 2676841 2677149 gene locus_tag LOCUS_21240 2676841 2677149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2678541 2677225 gene locus_tag LOCUS_21250 gene ltrA 2678541 2677225 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_21250 2679431 2680279 gene locus_tag LOCUS_21260 2679431 2680279 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_21260 2680755 2680408 gene locus_tag LOCUS_21270 2680755 2680408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2681156 2681566 gene locus_tag LOCUS_21280 2681156 2681566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2681728 2682165 gene locus_tag LOCUS_21290 2681728 2682165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2682800 2683831 gene locus_tag LOCUS_21300 2682800 2683831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 2683822 2684205 gene locus_tag LOCUS_21310 2683822 2684205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21310 2684267 2685928 gene locus_tag LOCUS_21320 2684267 2685928 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_21320 2686735 2686475 gene locus_tag LOCUS_21330 2686735 2686475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2687081 2686854 gene locus_tag LOCUS_21340 2687081 2686854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2687383 2687192 gene locus_tag LOCUS_21350 2687383 2687192 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_21350 2687904 2688542 gene locus_tag LOCUS_21360 2687904 2688542 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210395.1 protein_id gnl|my_center|LOCUS_21360 2688705 2690144 gene locus_tag LOCUS_21370 2688705 2690144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2690436 2691989 gene locus_tag LOCUS_21380 2690436 2691989 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 protein_id gnl|my_center|LOCUS_21380 2692111 2693094 gene locus_tag LOCUS_21390 2692111 2693094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2693105 2693875 gene locus_tag LOCUS_21400 2693105 2693875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2695266 2694238 gene locus_tag LOCUS_21410 2695266 2694238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2695570 2696433 gene locus_tag LOCUS_21420 2695570 2696433 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461658.1 protein_id gnl|my_center|LOCUS_21420 2697220 2700258 gene locus_tag LOCUS_21430 2697220 2700258 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_21430 2700245 2701804 gene locus_tag LOCUS_21440 2700245 2701804 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_21440 2701827 2703248 gene locus_tag LOCUS_21450 2701827 2703248 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_21450 2704351 2703401 gene locus_tag LOCUS_21460 2704351 2703401 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002415541.1 protein_id gnl|my_center|LOCUS_21460 2705441 2704623 gene locus_tag LOCUS_21470 2705441 2704623 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_21470 2705734 2705438 gene locus_tag LOCUS_21480 2705734 2705438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2706069 2705773 gene locus_tag LOCUS_21490 2706069 2705773 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_21490 2706360 2706193 gene locus_tag LOCUS_21500 2706360 2706193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2706631 2707623 gene locus_tag LOCUS_21510 2706631 2707623 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_21510 2709738 2707765 gene locus_tag LOCUS_21520 2709738 2707765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2711752 2710208 gene locus_tag LOCUS_21530 2711752 2710208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2713771 2712161 gene locus_tag LOCUS_21540 2713771 2712161 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_21540 2716983 2713795 gene locus_tag LOCUS_21550 2716983 2713795 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714627.1 protein_id gnl|my_center|LOCUS_21550 2718805 2717486 gene locus_tag LOCUS_21560 2718805 2717486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2719650 2718802 gene locus_tag LOCUS_21570 2719650 2718802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21570 2721518 2719779 gene locus_tag LOCUS_21580 2721518 2719779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21580 2722048 2721527 gene locus_tag LOCUS_21590 2722048 2721527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21590 2723242 2723619 gene locus_tag LOCUS_21600 2723242 2723619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2724384 2723821 gene locus_tag LOCUS_21610 2724384 2723821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2724920 2724663 gene locus_tag LOCUS_21620 2724920 2724663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2726495 2725086 gene locus_tag LOCUS_21630 2726495 2725086 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_21630 2726997 2729144 gene locus_tag LOCUS_21640 2726997 2729144 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303083.1 protein_id gnl|my_center|LOCUS_21640 2729263 2729610 gene locus_tag LOCUS_21650 2729263 2729610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2729693 2730235 gene locus_tag LOCUS_21660 2729693 2730235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2730342 2730647 gene locus_tag LOCUS_21670 2730342 2730647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2730650 2730892 gene locus_tag LOCUS_21680 2730650 2730892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2731719 2732096 gene locus_tag LOCUS_21690 2731719 2732096 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_21690 2732891 2732256 gene locus_tag LOCUS_21700 2732891 2732256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2733336 2733052 gene locus_tag LOCUS_21710 2733336 2733052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2733636 2733343 gene locus_tag LOCUS_21720 2733636 2733343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2734210 2735052 gene locus_tag LOCUS_21730 2734210 2735052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2735850 2735206 gene locus_tag LOCUS_21740 2735850 2735206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2736352 2735822 gene locus_tag LOCUS_21750 2736352 2735822 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_21750 2737079 2736582 gene locus_tag LOCUS_21760 2737079 2736582 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948566.1 protein_id gnl|my_center|LOCUS_21760 2737668 2737853 gene locus_tag LOCUS_21770 2737668 2737853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2738045 2739187 gene locus_tag LOCUS_21780 2738045 2739187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2739262 2739744 gene locus_tag LOCUS_21790 2739262 2739744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2741275 2739875 gene locus_tag LOCUS_21800 2741275 2739875 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_21800 2742506 2741829 gene locus_tag LOCUS_21810 2742506 2741829 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_21810 2743691 2742741 gene locus_tag LOCUS_21820 2743691 2742741 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_21820 2744288 2745685 gene locus_tag LOCUS_21830 2744288 2745685 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202983.1 protein_id gnl|my_center|LOCUS_21830 2745973 2746923 gene locus_tag LOCUS_21840 2745973 2746923 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203335.1 protein_id gnl|my_center|LOCUS_21840 2747157 2750441 gene locus_tag LOCUS_21850 2747157 2750441 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_21850 2750486 2751214 gene locus_tag LOCUS_21860 2750486 2751214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2754654 2751469 gene locus_tag LOCUS_21870 2754654 2751469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2755629 2755814 gene locus_tag LOCUS_21880 2755629 2755814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2755961 2756332 gene locus_tag LOCUS_21890 2755961 2756332 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_21890 2756904 2756533 gene locus_tag LOCUS_21900 2756904 2756533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2758207 2758133 gene locus_tag LOCUS_t00210 2758207 2758133 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2758372 2758298 gene locus_tag LOCUS_t00220 2758372 2758298 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2758565 2758477 gene locus_tag LOCUS_t00230 2758565 2758477 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2758896 2759867 gene locus_tag LOCUS_21910 2758896 2759867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2759864 2760829 gene locus_tag LOCUS_21920 2759864 2760829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2760927 2762111 gene locus_tag LOCUS_21930 2760927 2762111 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_21930 2762475 2763506 gene locus_tag LOCUS_21940 2762475 2763506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21940 2763617 2763880 gene locus_tag LOCUS_21950 2763617 2763880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21950 2764299 2765171 gene locus_tag LOCUS_21960 2764299 2765171 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_21960 2766471 2765272 gene locus_tag LOCUS_21970 2766471 2765272 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_21970 2766871 2767887 gene locus_tag LOCUS_21980 gene murB 2766871 2767887 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 protein_id gnl|my_center|LOCUS_21980 2770423 2768027 gene locus_tag LOCUS_21990 2770423 2768027 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_21990 2770583 2771038 gene locus_tag LOCUS_22000 2770583 2771038 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175289.1 protein_id gnl|my_center|LOCUS_22000 2771468 2772634 gene locus_tag LOCUS_22010 2771468 2772634 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_22010 2772834 2773298 gene locus_tag LOCUS_22020 2772834 2773298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22020 2774824 2773856 gene locus_tag LOCUS_22030 2774824 2773856 CDS product IS5-like element ISSod12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074424.1 protein_id gnl|my_center|LOCUS_22030 2775941 2774928 gene locus_tag LOCUS_22040 2775941 2774928 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_22040 2776111 2776671 gene locus_tag LOCUS_22050 2776111 2776671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2777307 2778425 gene locus_tag LOCUS_22060 2777307 2778425 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_22060 2778468 2780534 gene locus_tag LOCUS_22070 2778468 2780534 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338288.1 protein_id gnl|my_center|LOCUS_22070 2780531 2781538 gene locus_tag LOCUS_22080 2780531 2781538 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975138.1 protein_id gnl|my_center|LOCUS_22080 2781743 2782783 gene locus_tag LOCUS_22090 2781743 2782783 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456580.1 protein_id gnl|my_center|LOCUS_22090 2782787 2783890 gene locus_tag LOCUS_22100 2782787 2783890 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533195.1 protein_id gnl|my_center|LOCUS_22100 2783910 2785049 gene locus_tag LOCUS_22110 2783910 2785049 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338286.1 protein_id gnl|my_center|LOCUS_22110 2785039 2786148 gene locus_tag LOCUS_22120 2785039 2786148 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533197.1 protein_id gnl|my_center|LOCUS_22120 2786145 2787227 gene locus_tag LOCUS_22130 2786145 2787227 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338284.1 protein_id gnl|my_center|LOCUS_22130 2787493 2788311 gene locus_tag LOCUS_22140 2787493 2788311 CDS product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975130.1 protein_id gnl|my_center|LOCUS_22140 2788457 2789920 gene locus_tag LOCUS_22150 2788457 2789920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2792413 2789993 gene locus_tag LOCUS_22160 2792413 2789993 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_22160 2792647 2793390 gene locus_tag LOCUS_22170 2792647 2793390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2793631 2794755 gene locus_tag LOCUS_22180 gene ald 2793631 2794755 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107857.1 protein_id gnl|my_center|LOCUS_22180 2794889 2796745 gene locus_tag LOCUS_22190 2794889 2796745 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_22190 2797312 2796842 gene locus_tag LOCUS_22200 2797312 2796842 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_22200 2797477 2798250 gene locus_tag LOCUS_22210 2797477 2798250 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_22210 2798243 2799901 gene locus_tag LOCUS_22220 2798243 2799901 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_22220 2801254 2799944 gene locus_tag LOCUS_22230 2801254 2799944 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_22230 2801463 2802707 gene locus_tag LOCUS_22240 2801463 2802707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2802718 2802891 gene locus_tag LOCUS_22250 2802718 2802891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2802891 2803613 gene locus_tag LOCUS_22260 2802891 2803613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2804033 2804575 gene locus_tag LOCUS_22270 2804033 2804575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2805879 2804668 gene locus_tag LOCUS_22280 2805879 2804668 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256441.1 protein_id gnl|my_center|LOCUS_22280 2806197 2807486 gene locus_tag LOCUS_22290 2806197 2807486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2808183 2814605 gene locus_tag LOCUS_22300 2808183 2814605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2814613 2815611 gene locus_tag LOCUS_22310 2814613 2815611 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_22310 2815981 2817105 gene locus_tag LOCUS_22320 2815981 2817105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2817362 2817556 gene locus_tag LOCUS_22330 2817362 2817556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2819683 2817776 gene locus_tag LOCUS_22340 2819683 2817776 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545360.1 protein_id gnl|my_center|LOCUS_22340 2820396 2819680 gene locus_tag LOCUS_22350 2820396 2819680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2822506 2820809 gene locus_tag LOCUS_22360 2822506 2820809 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_22360 2824216 2822711 gene locus_tag LOCUS_22370 gene araA 2824216 2822711 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705775.1 protein_id gnl|my_center|LOCUS_22370 2824951 2824445 gene locus_tag LOCUS_22380 2824951 2824445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2825764 2825066 gene locus_tag LOCUS_22390 2825764 2825066 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_22390 2827563 2825785 gene locus_tag LOCUS_22400 2827563 2825785 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460432.1 protein_id gnl|my_center|LOCUS_22400 2827882 2827661 gene locus_tag LOCUS_22410 2827882 2827661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2828801 2828094 gene locus_tag LOCUS_22420 2828801 2828094 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_22420 2830357 2829152 gene locus_tag LOCUS_22430 2830357 2829152 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770127.1 protein_id gnl|my_center|LOCUS_22430 2831414 2830437 gene locus_tag LOCUS_22440 2831414 2830437 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_22440 2833754 2831907 gene locus_tag LOCUS_22450 2833754 2831907 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_22450 2835475 2833931 gene locus_tag LOCUS_22460 2835475 2833931 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_22460 2835835 2836167 gene locus_tag LOCUS_22470 2835835 2836167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2836321 2836698 gene locus_tag LOCUS_22480 2836321 2836698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22480 2837094 2836921 gene locus_tag LOCUS_22490 2837094 2836921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2837961 2840984 gene locus_tag LOCUS_22500 2837961 2840984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2841849 2841070 gene locus_tag LOCUS_22510 2841849 2841070 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_22510 2842861 2841935 gene locus_tag LOCUS_22520 2842861 2841935 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_22520 2844134 2842989 gene locus_tag LOCUS_22530 2844134 2842989 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703309.1 protein_id gnl|my_center|LOCUS_22530 2845303 2844368 gene locus_tag LOCUS_22540 2845303 2844368 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_22540 2845785 2845540 gene locus_tag LOCUS_22550 2845785 2845540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2846418 2845915 gene locus_tag LOCUS_22560 2846418 2845915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2846653 2848173 gene locus_tag LOCUS_22570 2846653 2848173 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_22570 2849082 2848393 gene locus_tag LOCUS_22580 2849082 2848393 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 protein_id gnl|my_center|LOCUS_22580 2849859 2849455 gene locus_tag LOCUS_22590 2849859 2849455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2849929 2850903 gene locus_tag LOCUS_22600 2849929 2850903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2851514 2851071 gene locus_tag LOCUS_22610 2851514 2851071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2851834 2851598 gene locus_tag LOCUS_22620 2851834 2851598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2852411 2852001 gene locus_tag LOCUS_22630 2852411 2852001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2854002 2852569 gene locus_tag LOCUS_22640 2854002 2852569 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_22640 2855739 2854558 gene locus_tag LOCUS_22650 2855739 2854558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2856291 2857577 gene locus_tag LOCUS_22660 2856291 2857577 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_22660 2859744 2857819 gene locus_tag LOCUS_22670 2859744 2857819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2860407 2859754 gene locus_tag LOCUS_22680 2860407 2859754 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_22680 2861513 2860626 gene locus_tag LOCUS_22690 gene folD 2861513 2860626 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_22690 2861924 2861562 gene locus_tag LOCUS_22700 2861924 2861562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2862151 2861921 gene locus_tag LOCUS_22710 2862151 2861921 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_22710 2864059 2862272 gene locus_tag LOCUS_22720 gene lepA 2864059 2862272 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964332.1 protein_id gnl|my_center|LOCUS_22720 2865891 2864284 gene locus_tag LOCUS_22730 gene treA 2865891 2864284 CDS product alpha,alpha-trehalase TreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205444.1 protein_id gnl|my_center|LOCUS_22730 2866101 2869508 gene locus_tag LOCUS_22740 2866101 2869508 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143960588.1 protein_id gnl|my_center|LOCUS_22740 2870399 2869944 gene locus_tag LOCUS_22750 2870399 2869944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2871108 2870815 gene locus_tag LOCUS_22760 2871108 2870815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2872945 2871113 gene locus_tag LOCUS_22770 2872945 2871113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2873848 2873060 gene locus_tag LOCUS_22780 2873848 2873060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2876630 2873925 gene locus_tag LOCUS_22790 2876630 2873925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2877073 2878266 gene locus_tag LOCUS_22800 2877073 2878266 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763375.1 protein_id gnl|my_center|LOCUS_22800 2878390 2878734 gene locus_tag LOCUS_22810 2878390 2878734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2878816 2879181 gene locus_tag LOCUS_22820 2878816 2879181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2879491 2879709 gene locus_tag LOCUS_22830 2879491 2879709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2879886 2880722 gene locus_tag LOCUS_22840 2879886 2880722 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_22840 2881068 2881805 gene locus_tag LOCUS_22850 2881068 2881805 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975902.1 protein_id gnl|my_center|LOCUS_22850 2883185 2881980 gene locus_tag LOCUS_22860 2883185 2881980 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_22860 2884431 2883241 gene locus_tag LOCUS_22870 2884431 2883241 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218312883.1 protein_id gnl|my_center|LOCUS_22870 2885804 2884632 gene locus_tag LOCUS_22880 2885804 2884632 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_22880 2887881 2885932 gene locus_tag LOCUS_22890 gene dnaG 2887881 2885932 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964171.1 protein_id gnl|my_center|LOCUS_22890 2888546 2891641 gene locus_tag LOCUS_22900 2888546 2891641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2891981 2893084 gene locus_tag LOCUS_22910 2891981 2893084 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_22910 2893088 2893357 gene locus_tag LOCUS_22920 2893088 2893357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2893634 2894905 gene locus_tag LOCUS_22930 gene fahA 2893634 2894905 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_22930 2895062 2895673 gene locus_tag LOCUS_22940 gene pncA 2895062 2895673 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870185.1 protein_id gnl|my_center|LOCUS_22940 2896685 2895798 gene locus_tag LOCUS_22950 2896685 2895798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2897033 2897575 gene locus_tag LOCUS_22960 2897033 2897575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2897903 2897565 gene locus_tag LOCUS_22970 2897903 2897565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2899480 2897924 gene locus_tag LOCUS_22980 2899480 2897924 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22980 2899928 2901118 gene locus_tag LOCUS_22990 2899928 2901118 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393523.1 protein_id gnl|my_center|LOCUS_22990 2901604 2903181 gene locus_tag LOCUS_23000 2901604 2903181 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_23000 2903345 2903417 gene locus_tag LOCUS_t00240 2903345 2903417 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2905616 2904492 gene locus_tag LOCUS_23010 2905616 2904492 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953461.1 protein_id gnl|my_center|LOCUS_23010 2907176 2906565 gene locus_tag LOCUS_23020 2907176 2906565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2908042 2907659 gene locus_tag LOCUS_23030 2908042 2907659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2908237 2909112 gene locus_tag LOCUS_23040 2908237 2909112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2909273 2910919 gene locus_tag LOCUS_23050 2909273 2910919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2911012 2911833 gene locus_tag LOCUS_23060 2911012 2911833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2911920 2912948 gene locus_tag LOCUS_23070 2911920 2912948 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_23070 2913490 2913035 gene locus_tag LOCUS_23080 2913490 2913035 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323316.1 protein_id gnl|my_center|LOCUS_23080 2919212 2913567 gene locus_tag LOCUS_23090 2919212 2913567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2920909 2920355 gene locus_tag LOCUS_23100 2920909 2920355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 2922022 2920922 gene locus_tag LOCUS_23110 2922022 2920922 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727112.1 protein_id gnl|my_center|LOCUS_23110 2924211 2922628 gene locus_tag LOCUS_23120 2924211 2922628 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_23120 2924907 2924674 gene locus_tag LOCUS_23130 2924907 2924674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2925375 2924914 gene locus_tag LOCUS_23140 gene tadA 2925375 2924914 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_23140 2926425 2925511 gene locus_tag LOCUS_23150 2926425 2925511 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111553.1 protein_id gnl|my_center|LOCUS_23150 2927974 2926943 gene locus_tag LOCUS_23160 2927974 2926943 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921628.1 protein_id gnl|my_center|LOCUS_23160 2928824 2928204 gene locus_tag LOCUS_23170 2928824 2928204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2930047 2929067 gene locus_tag LOCUS_23180 2930047 2929067 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448438.1 protein_id gnl|my_center|LOCUS_23180 2930288 2930731 gene locus_tag LOCUS_23190 2930288 2930731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2930856 2931287 gene locus_tag LOCUS_23200 2930856 2931287 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_23200 2931356 2931898 gene locus_tag LOCUS_23210 2931356 2931898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2932082 2932513 gene locus_tag LOCUS_23220 2932082 2932513 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_23220 2932833 2933171 gene locus_tag LOCUS_23230 2932833 2933171 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_23230 2933273 2933680 gene locus_tag LOCUS_23240 2933273 2933680 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_23240 2933796 2933614 gene locus_tag LOCUS_23250 2933796 2933614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2933846 2934202 gene locus_tag LOCUS_23260 2933846 2934202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2934260 2934484 gene locus_tag LOCUS_23270 2934260 2934484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2934543 2934932 gene locus_tag LOCUS_23280 2934543 2934932 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528007.1 protein_id gnl|my_center|LOCUS_23280 2935296 2935847 gene locus_tag LOCUS_23290 2935296 2935847 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_23290 2935995 2936432 gene locus_tag LOCUS_23300 2935995 2936432 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_23300 2936829 2936452 gene locus_tag LOCUS_23310 2936829 2936452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 2939595 2936971 gene locus_tag LOCUS_23320 2939595 2936971 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085500226.1 protein_id gnl|my_center|LOCUS_23320 2940109 2942382 gene locus_tag LOCUS_23330 2940109 2942382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2942592 2943878 gene locus_tag LOCUS_23340 2942592 2943878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_23340 2944031 2946346 gene locus_tag LOCUS_23350 2944031 2946346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2947600 2947977 gene locus_tag LOCUS_23360 2947600 2947977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2948021 2948635 gene locus_tag LOCUS_23370 2948021 2948635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2948939 2949805 gene locus_tag LOCUS_23380 2948939 2949805 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267584.1 protein_id gnl|my_center|LOCUS_23380 2949921 2950841 gene locus_tag LOCUS_23390 2949921 2950841 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_23390 2951421 2951837 gene locus_tag LOCUS_23400 2951421 2951837 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_23400 2953505 2952171 gene locus_tag LOCUS_23410 2953505 2952171 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267368.1 protein_id gnl|my_center|LOCUS_23410 2954366 2953581 gene locus_tag LOCUS_23420 2954366 2953581 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_23420 2955514 2954456 gene locus_tag LOCUS_23430 2955514 2954456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2958354 2955787 gene locus_tag LOCUS_23440 2958354 2955787 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368537.1 protein_id gnl|my_center|LOCUS_23440 2959967 2958579 gene locus_tag LOCUS_23450 2959967 2958579 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_23450 2961502 2960483 gene locus_tag LOCUS_23460 2961502 2960483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_23460 2961887 2962993 gene locus_tag LOCUS_23470 2961887 2962993 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920312.1 protein_id gnl|my_center|LOCUS_23470 2963467 2963285 gene locus_tag LOCUS_23480 2963467 2963285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2964931 2963594 gene locus_tag LOCUS_23490 2964931 2963594 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_23490 2967916 2965445 gene locus_tag LOCUS_23500 2967916 2965445 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_23500 2968531 2969280 gene locus_tag LOCUS_23510 2968531 2969280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2969489 2970565 gene locus_tag LOCUS_23520 2969489 2970565 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942021.1 protein_id gnl|my_center|LOCUS_23520 2971295 2970636 gene locus_tag LOCUS_23530 2971295 2970636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2971930 2971397 gene locus_tag LOCUS_23540 gene purE 2971930 2971397 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_23540 2973057 2971927 gene locus_tag LOCUS_23550 2973057 2971927 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_23550 2973400 2974017 gene locus_tag LOCUS_23560 2973400 2974017 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302344.1 protein_id gnl|my_center|LOCUS_23560 2974349 2975404 gene locus_tag LOCUS_23570 gene hemE 2974349 2975404 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404447.1 protein_id gnl|my_center|LOCUS_23570 2976898 2975978 gene locus_tag LOCUS_23580 2976898 2975978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2978727 2977093 gene locus_tag LOCUS_23590 2978727 2977093 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_23590 2979906 2978893 gene locus_tag LOCUS_23600 2979906 2978893 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_23600 2980622 2979927 gene locus_tag LOCUS_23610 2980622 2979927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 2980834 2983440 gene locus_tag LOCUS_23620 2980834 2983440 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_23620 2983612 2984430 gene locus_tag LOCUS_23630 gene panB 2983612 2984430 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_23630 2984684 2985394 gene locus_tag LOCUS_23640 2984684 2985394 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_23640 2985638 2986276 gene locus_tag LOCUS_23650 2985638 2986276 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_23650 2986398 2987894 gene locus_tag LOCUS_23660 2986398 2987894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2988344 2988877 gene locus_tag LOCUS_23670 2988344 2988877 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763025.1 protein_id gnl|my_center|LOCUS_23670 2988893 2989462 gene locus_tag LOCUS_23680 gene rimM 2988893 2989462 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_23680 2989452 2990126 gene locus_tag LOCUS_23690 gene trmD 2989452 2990126 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_23690 2990344 2990709 gene locus_tag LOCUS_23700 gene rplS 2990344 2990709 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870154.1 protein_id gnl|my_center|LOCUS_23700 2991045 2991704 gene locus_tag LOCUS_23710 2991045 2991704 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155666.1 protein_id gnl|my_center|LOCUS_23710 2993921 2991792 gene locus_tag LOCUS_23720 2993921 2991792 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_23720 2994733 2993912 gene locus_tag LOCUS_23730 2994733 2993912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2994968 2995186 gene locus_tag LOCUS_23740 gene yidD 2994968 2995186 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_23740 2996345 2995485 gene locus_tag LOCUS_23750 gene lgt 2996345 2995485 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_23750 2998324 2996429 gene locus_tag LOCUS_23760 gene nadE 2998324 2996429 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_23760 2999470 2998748 gene locus_tag LOCUS_23770 2999470 2998748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3000734 2999487 gene locus_tag LOCUS_23780 gene fabF 3000734 2999487 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_23780 3001040 3000804 gene locus_tag LOCUS_23790 3001040 3000804 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_23790 3001216 3001016 gene locus_tag LOCUS_23800 3001216 3001016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3001215 3001643 gene locus_tag LOCUS_23810 3001215 3001643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 3001645 3003075 gene locus_tag LOCUS_23820 gene pyk 3001645 3003075 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_23820 3003525 3003265 gene locus_tag LOCUS_23830 gene rpsT 3003525 3003265 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963520.1 protein_id gnl|my_center|LOCUS_23830 3003858 3004769 gene locus_tag LOCUS_23840 3003858 3004769 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_23840 3006549 3005173 gene locus_tag LOCUS_23850 3006549 3005173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_23850 3008586 3006850 gene locus_tag LOCUS_23860 3008586 3006850 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_23860 3011015 3008694 gene locus_tag LOCUS_23870 3011015 3008694 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_23870 3011917 3011234 gene locus_tag LOCUS_23880 gene pgmB 3011917 3011234 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_23880 3013880 3012015 gene locus_tag LOCUS_23890 3013880 3012015 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_23890 3016685 3013929 gene locus_tag LOCUS_23900 3016685 3013929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3018059 3016968 gene locus_tag LOCUS_23910 3018059 3016968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3019725 3018133 gene locus_tag LOCUS_23920 3019725 3018133 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_23920 3022720 3019745 gene locus_tag LOCUS_23930 3022720 3019745 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_23930 3023225 3023079 gene locus_tag LOCUS_23940 3023225 3023079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3024814 3023795 gene locus_tag LOCUS_23950 3024814 3023795 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_23950 3025483 3025091 gene locus_tag LOCUS_23960 3025483 3025091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3027340 3026384 gene locus_tag LOCUS_23970 3027340 3026384 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_23970 3027620 3028873 gene locus_tag LOCUS_23980 3027620 3028873 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_23980 3030109 3029054 gene locus_tag LOCUS_23990 3030109 3029054 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_23990 3031099 3033072 gene locus_tag LOCUS_24000 3031099 3033072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3033150 3034568 gene locus_tag LOCUS_24010 3033150 3034568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 3035344 3034916 gene locus_tag LOCUS_24020 3035344 3034916 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_24020 3036624 3035356 gene locus_tag LOCUS_24030 3036624 3035356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 3038009 3037029 gene locus_tag LOCUS_24040 3038009 3037029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3038186 3039247 gene locus_tag LOCUS_24050 gene sucD 3038186 3039247 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_24050 3039645 3040121 gene locus_tag LOCUS_24060 3039645 3040121 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_24060 3041907 3040330 gene locus_tag LOCUS_24070 3041907 3040330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3044336 3041907 gene locus_tag LOCUS_24080 3044336 3041907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3045132 3046802 gene locus_tag LOCUS_24090 3045132 3046802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3046763 3047842 gene locus_tag LOCUS_24100 3046763 3047842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3048076 3048549 gene locus_tag LOCUS_24110 3048076 3048549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3049653 3048700 gene locus_tag LOCUS_24120 gene corA 3049653 3048700 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_24120 3050184 3051644 gene locus_tag LOCUS_24130 3050184 3051644 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_24130 3051965 3051759 gene locus_tag LOCUS_24140 3051965 3051759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3052288 3052722 gene locus_tag LOCUS_24150 3052288 3052722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 3052914 3053660 gene locus_tag LOCUS_24160 gene cmoA 3052914 3053660 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655545.1 protein_id gnl|my_center|LOCUS_24160 3053670 3054392 gene locus_tag LOCUS_24170 3053670 3054392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 3054735 3055598 gene locus_tag LOCUS_24180 3054735 3055598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3055761 3055946 gene locus_tag LOCUS_24190 3055761 3055946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24190 3056458 3061677 gene locus_tag LOCUS_24200 3056458 3061677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 3062048 3064150 gene locus_tag LOCUS_24210 3062048 3064150 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766928.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24210 3065289 3064195 gene locus_tag LOCUS_24220 3065289 3064195 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_24220 3065972 3065403 gene locus_tag LOCUS_24230 3065972 3065403 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_24230 3067851 3066124 gene locus_tag LOCUS_24240 3067851 3066124 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_24240 3073024 3068588 gene locus_tag LOCUS_24250 3073024 3068588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3073075 3073377 gene locus_tag LOCUS_24260 3073075 3073377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 3077944 3073409 gene locus_tag LOCUS_24270 3077944 3073409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 3078346 3078828 gene locus_tag LOCUS_24280 3078346 3078828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 3080695 3079055 gene locus_tag LOCUS_24290 gene treF 3080695 3079055 CDS product alpha,alpha-trehalase TreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068421.1 protein_id gnl|my_center|LOCUS_24290 3081101 3081493 gene locus_tag LOCUS_24300 3081101 3081493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3097854 3081568 gene locus_tag LOCUS_24310 3097854 3081568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 3098690 3100054 gene locus_tag LOCUS_24320 3098690 3100054 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_24320 3102028 3100124 gene locus_tag LOCUS_24330 3102028 3100124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 3103192 3102428 gene locus_tag LOCUS_24340 3103192 3102428 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531783.1 protein_id gnl|my_center|LOCUS_24340 3105135 3103366 gene locus_tag LOCUS_24350 3105135 3103366 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 protein_id gnl|my_center|LOCUS_24350 3106184 3105567 gene locus_tag LOCUS_24360 3106184 3105567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 3106978 3106187 gene locus_tag LOCUS_24370 3106978 3106187 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761368.1 protein_id gnl|my_center|LOCUS_24370 3109564 3107123 gene locus_tag LOCUS_24380 3109564 3107123 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_24380 3110767 3109796 gene locus_tag LOCUS_24390 3110767 3109796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3111204 3110785 gene locus_tag LOCUS_24400 3111204 3110785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3111586 3112494 gene locus_tag LOCUS_24410 3111586 3112494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 3113263 3112619 gene locus_tag LOCUS_24420 gene can 3113263 3112619 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_24420 3114893 3113289 gene locus_tag LOCUS_24430 3114893 3113289 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_24430 3116352 3114976 gene locus_tag LOCUS_24440 3116352 3114976 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_24440 3117032 3116358 gene locus_tag LOCUS_24450 3117032 3116358 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_24450 3117986 3117267 gene locus_tag LOCUS_24460 3117986 3117267 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_24460 3118376 3119890 gene locus_tag LOCUS_24470 3118376 3119890 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_24470 3120270 3121604 gene locus_tag LOCUS_24480 gene xylA 3120270 3121604 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_24480 3121855 3123486 gene locus_tag LOCUS_24490 3121855 3123486 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_24490 3125295 3124684 gene locus_tag LOCUS_24500 3125295 3124684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24500 3126079 3125318 gene locus_tag LOCUS_24510 3126079 3125318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 3126786 3126109 gene locus_tag LOCUS_24520 3126786 3126109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3128164 3127748 gene locus_tag LOCUS_24530 3128164 3127748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 3128729 3128151 gene locus_tag LOCUS_24540 3128729 3128151 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099939.1 protein_id gnl|my_center|LOCUS_24540 3129247 3128840 gene locus_tag LOCUS_24550 3129247 3128840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 3130158 3129247 gene locus_tag LOCUS_24560 3130158 3129247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 3131302 3130247 gene locus_tag LOCUS_24570 3131302 3130247 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_24570 3132066 3131305 gene locus_tag LOCUS_24580 3132066 3131305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 protein_id gnl|my_center|LOCUS_24580 3133389 3132721 gene locus_tag LOCUS_24590 3133389 3132721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24590 3133823 3133296 gene locus_tag LOCUS_24600 3133823 3133296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24600 3135795 3134368 gene locus_tag LOCUS_24610 3135795 3134368 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_24610 3137484 3136171 gene locus_tag LOCUS_24620 3137484 3136171 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_24620 3137420 3137593 gene locus_tag LOCUS_24630 3137420 3137593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 3138211 3139890 gene locus_tag LOCUS_24640 3138211 3139890 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_24640 3139917 3140516 gene locus_tag LOCUS_24650 3139917 3140516 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_24650 3140960 3141415 gene locus_tag LOCUS_24660 3140960 3141415 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_24660 3144049 3142541 gene locus_tag LOCUS_24670 3144049 3142541 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_24670 3145029 3144577 gene locus_tag LOCUS_24680 gene msrB 3145029 3144577 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_24680 3145155 3146213 gene locus_tag LOCUS_24690 3145155 3146213 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_24690 3146210 3146899 gene locus_tag LOCUS_24700 3146210 3146899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3147376 3147675 gene locus_tag LOCUS_24710 3147376 3147675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3148820 3149209 gene locus_tag LOCUS_24720 3148820 3149209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 3149410 3151059 gene locus_tag LOCUS_24730 3149410 3151059 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_24730 3151776 3151126 gene locus_tag LOCUS_24740 3151776 3151126 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 protein_id gnl|my_center|LOCUS_24740 3152388 3152143 gene locus_tag LOCUS_24750 gene atpC 3152388 3152143 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_24750 3153981 3152476 gene locus_tag LOCUS_24760 gene atpD 3153981 3152476 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_24760 3154381 3154962 gene locus_tag LOCUS_24770 3154381 3154962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 3155106 3157331 gene locus_tag LOCUS_24780 gene purL 3155106 3157331 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_24780 3157415 3157488 gene locus_tag LOCUS_t00250 3157415 3157488 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3157660 3158586 gene locus_tag LOCUS_24790 3157660 3158586 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_24790 3158802 3159371 gene locus_tag LOCUS_24800 3158802 3159371 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_24800 3159516 3160163 gene locus_tag LOCUS_24810 gene pth 3159516 3160163 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_24810 3161048 3160551 gene locus_tag LOCUS_24820 3161048 3160551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 3162199 3161267 gene locus_tag LOCUS_24830 3162199 3161267 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922574.1 protein_id gnl|my_center|LOCUS_24830 3162395 3162841 gene locus_tag LOCUS_24840 3162395 3162841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 3164155 3162962 gene locus_tag LOCUS_24850 3164155 3162962 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_24850 3164928 3164152 gene locus_tag LOCUS_24860 gene pxpA 3164928 3164152 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_24860 3166529 3165522 gene locus_tag LOCUS_24870 gene pxpC 3166529 3165522 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234419.1 protein_id gnl|my_center|LOCUS_24870 3167265 3166519 gene locus_tag LOCUS_24880 gene pxpB 3167265 3166519 CDS product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 protein_id gnl|my_center|LOCUS_24880 3167574 3170081 gene locus_tag LOCUS_24890 3167574 3170081 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_24890 3170178 3170732 gene locus_tag LOCUS_24900 3170178 3170732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 3170834 3171277 gene locus_tag LOCUS_24910 3170834 3171277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3172442 3171579 gene locus_tag LOCUS_24920 3172442 3171579 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 protein_id gnl|my_center|LOCUS_24920 3172691 3173677 gene locus_tag LOCUS_24930 3172691 3173677 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_24930 3173803 3174096 gene locus_tag LOCUS_24940 3173803 3174096 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_24940 3174154 3174519 gene locus_tag LOCUS_24950 3174154 3174519 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390235.1 protein_id gnl|my_center|LOCUS_24950 3174557 3174772 gene locus_tag LOCUS_24960 3174557 3174772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3174886 3175770 gene locus_tag LOCUS_24970 3174886 3175770 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074468.1 protein_id gnl|my_center|LOCUS_24970 3175903 3176124 gene locus_tag LOCUS_24980 3175903 3176124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 3176162 3176455 gene locus_tag LOCUS_24990 3176162 3176455 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118081.1 protein_id gnl|my_center|LOCUS_24990 3176473 3177327 gene locus_tag LOCUS_25000 3176473 3177327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25000 3177377 3177583 gene locus_tag LOCUS_25010 3177377 3177583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 3178128 3178289 gene locus_tag LOCUS_25020 3178128 3178289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 3178860 3178273 gene locus_tag LOCUS_25030 3178860 3178273 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268606.1 protein_id gnl|my_center|LOCUS_25030 3179120 3178938 gene locus_tag LOCUS_25040 3179120 3178938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3179298 3180218 gene locus_tag LOCUS_25050 3179298 3180218 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198488.1 protein_id gnl|my_center|LOCUS_25050 3185016 3180778 gene locus_tag LOCUS_25060 3185016 3180778 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_25060 3187648 3185588 gene locus_tag LOCUS_25070 3187648 3185588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3192317 3188052 gene locus_tag LOCUS_25080 3192317 3188052 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_25080 3192976 3193155 gene locus_tag LOCUS_25090 3192976 3193155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25090 3193167 3193949 gene locus_tag LOCUS_25100 3193167 3193949 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25100 3194638 3195720 gene locus_tag LOCUS_25110 3194638 3195720 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_25110 3196950 3196081 gene locus_tag LOCUS_25120 3196950 3196081 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_25120 3197234 3199285 gene locus_tag LOCUS_25130 3197234 3199285 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_25130 3199368 3200027 gene locus_tag LOCUS_25140 3199368 3200027 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263627.1 protein_id gnl|my_center|LOCUS_25140 3200276 3201067 gene locus_tag LOCUS_25150 3200276 3201067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3201357 3202586 gene locus_tag LOCUS_25160 3201357 3202586 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_25160 3203038 3202823 gene locus_tag LOCUS_25170 3203038 3202823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 3203292 3203020 gene locus_tag LOCUS_25180 3203292 3203020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 3203500 3203913 gene locus_tag LOCUS_25190 3203500 3203913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25190 3204022 3204276 gene locus_tag LOCUS_25200 3204022 3204276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3207108 3204565 gene locus_tag LOCUS_25210 3207108 3204565 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_25210 3207306 3207797 gene locus_tag LOCUS_25220 3207306 3207797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 3208099 3208461 gene locus_tag LOCUS_25230 3208099 3208461 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_25230 3208783 3209217 gene locus_tag LOCUS_25240 3208783 3209217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3212247 3209305 gene locus_tag LOCUS_25250 3212247 3209305 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_25250 3212538 3213392 gene locus_tag LOCUS_25260 3212538 3213392 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_25260 3213376 3214152 gene locus_tag LOCUS_25270 3213376 3214152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3214168 3214569 gene locus_tag LOCUS_25280 3214168 3214569 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 protein_id gnl|my_center|LOCUS_25280 3214776 3215513 gene locus_tag LOCUS_25290 3214776 3215513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3215938 3215549 gene locus_tag LOCUS_25300 3215938 3215549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3216596 3216811 gene locus_tag LOCUS_25310 3216596 3216811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 3217322 3216927 gene locus_tag LOCUS_25320 3217322 3216927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3217835 3217617 gene locus_tag LOCUS_25330 3217835 3217617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 3221051 3218040 gene locus_tag LOCUS_25340 3221051 3218040 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_25340 3221607 3223076 gene locus_tag LOCUS_25350 gene guaB 3221607 3223076 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_25350 3223372 3225429 gene locus_tag LOCUS_25360 3223372 3225429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 3225444 3225782 gene locus_tag LOCUS_25370 gene rsbV 3225444 3225782 CDS product anti sigma b factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195245.1 protein_id gnl|my_center|LOCUS_25370 3225775 3226185 gene locus_tag LOCUS_25380 3225775 3226185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3226468 3228771 gene locus_tag LOCUS_25390 3226468 3228771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3228941 3230314 gene locus_tag LOCUS_25400 3228941 3230314 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_25400 3230323 3231288 gene locus_tag LOCUS_25410 3230323 3231288 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_25410 3231385 3231645 gene locus_tag LOCUS_25420 3231385 3231645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3231792 3232754 gene locus_tag LOCUS_25430 3231792 3232754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 3232777 3233532 gene locus_tag LOCUS_25440 3232777 3233532 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114678736.1 protein_id gnl|my_center|LOCUS_25440 3233659 3234093 gene locus_tag LOCUS_25450 3233659 3234093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3234229 3234816 gene locus_tag LOCUS_25460 3234229 3234816 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_25460 3235771 3234935 gene locus_tag LOCUS_25470 gene tsf 3235771 3234935 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_25470 3236690 3235929 gene locus_tag LOCUS_25480 gene rpsB 3236690 3235929 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962623.1 protein_id gnl|my_center|LOCUS_25480 3237098 3236712 gene locus_tag LOCUS_25490 gene rpsI 3237098 3236712 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_25490 3237559 3237113 gene locus_tag LOCUS_25500 gene rplM 3237559 3237113 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_25500 3238683 3238003 gene locus_tag LOCUS_25510 3238683 3238003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 3239829 3239047 gene locus_tag LOCUS_25520 3239829 3239047 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_25520 3241394 3240129 gene locus_tag LOCUS_25530 3241394 3240129 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_25530 3241636 3243525 gene locus_tag LOCUS_25540 3241636 3243525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023577041.1 protein_id gnl|my_center|LOCUS_25540 3243868 3244380 gene locus_tag LOCUS_25550 3243868 3244380 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_25550 3244367 3245137 gene locus_tag LOCUS_25560 3244367 3245137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3245231 3246142 gene locus_tag LOCUS_25570 3245231 3246142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 3246169 3246873 gene locus_tag LOCUS_25580 3246169 3246873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3247170 3249590 gene locus_tag LOCUS_25590 3247170 3249590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3249669 3251009 gene locus_tag LOCUS_25600 3249669 3251009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 3251365 3251763 gene locus_tag LOCUS_25610 3251365 3251763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 3251960 3254179 gene locus_tag LOCUS_25620 3251960 3254179 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_25620 3255209 3254436 gene locus_tag LOCUS_25630 3255209 3254436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3255289 3256299 gene locus_tag LOCUS_25640 3255289 3256299 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 protein_id gnl|my_center|LOCUS_25640 3256595 3257437 gene locus_tag LOCUS_25650 3256595 3257437 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_25650 3258500 3257637 gene locus_tag LOCUS_25660 3258500 3257637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 3259764 3259549 gene locus_tag LOCUS_25670 3259764 3259549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3260038 3259745 gene locus_tag LOCUS_25680 3260038 3259745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3260641 3260279 gene locus_tag LOCUS_25690 3260641 3260279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 3261581 3262276 gene locus_tag LOCUS_25700 3261581 3262276 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_25700 3262447 3263241 gene locus_tag LOCUS_25710 3262447 3263241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3263504 3264178 gene locus_tag LOCUS_25720 3263504 3264178 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_25720 3264839 3267868 gene locus_tag LOCUS_25730 3264839 3267868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 3268874 3267909 gene locus_tag LOCUS_25740 3268874 3267909 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_25740 3269788 3268874 gene locus_tag LOCUS_25750 gene rimK 3269788 3268874 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_25750 3270258 3269785 gene locus_tag LOCUS_25760 3270258 3269785 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334532.1 protein_id gnl|my_center|LOCUS_25760 3270453 3270968 gene locus_tag LOCUS_25770 3270453 3270968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3272806 3271922 gene locus_tag LOCUS_25780 3272806 3271922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3273357 3272815 gene locus_tag LOCUS_25790 3273357 3272815 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_25790 3273603 3273442 gene locus_tag LOCUS_25800 3273603 3273442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25800 3274313 3273549 gene locus_tag LOCUS_25810 3274313 3273549 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108114.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25810 3275223 3274519 gene locus_tag LOCUS_25820 gene cmk 3275223 3274519 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_25820 3275484 3277133 gene locus_tag LOCUS_25830 gene ade 3275484 3277133 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_25830 3277314 3278180 gene locus_tag LOCUS_25840 3277314 3278180 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455762.1 protein_id gnl|my_center|LOCUS_25840 3279123 3278191 gene locus_tag LOCUS_25850 gene yedA 3279123 3278191 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168169.1 protein_id gnl|my_center|LOCUS_25850 3280415 3279477 gene locus_tag LOCUS_25860 3280415 3279477 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807052.1 protein_id gnl|my_center|LOCUS_25860 3281096 3280419 gene locus_tag LOCUS_25870 3281096 3280419 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172761.1 protein_id gnl|my_center|LOCUS_25870 3282405 3281263 gene locus_tag LOCUS_25880 gene moeB 3282405 3281263 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_25880 3282779 3282501 gene locus_tag LOCUS_25890 3282779 3282501 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259328.1 protein_id gnl|my_center|LOCUS_25890 3283218 3282781 gene locus_tag LOCUS_25900 3283218 3282781 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_25900 3284209 3283277 gene locus_tag LOCUS_25910 3284209 3283277 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_25910 3285439 3284660 gene locus_tag LOCUS_25920 gene cysQ 3285439 3284660 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_25920 3285679 3286287 gene locus_tag LOCUS_25930 gene cysC 3285679 3286287 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_25930 3286468 3287394 gene locus_tag LOCUS_25940 gene cysD 3286468 3287394 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_25940 3287577 3288860 gene locus_tag LOCUS_25950 3287577 3288860 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_25950 3289838 3288936 gene locus_tag LOCUS_25960 3289838 3288936 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_25960 3290624 3289848 gene locus_tag LOCUS_25970 3290624 3289848 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_25970 3292503 3290635 gene locus_tag LOCUS_25980 gene mutL 3292503 3290635 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_25980 3293013 3295913 gene locus_tag LOCUS_25990 3293013 3295913 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_25990 3296165 3297313 gene locus_tag LOCUS_26000 gene bshA 3296165 3297313 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_26000 3298043 3299185 gene locus_tag LOCUS_26010 3298043 3299185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 3299408 3301306 gene locus_tag LOCUS_26020 3299408 3301306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 3301419 3302576 gene locus_tag LOCUS_26030 gene serC 3301419 3302576 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_26030 3303243 3302719 gene locus_tag LOCUS_26040 3303243 3302719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_26040 3303393 3303746 gene locus_tag LOCUS_26050 3303393 3303746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3304680 3303820 gene locus_tag LOCUS_26060 3304680 3303820 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_26060 3306035 3304734 gene locus_tag LOCUS_26070 3306035 3304734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_26070 3306960 3306028 gene locus_tag LOCUS_26080 3306960 3306028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_26080 3308253 3307108 gene locus_tag LOCUS_26090 gene dnaJ 3308253 3307108 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962830.1 protein_id gnl|my_center|LOCUS_26090 3308829 3308257 gene locus_tag LOCUS_26100 3308829 3308257 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_26100 3309897 3308977 gene locus_tag LOCUS_26110 3309897 3308977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3310929 3310339 gene locus_tag LOCUS_26120 3310929 3310339 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_26120 3311574 3311032 gene locus_tag LOCUS_26130 gene hpt 3311574 3311032 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_26130 3314028 3311821 gene locus_tag LOCUS_26140 3314028 3311821 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_26140 3315068 3314154 gene locus_tag LOCUS_26150 3315068 3314154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3315881 3317161 gene locus_tag LOCUS_26160 3315881 3317161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3317235 3318587 gene locus_tag LOCUS_26170 3317235 3318587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3319607 3318552 gene locus_tag LOCUS_26180 3319607 3318552 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_26180 3320520 3319615 gene locus_tag LOCUS_26190 3320520 3319615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3321427 3320591 gene locus_tag LOCUS_26200 3321427 3320591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 3321810 3321409 gene locus_tag LOCUS_26210 3321810 3321409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26210 3322975 3321860 gene locus_tag LOCUS_26220 3322975 3321860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 3324898 3323054 gene locus_tag LOCUS_26230 gene asnB 3324898 3323054 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 protein_id gnl|my_center|LOCUS_26230 3326021 3324954 gene locus_tag LOCUS_26240 3326021 3324954 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478388.1 protein_id gnl|my_center|LOCUS_26240 3327023 3326049 gene locus_tag LOCUS_26250 3327023 3326049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 3328143 3327091 gene locus_tag LOCUS_26260 3328143 3327091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 3329193 3328414 gene locus_tag LOCUS_26270 3329193 3328414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 3330185 3329217 gene locus_tag LOCUS_26280 3330185 3329217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3331004 3330192 gene locus_tag LOCUS_26290 3331004 3330192 CDS product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003918527.1 protein_id gnl|my_center|LOCUS_26290 3332215 3331361 gene locus_tag LOCUS_26300 3332215 3331361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3332982 3332230 gene locus_tag LOCUS_26310 3332982 3332230 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470658.1 protein_id gnl|my_center|LOCUS_26310 3334130 3333207 gene locus_tag LOCUS_26320 3334130 3333207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3335229 3334132 gene locus_tag LOCUS_26330 3335229 3334132 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679043.1 protein_id gnl|my_center|LOCUS_26330 3336195 3335266 gene locus_tag LOCUS_26340 3336195 3335266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911545.1 protein_id gnl|my_center|LOCUS_26340 3336848 3336192 gene locus_tag LOCUS_26350 3336848 3336192 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_26350 3337639 3336875 gene locus_tag LOCUS_26360 3337639 3336875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 3338446 3337649 gene locus_tag LOCUS_26370 3338446 3337649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 3339028 3338597 gene locus_tag LOCUS_26380 3339028 3338597 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_26380 3340301 3339021 gene locus_tag LOCUS_26390 3340301 3339021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_26390 3341267 3340371 gene locus_tag LOCUS_26400 3341267 3340371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_26400 3343240 3342302 gene locus_tag LOCUS_26410 3343240 3342302 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_26410 3344591 3343248 gene locus_tag LOCUS_26420 3344591 3343248 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_26420 3346917 3345013 gene locus_tag LOCUS_26430 gene asnB 3346917 3345013 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_26430 3347391 3347960 gene locus_tag LOCUS_26440 3347391 3347960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 3348341 3351550 gene locus_tag LOCUS_26450 3348341 3351550 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_26450 3352135 3352479 gene locus_tag LOCUS_26460 3352135 3352479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26460 3352606 3352758 gene locus_tag LOCUS_26470 3352606 3352758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 3352791 3353753 gene locus_tag LOCUS_26480 3352791 3353753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26480 3353744 3355045 gene locus_tag LOCUS_26490 3353744 3355045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26490 3355151 3355393 gene locus_tag LOCUS_26500 3355151 3355393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 3355908 3355982 gene locus_tag LOCUS_t00260 3355908 3355982 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3356526 3356750 gene locus_tag LOCUS_26510 3356526 3356750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3357005 3357223 gene locus_tag LOCUS_26520 3357005 3357223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 3357291 3357668 gene locus_tag LOCUS_26530 3357291 3357668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3358160 3358333 gene locus_tag LOCUS_26540 3358160 3358333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 3358556 3358407 gene locus_tag LOCUS_26550 3358556 3358407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 3358960 3359589 gene locus_tag LOCUS_26560 3358960 3359589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 3359728 3360027 gene locus_tag LOCUS_26570 3359728 3360027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3360940 3360500 gene locus_tag LOCUS_26580 3360940 3360500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 3360956 3361150 gene locus_tag LOCUS_26590 3360956 3361150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 3361572 3362354 gene locus_tag LOCUS_26600 3361572 3362354 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066484172.1 protein_id gnl|my_center|LOCUS_26600 3364939 3362672 gene locus_tag LOCUS_26610 3364939 3362672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3366168 3366503 gene locus_tag LOCUS_26620 3366168 3366503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3366545 3366835 gene locus_tag LOCUS_26630 3366545 3366835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 3366890 3367180 gene locus_tag LOCUS_26640 3366890 3367180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 3367191 3368435 gene locus_tag LOCUS_26650 3367191 3368435 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181621.1 protein_id gnl|my_center|LOCUS_26650 3369424 3368717 gene locus_tag LOCUS_26660 3369424 3368717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 3370228 3369500 gene locus_tag LOCUS_26670 3370228 3369500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3373154 3370842 gene locus_tag LOCUS_26680 3373154 3370842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 3375054 3373741 gene locus_tag LOCUS_26690 3375054 3373741 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_26690 3376735 3375116 gene locus_tag LOCUS_26700 3376735 3375116 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_26700 3378279 3376813 gene locus_tag LOCUS_26710 3378279 3376813 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_26710 3381222 3378298 gene locus_tag LOCUS_26720 3381222 3378298 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_26720 3383183 3381606 gene locus_tag LOCUS_26730 gene dnaB 3383183 3381606 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_26730 3383381 3384760 gene locus_tag LOCUS_26740 3383381 3384760 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_26740 3384767 3385585 gene locus_tag LOCUS_26750 3384767 3385585 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_26750 3387068 3386277 gene locus_tag LOCUS_26760 3387068 3386277 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_26760 3387370 3387981 gene locus_tag LOCUS_26770 3387370 3387981 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_26770 3388010 3389866 gene locus_tag LOCUS_26780 3388010 3389866 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_26780 3389948 3390409 gene locus_tag LOCUS_26790 gene bcp 3389948 3390409 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_26790 3390559 3391416 gene locus_tag LOCUS_26800 3390559 3391416 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_26800 3391618 3392967 gene locus_tag LOCUS_26810 3391618 3392967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3392974 3393927 gene locus_tag LOCUS_26820 3392974 3393927 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_26820 3394008 3394547 gene locus_tag LOCUS_26830 3394008 3394547 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_26830 3394578 3395021 gene locus_tag LOCUS_26840 3394578 3395021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 3395026 3395505 gene locus_tag LOCUS_26850 3395026 3395505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 3395698 3396891 gene locus_tag LOCUS_26860 3395698 3396891 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_26860 3397176 3398933 gene locus_tag LOCUS_26870 3397176 3398933 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888050.1 protein_id gnl|my_center|LOCUS_26870 3399451 3399023 gene locus_tag LOCUS_26880 3399451 3399023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3399786 3400757 gene locus_tag LOCUS_26890 gene pfkA 3399786 3400757 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_26890 3401829 3400903 gene locus_tag LOCUS_26900 gene miaA 3401829 3400903 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_26900 3402125 3401790 gene locus_tag LOCUS_26910 3402125 3401790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26910 3402910 3402134 gene locus_tag LOCUS_26920 3402910 3402134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26920 3403072 3404412 gene locus_tag LOCUS_26930 3403072 3404412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3404565 3407561 gene locus_tag LOCUS_26940 3404565 3407561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3407568 3407945 gene locus_tag LOCUS_26950 3407568 3407945 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_26950 3407955 3408230 gene locus_tag LOCUS_26960 3407955 3408230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3408230 3408991 gene locus_tag LOCUS_26970 3408230 3408991 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_26970 3409233 3410393 gene locus_tag LOCUS_26980 3409233 3410393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3410450 3410812 gene locus_tag LOCUS_26990 3410450 3410812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26990 3410935 3410852 gene locus_tag LOCUS_t00270 3410935 3410852 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3411382 3411170 gene locus_tag LOCUS_27000 3411382 3411170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 3411515 3412090 gene locus_tag LOCUS_27010 3411515 3412090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3412160 3413278 gene locus_tag LOCUS_27020 3412160 3413278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 3414848 3413520 gene locus_tag LOCUS_27030 3414848 3413520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 3415581 3417101 gene locus_tag LOCUS_27040 3415581 3417101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 3417044 3422026 gene locus_tag LOCUS_27050 3417044 3422026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 3422509 3423093 gene locus_tag LOCUS_27060 3422509 3423093 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268393.1 protein_id gnl|my_center|LOCUS_27060 3423120 3423926 gene locus_tag LOCUS_27070 3423120 3423926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 3424685 3424464 gene locus_tag LOCUS_27080 3424685 3424464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3425679 3424858 gene locus_tag LOCUS_27090 3425679 3424858 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467799.1 protein_id gnl|my_center|LOCUS_27090 3426040 3425756 gene locus_tag LOCUS_27100 3426040 3425756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 3426960 3426499 gene locus_tag LOCUS_27110 3426960 3426499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3427520 3430591 gene locus_tag LOCUS_27120 3427520 3430591 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_27120 3430847 3431494 gene locus_tag LOCUS_27130 3430847 3431494 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_27130 3431520 3431975 gene locus_tag LOCUS_27140 3431520 3431975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3432151 3432378 gene locus_tag LOCUS_27150 3432151 3432378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27150 3432398 3433198 gene locus_tag LOCUS_27160 3432398 3433198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27160 3433520 3433723 gene locus_tag LOCUS_27170 3433520 3433723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 3434365 3436803 gene locus_tag LOCUS_27180 3434365 3436803 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_27180 3437196 3437930 gene locus_tag LOCUS_27190 3437196 3437930 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_27190 3438727 3438008 gene locus_tag LOCUS_27200 3438727 3438008 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_27200 3439781 3443845 gene locus_tag LOCUS_27210 3439781 3443845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3444848 3447511 gene locus_tag LOCUS_27220 3444848 3447511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3448287 3447679 gene locus_tag LOCUS_27230 3448287 3447679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3449157 3448504 gene locus_tag LOCUS_27240 3449157 3448504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 3449540 3449298 gene locus_tag LOCUS_27250 3449540 3449298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3450428 3451270 gene locus_tag LOCUS_27260 3450428 3451270 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036721.1 protein_id gnl|my_center|LOCUS_27260 3451524 3455243 gene locus_tag LOCUS_27270 3451524 3455243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 3455295 3455693 gene locus_tag LOCUS_27280 3455295 3455693 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_27280 3456345 3456911 gene locus_tag LOCUS_27290 3456345 3456911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 3457071 3457289 gene locus_tag LOCUS_27300 3457071 3457289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3457581 3458270 gene locus_tag LOCUS_27310 gene clpP 3457581 3458270 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_27310 3462166 3458933 gene locus_tag LOCUS_27320 3462166 3458933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3464187 3464666 gene locus_tag LOCUS_27330 3464187 3464666 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531406.1 protein_id gnl|my_center|LOCUS_27330 3465471 3464737 gene locus_tag LOCUS_27340 3465471 3464737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27340 3466517 3465513 gene locus_tag LOCUS_27350 3466517 3465513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27350 3466958 3467845 gene locus_tag LOCUS_27360 3466958 3467845 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447162.1 protein_id gnl|my_center|LOCUS_27360 3467859 3468287 gene locus_tag LOCUS_27370 3467859 3468287 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_27370 3468315 3468884 gene locus_tag LOCUS_27380 3468315 3468884 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948185.1 protein_id gnl|my_center|LOCUS_27380 3469352 3469188 gene locus_tag LOCUS_27390 3469352 3469188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 3469622 3469425 gene locus_tag LOCUS_27400 3469622 3469425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3470403 3470101 gene locus_tag LOCUS_27410 3470403 3470101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 3470755 3472638 gene locus_tag LOCUS_27420 3470755 3472638 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_27420 3475640 3472953 gene locus_tag LOCUS_27430 3475640 3472953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3476546 3477598 gene locus_tag LOCUS_27440 3476546 3477598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3479266 3478634 gene locus_tag LOCUS_27450 3479266 3478634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3479736 3479362 gene locus_tag LOCUS_27460 3479736 3479362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 3480608 3479913 gene locus_tag LOCUS_27470 3480608 3479913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 3481246 3480710 gene locus_tag LOCUS_27480 3481246 3480710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3481857 3481366 gene locus_tag LOCUS_27490 3481857 3481366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 3482016 3482879 gene locus_tag LOCUS_27500 3482016 3482879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3482950 3484299 gene locus_tag LOCUS_27510 gene chrA 3482950 3484299 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 protein_id gnl|my_center|LOCUS_27510 3485135 3485464 gene locus_tag LOCUS_27520 3485135 3485464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 3486477 3485575 gene locus_tag LOCUS_27530 3486477 3485575 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_27530 3488247 3486730 gene locus_tag LOCUS_27540 3488247 3486730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173416272.1 protein_id gnl|my_center|LOCUS_27540 3489699 3488272 gene locus_tag LOCUS_27550 3489699 3488272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 3491213 3489939 gene locus_tag LOCUS_27560 3491213 3489939 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_27560 3494305 3491264 gene locus_tag LOCUS_27570 3494305 3491264 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_27570 3495556 3494924 gene locus_tag LOCUS_27580 3495556 3494924 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_27580 3495658 3495587 gene locus_tag LOCUS_t00280 3495658 3495587 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3495938 3496336 gene locus_tag LOCUS_27590 3495938 3496336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 3496660 3497226 gene locus_tag LOCUS_27600 3496660 3497226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 3498106 3497387 gene locus_tag LOCUS_27610 gene bshB1 3498106 3497387 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_27610 3499391 3498141 gene locus_tag LOCUS_27620 gene soxC 3499391 3498141 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_27620 3500100 3499453 gene locus_tag LOCUS_27630 3500100 3499453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3500366 3500539 gene locus_tag LOCUS_27640 3500366 3500539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 3502050 3500761 gene locus_tag LOCUS_27650 3502050 3500761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3503928 3502522 gene locus_tag LOCUS_27660 3503928 3502522 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_27660 3505952 3504297 gene locus_tag LOCUS_27670 3505952 3504297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3507411 3505984 gene locus_tag LOCUS_27680 3507411 3505984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173416272.1 protein_id gnl|my_center|LOCUS_27680 3508952 3507603 gene locus_tag LOCUS_27690 3508952 3507603 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_27690 3511958 3508965 gene locus_tag LOCUS_27700 3511958 3508965 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_27700 3513570 3512854 gene locus_tag LOCUS_27710 3513570 3512854 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_27710 3513641 3515473 gene locus_tag LOCUS_27720 3513641 3515473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3515457 3516206 gene locus_tag LOCUS_27730 3515457 3516206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 3516199 3517377 gene locus_tag LOCUS_27740 3516199 3517377 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 protein_id gnl|my_center|LOCUS_27740 3517670 3518656 gene locus_tag LOCUS_27750 3517670 3518656 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_27750 3518656 3519987 gene locus_tag LOCUS_27760 3518656 3519987 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_27760 3520452 3521378 gene locus_tag LOCUS_27770 3520452 3521378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 3521378 3522949 gene locus_tag LOCUS_27780 3521378 3522949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3524419 3523679 gene locus_tag LOCUS_27790 3524419 3523679 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_27790 3525489 3524419 gene locus_tag LOCUS_27800 3525489 3524419 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_27800 3525857 3528433 gene locus_tag LOCUS_27810 3525857 3528433 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_27810 3528861 3529457 gene locus_tag LOCUS_27820 3528861 3529457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 3529577 3530245 gene locus_tag LOCUS_27830 3529577 3530245 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_27830 3530786 3530367 gene locus_tag LOCUS_27840 3530786 3530367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 3532374 3531145 gene locus_tag LOCUS_27850 3532374 3531145 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_27850 3532821 3532381 gene locus_tag LOCUS_27860 gene tsaE 3532821 3532381 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_27860 3534376 3532814 gene locus_tag LOCUS_27870 3534376 3532814 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_27870 3534568 3535797 gene locus_tag LOCUS_27880 3534568 3535797 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_27880 3536343 3538472 gene locus_tag LOCUS_27890 3536343 3538472 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107297.1 protein_id gnl|my_center|LOCUS_27890 3538887 3538603 gene locus_tag LOCUS_27900 3538887 3538603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 3539308 3540330 gene locus_tag LOCUS_27910 gene lpxD 3539308 3540330 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_27910 3540451 3541848 gene locus_tag LOCUS_27920 3540451 3541848 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_27920 3542013 3542807 gene locus_tag LOCUS_27930 gene lpxA 3542013 3542807 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_27930 3542797 3543420 gene locus_tag LOCUS_27940 3542797 3543420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774917.1 protein_id gnl|my_center|LOCUS_27940 3544330 3543767 gene locus_tag LOCUS_27950 3544330 3543767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3544568 3546607 gene locus_tag LOCUS_27960 gene metG 3544568 3546607 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_27960 3546811 3548832 gene locus_tag LOCUS_27970 3546811 3548832 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870191.1 protein_id gnl|my_center|LOCUS_27970 3549029 3549319 gene locus_tag LOCUS_27980 3549029 3549319 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_27980 3549316 3549678 gene locus_tag LOCUS_27990 3549316 3549678 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_27990 3549801 3551111 gene locus_tag LOCUS_28000 3549801 3551111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3551101 3551676 gene locus_tag LOCUS_28010 3551101 3551676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 3553129 3551825 gene locus_tag LOCUS_28020 3553129 3551825 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_28020 3553538 3553089 gene locus_tag LOCUS_28030 3553538 3553089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 3554571 3553648 gene locus_tag LOCUS_28040 3554571 3553648 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_28040 3555126 3554575 gene locus_tag LOCUS_28050 gene pyrR 3555126 3554575 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_28050 3555732 3555439 gene locus_tag LOCUS_28060 3555732 3555439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3556018 3555782 gene locus_tag LOCUS_28070 3556018 3555782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 3557578 3556091 gene locus_tag LOCUS_28080 3557578 3556091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 3557767 3557994 gene locus_tag LOCUS_28090 3557767 3557994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 3557987 3558331 gene locus_tag LOCUS_28100 3557987 3558331 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_28100 3558818 3558414 gene locus_tag LOCUS_28110 3558818 3558414 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_28110 3558994 3560709 gene locus_tag LOCUS_28120 3558994 3560709 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839088.1 protein_id gnl|my_center|LOCUS_28120 3560706 3561689 gene locus_tag LOCUS_28130 3560706 3561689 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_28130 3561832 3562131 gene locus_tag LOCUS_28140 3561832 3562131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 3562248 3562517 gene locus_tag LOCUS_28150 3562248 3562517 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528614.1 protein_id gnl|my_center|LOCUS_28150 3563673 3563062 gene locus_tag LOCUS_28160 3563673 3563062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 3564254 3563751 gene locus_tag LOCUS_28170 3564254 3563751 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_28170 3566070 3565012 gene locus_tag LOCUS_28180 3566070 3565012 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583497.1 protein_id gnl|my_center|LOCUS_28180 3567164 3566067 gene locus_tag LOCUS_28190 3567164 3566067 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_28190 3567708 3567151 gene locus_tag LOCUS_28200 3567708 3567151 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_28200 3567836 3568636 gene locus_tag LOCUS_28210 gene folP 3567836 3568636 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_28210 3568904 3569749 gene locus_tag LOCUS_28220 gene cdaA 3568904 3569749 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_28220 3569851 3570075 gene locus_tag LOCUS_28230 3569851 3570075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3570457 3570852 gene locus_tag LOCUS_28240 3570457 3570852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28240 3570917 3571420 gene locus_tag LOCUS_28250 3570917 3571420 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 protein_id gnl|my_center|LOCUS_28250 3571463 3572275 gene locus_tag LOCUS_28260 3571463 3572275 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 protein_id gnl|my_center|LOCUS_28260 3572349 3572984 gene locus_tag LOCUS_28270 3572349 3572984 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_28270 3573009 3573749 gene locus_tag LOCUS_28280 3573009 3573749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3573854 3574930 gene locus_tag LOCUS_28290 3573854 3574930 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_28290 3575142 3575546 gene locus_tag LOCUS_28300 3575142 3575546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 3577151 3576138 gene locus_tag LOCUS_28310 3577151 3576138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 3578609 3577599 gene locus_tag LOCUS_28320 gene kbl 3578609 3577599 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28320 3580166 3578832 gene locus_tag LOCUS_28330 3580166 3578832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 3580373 3581341 gene locus_tag LOCUS_28340 3580373 3581341 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_28340 3581507 3581358 gene locus_tag LOCUS_28350 3581507 3581358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3585048 3581893 gene locus_tag LOCUS_28360 3585048 3581893 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_28360 3587230 3585347 gene locus_tag LOCUS_28370 3587230 3585347 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_28370 3590429 3587241 gene locus_tag LOCUS_28380 3590429 3587241 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_28380 3590976 3591701 gene locus_tag LOCUS_28390 3590976 3591701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3591985 3593439 gene locus_tag LOCUS_28400 3591985 3593439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3594506 3593538 gene locus_tag LOCUS_28410 3594506 3593538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3594990 3595226 gene locus_tag LOCUS_28420 3594990 3595226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3595265 3596599 gene locus_tag LOCUS_28430 3595265 3596599 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_28430 3597240 3597896 gene locus_tag LOCUS_28440 3597240 3597896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 3597908 3598648 gene locus_tag LOCUS_28450 3597908 3598648 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_28450 3599443 3598721 gene locus_tag LOCUS_28460 3599443 3598721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 3599960 3599448 gene locus_tag LOCUS_28470 3599960 3599448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 3600751 3600014 gene locus_tag LOCUS_28480 3600751 3600014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3601434 3601156 gene locus_tag LOCUS_28490 3601434 3601156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3602110 3601859 gene locus_tag LOCUS_28500 3602110 3601859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 3602368 3602153 gene locus_tag LOCUS_28510 3602368 3602153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 3603833 3602673 gene locus_tag LOCUS_28520 gene uxuA 3603833 3602673 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_28520 3605251 3604022 gene locus_tag LOCUS_28530 3605251 3604022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3606588 3605449 gene locus_tag LOCUS_28540 gene uxuA 3606588 3605449 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426045.1 protein_id gnl|my_center|LOCUS_28540 3608875 3607271 gene locus_tag LOCUS_28550 3608875 3607271 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_28550 3609290 3608922 gene locus_tag LOCUS_28560 3609290 3608922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28560 3610855 3609314 gene locus_tag LOCUS_28570 3610855 3609314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28570 3612252 3610816 gene locus_tag LOCUS_28580 3612252 3610816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28580 3613613 3612564 gene locus_tag LOCUS_28590 3613613 3612564 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138280268.1 protein_id gnl|my_center|LOCUS_28590 3614302 3613724 gene locus_tag LOCUS_28600 3614302 3613724 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797529.1 protein_id gnl|my_center|LOCUS_28600 3615254 3614739 gene locus_tag LOCUS_28610 3615254 3614739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3617493 3615292 gene locus_tag LOCUS_28620 3617493 3615292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 3619798 3617930 gene locus_tag LOCUS_28630 3619798 3617930 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_28630 3620336 3620893 gene locus_tag LOCUS_28640 3620336 3620893 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_28640 3622173 3621058 gene locus_tag LOCUS_28650 3622173 3621058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3623390 3622383 gene locus_tag LOCUS_28660 3623390 3622383 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 protein_id gnl|my_center|LOCUS_28660 3624424 3623717 gene locus_tag LOCUS_28670 3624424 3623717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3624711 3625037 gene locus_tag LOCUS_28680 gene trxA 3624711 3625037 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_28680 3625249 3625656 gene locus_tag LOCUS_28690 3625249 3625656 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_28690 3625649 3626326 gene locus_tag LOCUS_28700 gene folE 3625649 3626326 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_28700 3626487 3627404 gene locus_tag LOCUS_28710 3626487 3627404 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_28710 3627575 3628036 gene locus_tag LOCUS_28720 3627575 3628036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3628498 3628118 gene locus_tag LOCUS_28730 3628498 3628118 CDS product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619585.1 protein_id gnl|my_center|LOCUS_28730 3629076 3628495 gene locus_tag LOCUS_28740 gene nudK 3629076 3628495 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_28740 3629660 3629304 gene locus_tag LOCUS_28750 3629660 3629304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3629911 3630357 gene locus_tag LOCUS_28760 3629911 3630357 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611534.1 protein_id gnl|my_center|LOCUS_28760 3630467 3630709 gene locus_tag LOCUS_28770 3630467 3630709 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_28770 3631329 3631039 gene locus_tag LOCUS_28780 3631329 3631039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 3631559 3631326 gene locus_tag LOCUS_28790 3631559 3631326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 3632131 3631631 gene locus_tag LOCUS_28800 3632131 3631631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3637776 3632410 gene locus_tag LOCUS_28810 3637776 3632410 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_28810 3638503 3639537 gene locus_tag LOCUS_28820 3638503 3639537 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_28820 3639857 3640975 gene locus_tag LOCUS_28830 3639857 3640975 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462611.1 protein_id gnl|my_center|LOCUS_28830 3641230 3642150 gene locus_tag LOCUS_28840 3641230 3642150 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_28840 3644309 3643080 gene locus_tag LOCUS_28850 3644309 3643080 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_28850 3644648 3647572 gene locus_tag LOCUS_28860 gene gcvP 3644648 3647572 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_28860 3647891 3648418 gene locus_tag LOCUS_28870 3647891 3648418 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039427.1 protein_id gnl|my_center|LOCUS_28870 3648622 3650496 gene locus_tag LOCUS_28880 3648622 3650496 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168196249.1 protein_id gnl|my_center|LOCUS_28880 3650727 3651398 gene locus_tag LOCUS_28890 3650727 3651398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 3653448 3651574 gene locus_tag LOCUS_28900 3653448 3651574 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_28900 3653852 3654424 gene locus_tag LOCUS_28910 3653852 3654424 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_28910 3654511 3655860 gene locus_tag LOCUS_28920 3654511 3655860 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_28920 3655889 3657028 gene locus_tag LOCUS_28930 3655889 3657028 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_28930 3657227 3660418 gene locus_tag LOCUS_28940 3657227 3660418 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157567585.1 protein_id gnl|my_center|LOCUS_28940 3660804 3660547 gene locus_tag LOCUS_28950 3660804 3660547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3660990 3661493 gene locus_tag LOCUS_28960 3660990 3661493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 3661553 3662719 gene locus_tag LOCUS_28970 3661553 3662719 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176146113.1 protein_id gnl|my_center|LOCUS_28970 3663531 3662755 gene locus_tag LOCUS_28980 3663531 3662755 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_28980 3664549 3663629 gene locus_tag LOCUS_28990 3664549 3663629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 3665836 3664880 gene locus_tag LOCUS_29000 3665836 3664880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3666711 3665887 gene locus_tag LOCUS_29010 3666711 3665887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 3666957 3667697 gene locus_tag LOCUS_29020 gene kdsB 3666957 3667697 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_29020 3668079 3667732 gene locus_tag LOCUS_29030 3668079 3667732 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_29030 3668972 3668082 gene locus_tag LOCUS_29040 3668972 3668082 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_29040 3669966 3669073 gene locus_tag LOCUS_29050 3669966 3669073 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061282.1 protein_id gnl|my_center|LOCUS_29050 3671166 3670162 gene locus_tag LOCUS_29060 gene gap 3671166 3670162 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_29060 3671379 3671451 gene locus_tag LOCUS_t00290 3671379 3671451 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3672076 3672618 gene locus_tag LOCUS_29070 3672076 3672618 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 protein_id gnl|my_center|LOCUS_29070 3672578 3672763 gene locus_tag LOCUS_29080 3672578 3672763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 3673067 3673543 gene locus_tag LOCUS_29090 3673067 3673543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 3674122 3673835 gene locus_tag LOCUS_29100 3674122 3673835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3674533 3674306 gene locus_tag LOCUS_29110 3674533 3674306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 3674858 3674667 gene locus_tag LOCUS_29120 3674858 3674667 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_29120 3676060 3674939 gene locus_tag LOCUS_29130 3676060 3674939 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_29130 3676500 3676775 gene locus_tag LOCUS_29140 3676500 3676775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3676791 3677042 gene locus_tag LOCUS_29150 3676791 3677042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 3677104 3677361 gene locus_tag LOCUS_29160 3677104 3677361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 3677821 3677585 gene locus_tag LOCUS_29170 3677821 3677585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3678799 3678278 gene locus_tag LOCUS_29180 3678799 3678278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3679200 3679388 gene locus_tag LOCUS_29190 3679200 3679388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3679573 3679884 gene locus_tag LOCUS_29200 3679573 3679884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 3681084 3679987 gene locus_tag LOCUS_29210 3681084 3679987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 3681694 3681062 gene locus_tag LOCUS_29220 3681694 3681062 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258315.1 protein_id gnl|my_center|LOCUS_29220 3682179 3683636 gene locus_tag LOCUS_29230 3682179 3683636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 3683885 3685405 gene locus_tag LOCUS_29240 3683885 3685405 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_29240 3685889 3685476 gene locus_tag LOCUS_29250 3685889 3685476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 3686453 3687505 gene locus_tag LOCUS_29260 3686453 3687505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 3688987 3687791 gene locus_tag LOCUS_29270 3688987 3687791 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_29270 3689323 3689775 gene locus_tag LOCUS_29280 3689323 3689775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 3690686 3689892 gene locus_tag LOCUS_29290 3690686 3689892 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_29290 3692294 3691158 gene locus_tag LOCUS_29300 3692294 3691158 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_29300 3692552 3696955 gene locus_tag LOCUS_29310 3692552 3696955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 3698917 3697205 gene locus_tag LOCUS_29320 3698917 3697205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3700070 3700504 gene locus_tag LOCUS_29330 3700070 3700504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3701669 3701364 gene locus_tag LOCUS_29340 3701669 3701364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546304.1 protein_id gnl|my_center|LOCUS_29340 3702171 3701680 gene locus_tag LOCUS_29350 3702171 3701680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3703923 3702580 gene locus_tag LOCUS_29360 3703923 3702580 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_29360 3705282 3704257 gene locus_tag LOCUS_29370 3705282 3704257 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_29370 3706516 3705794 gene locus_tag LOCUS_29380 3706516 3705794 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790377.1 protein_id gnl|my_center|LOCUS_29380 3707160 3707843 gene locus_tag LOCUS_29390 3707160 3707843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3709157 3708171 gene locus_tag LOCUS_29400 3709157 3708171 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202721.1 protein_id gnl|my_center|LOCUS_29400 3709320 3711581 gene locus_tag LOCUS_29410 3709320 3711581 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970412.1 protein_id gnl|my_center|LOCUS_29410 3712884 3715793 gene locus_tag LOCUS_29420 3712884 3715793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 3720150 3715981 gene locus_tag LOCUS_29430 3720150 3715981 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838180.1 protein_id gnl|my_center|LOCUS_29430 3721736 3721071 gene locus_tag LOCUS_29440 3721736 3721071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3722713 3721895 gene locus_tag LOCUS_29450 3722713 3721895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 3722892 3722710 gene locus_tag LOCUS_29460 3722892 3722710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 3723977 3722892 gene locus_tag LOCUS_29470 3723977 3722892 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226779.1 protein_id gnl|my_center|LOCUS_29470 3724431 3723988 gene locus_tag LOCUS_29480 3724431 3723988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3724857 3725369 gene locus_tag LOCUS_29490 3724857 3725369 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921584.1 protein_id gnl|my_center|LOCUS_29490 3725666 3725487 gene locus_tag LOCUS_29500 3725666 3725487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3726195 3725845 gene locus_tag LOCUS_29510 3726195 3725845 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_29510 3726318 3727352 gene locus_tag LOCUS_29520 3726318 3727352 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_29520 3727582 3727881 gene locus_tag LOCUS_29530 3727582 3727881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3729018 3728146 gene locus_tag LOCUS_29540 3729018 3728146 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_29540 3729505 3729143 gene locus_tag LOCUS_29550 3729505 3729143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29550 3730095 3729412 gene locus_tag LOCUS_29560 3730095 3729412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29560 3730887 3730255 gene locus_tag LOCUS_29570 3730887 3730255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 3732334 3731039 gene locus_tag LOCUS_29580 3732334 3731039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3733638 3732331 gene locus_tag LOCUS_29590 3733638 3732331 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_29590 3735340 3733718 gene locus_tag LOCUS_29600 3735340 3733718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3736345 3735512 gene locus_tag LOCUS_29610 gene pyrF 3736345 3735512 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_29610 3736594 3738735 gene locus_tag LOCUS_29620 3736594 3738735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3738839 3739210 gene locus_tag LOCUS_29630 3738839 3739210 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_29630 3739688 3739344 gene locus_tag LOCUS_29640 3739688 3739344 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_29640 3739900 3741207 gene locus_tag LOCUS_29650 3739900 3741207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3741335 3741577 gene locus_tag LOCUS_29660 3741335 3741577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3742078 3742569 gene locus_tag LOCUS_29670 3742078 3742569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3742785 3744044 gene locus_tag LOCUS_29680 3742785 3744044 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_29680 3744260 3745096 gene locus_tag LOCUS_29690 3744260 3745096 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_29690 3745135 3746709 gene locus_tag LOCUS_29700 3745135 3746709 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206892.1 protein_id gnl|my_center|LOCUS_29700 3746769 3747281 gene locus_tag LOCUS_29710 3746769 3747281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3747278 3747736 gene locus_tag LOCUS_29720 3747278 3747736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3748794 3747820 gene locus_tag LOCUS_29730 3748794 3747820 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_29730 3750389 3748890 gene locus_tag LOCUS_29740 3750389 3748890 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_29740 3751406 3750570 gene locus_tag LOCUS_29750 3751406 3750570 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_29750 3752519 3751482 gene locus_tag LOCUS_29760 3752519 3751482 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_29760 3752911 3753702 gene locus_tag LOCUS_29770 3752911 3753702 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_29770 3753825 3754379 gene locus_tag LOCUS_29780 3753825 3754379 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_29780 3754516 3755319 gene locus_tag LOCUS_29790 3754516 3755319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3755261 3755548 gene locus_tag LOCUS_29800 gene gatC 3755261 3755548 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_29800 3755565 3758609 gene locus_tag LOCUS_29810 3755565 3758609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3758728 3759441 gene locus_tag LOCUS_29820 3758728 3759441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_29820 3759501 3760049 gene locus_tag LOCUS_29830 3759501 3760049 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_29830 3760233 3761297 gene locus_tag LOCUS_29840 3760233 3761297 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963851.1 protein_id gnl|my_center|LOCUS_29840 3761773 3762606 gene locus_tag LOCUS_29850 gene prfB 3761773 3762606 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29850 3763096 3766362 gene locus_tag LOCUS_29860 3763096 3766362 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_29860 3766374 3767837 gene locus_tag LOCUS_29870 3766374 3767837 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_29870 3768082 3771219 gene locus_tag LOCUS_29880 3768082 3771219 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963331.1 protein_id gnl|my_center|LOCUS_29880 3771251 3772792 gene locus_tag LOCUS_29890 3771251 3772792 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963330.1 protein_id gnl|my_center|LOCUS_29890 3772810 3773739 gene locus_tag LOCUS_29900 3772810 3773739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 3774143 3777280 gene locus_tag LOCUS_29910 3774143 3777280 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_29910 3777292 3778758 gene locus_tag LOCUS_29920 3777292 3778758 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764022.1 protein_id gnl|my_center|LOCUS_29920 3778769 3779197 gene locus_tag LOCUS_29930 3778769 3779197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 3780208 3779480 gene locus_tag LOCUS_29940 3780208 3779480 CDS product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271036.1 protein_id gnl|my_center|LOCUS_29940 3781976 3780267 gene locus_tag LOCUS_29950 3781976 3780267 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615421.1 protein_id gnl|my_center|LOCUS_29950 3782170 3781973 gene locus_tag LOCUS_29960 3782170 3781973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 3784713 3782218 gene locus_tag LOCUS_29970 3784713 3782218 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_29970 3785296 3784922 gene locus_tag LOCUS_29980 3785296 3784922 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143236.1 protein_id gnl|my_center|LOCUS_29980 3785744 3786013 gene locus_tag LOCUS_29990 3785744 3786013 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015000940.1 protein_id gnl|my_center|LOCUS_29990 3786208 3787056 gene locus_tag LOCUS_30000 3786208 3787056 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_30000 3787182 3787718 gene locus_tag LOCUS_30010 3787182 3787718 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_30010 3787984 3787715 gene locus_tag LOCUS_30020 3787984 3787715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3788490 3790472 gene locus_tag LOCUS_30030 3788490 3790472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3790556 3791281 gene locus_tag LOCUS_30040 3790556 3791281 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_30040 3791572 3791922 gene locus_tag LOCUS_30050 3791572 3791922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 3794115 3791998 gene locus_tag LOCUS_30060 3794115 3791998 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_30060 3794797 3794459 gene locus_tag LOCUS_30070 3794797 3794459 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_30070 3795133 3796248 gene locus_tag LOCUS_30080 3795133 3796248 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_30080 3796263 3799373 gene locus_tag LOCUS_30090 3796263 3799373 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119656495.1 protein_id gnl|my_center|LOCUS_30090 3799473 3800780 gene locus_tag LOCUS_30100 3799473 3800780 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_30100 3801401 3800883 gene locus_tag LOCUS_30110 3801401 3800883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3802691 3801597 gene locus_tag LOCUS_30120 3802691 3801597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3804047 3802869 gene locus_tag LOCUS_30130 3804047 3802869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899909.1 protein_id gnl|my_center|LOCUS_30130 3805613 3804300 gene locus_tag LOCUS_30140 3805613 3804300 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_30140 3807551 3806010 gene locus_tag LOCUS_30150 3807551 3806010 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_30150 3809088 3807793 gene locus_tag LOCUS_30160 gene dacB 3809088 3807793 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_30160 3810063 3809362 gene locus_tag LOCUS_30170 3810063 3809362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3811471 3810347 gene locus_tag LOCUS_30180 3811471 3810347 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953461.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30180 3811874 3812284 gene locus_tag LOCUS_30190 3811874 3812284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3813701 3813297 gene locus_tag LOCUS_30200 3813701 3813297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3814588 3813737 gene locus_tag LOCUS_30210 3814588 3813737 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140079.1 protein_id gnl|my_center|LOCUS_30210 3815584 3814784 gene locus_tag LOCUS_30220 3815584 3814784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3816261 3817445 gene locus_tag LOCUS_30230 3816261 3817445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_30230 3818211 3820157 gene locus_tag LOCUS_30240 3818211 3820157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 3820251 3820646 gene locus_tag LOCUS_30250 3820251 3820646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821345.1 protein_id gnl|my_center|LOCUS_30250 3821860 3820928 gene locus_tag LOCUS_30260 3821860 3820928 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859319.1 protein_id gnl|my_center|LOCUS_30260 3822309 3822052 gene locus_tag LOCUS_30270 3822309 3822052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3822530 3822997 gene locus_tag LOCUS_30280 3822530 3822997 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_30280 3823141 3823434 gene locus_tag LOCUS_30290 3823141 3823434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3823951 3823577 gene locus_tag LOCUS_30300 3823951 3823577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 3824403 3824714 gene locus_tag LOCUS_30310 3824403 3824714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3824701 3825666 gene locus_tag LOCUS_30320 3824701 3825666 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776006.1 protein_id gnl|my_center|LOCUS_30320 3825912 3826559 gene locus_tag LOCUS_30330 3825912 3826559 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_30330 3827333 3827860 gene locus_tag LOCUS_30340 3827333 3827860 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962661.1 protein_id gnl|my_center|LOCUS_30340 3827928 3830900 gene locus_tag LOCUS_30350 3827928 3830900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 3830900 3831487 gene locus_tag LOCUS_30360 3830900 3831487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3831742 3833718 gene locus_tag LOCUS_30370 3831742 3833718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3833750 3835669 gene locus_tag LOCUS_30380 3833750 3835669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3835844 3836638 gene locus_tag LOCUS_30390 3835844 3836638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_30390 3836616 3836999 gene locus_tag LOCUS_30400 3836616 3836999 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_30400 3837399 3838952 gene locus_tag LOCUS_30410 3837399 3838952 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_30410 3839469 3838990 gene locus_tag LOCUS_30420 3839469 3838990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 3839748 3839554 gene locus_tag LOCUS_30430 3839748 3839554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 3839904 3840998 gene locus_tag LOCUS_30440 3839904 3840998 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078027.1 protein_id gnl|my_center|LOCUS_30440 3841255 3842490 gene locus_tag LOCUS_30450 3841255 3842490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3842617 3843108 gene locus_tag LOCUS_30460 3842617 3843108 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142184.1 protein_id gnl|my_center|LOCUS_30460 3843111 3843713 gene locus_tag LOCUS_30470 3843111 3843713 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143387867.1 protein_id gnl|my_center|LOCUS_30470 3844124 3843726 gene locus_tag LOCUS_30480 3844124 3843726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3844864 3845016 gene locus_tag LOCUS_30490 3844864 3845016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3846324 3846073 gene locus_tag LOCUS_30500 3846324 3846073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 3846404 3848002 gene locus_tag LOCUS_30510 3846404 3848002 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_30510 3848699 3848439 gene locus_tag LOCUS_30520 3848699 3848439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3849554 3849102 gene locus_tag LOCUS_30530 3849554 3849102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 3850176 3853016 gene locus_tag LOCUS_30540 3850176 3853016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3853765 3853040 gene locus_tag LOCUS_30550 3853765 3853040 CDS product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 protein_id gnl|my_center|LOCUS_30550 3853990 3854895 gene locus_tag LOCUS_30560 3853990 3854895 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_30560 3854970 3855770 gene locus_tag LOCUS_30570 3854970 3855770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 3857119 3855824 gene locus_tag LOCUS_30580 3857119 3855824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3857483 3858298 gene locus_tag LOCUS_30590 3857483 3858298 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_30590 3860421 3858646 gene locus_tag LOCUS_30600 3860421 3858646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30600 3861806 3860484 gene locus_tag LOCUS_30610 3861806 3860484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144052.1 protein_id gnl|my_center|LOCUS_30610 3862690 3864837 gene locus_tag LOCUS_30620 3862690 3864837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3865344 3865955 gene locus_tag LOCUS_30630 3865344 3865955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 3865992 3866171 gene locus_tag LOCUS_30640 3865992 3866171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 3867840 3866500 gene locus_tag LOCUS_30650 3867840 3866500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3868099 3868015 gene locus_tag LOCUS_t00300 3868099 3868015 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3868251 3868176 gene locus_tag LOCUS_t00310 3868251 3868176 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3871024 3868391 gene locus_tag LOCUS_30660 gene mutS 3871024 3868391 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_30660 3871317 3871847 gene locus_tag LOCUS_30670 3871317 3871847 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_30670 3872993 3872223 gene locus_tag LOCUS_30680 3872993 3872223 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142748.1 protein_id gnl|my_center|LOCUS_30680 3873300 3873169 gene locus_tag LOCUS_30690 3873300 3873169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30690 3873659 3873372 gene locus_tag LOCUS_30700 3873659 3873372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30700 3873809 3874243 gene locus_tag LOCUS_30710 3873809 3874243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3874257 3874811 gene locus_tag LOCUS_30720 3874257 3874811 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_30720 3875217 3874813 gene locus_tag LOCUS_30730 3875217 3874813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 3875905 3875378 gene locus_tag LOCUS_30740 3875905 3875378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 3876150 3879512 gene locus_tag LOCUS_30750 gene mfd 3876150 3879512 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_30750 3880014 3879622 gene locus_tag LOCUS_30760 3880014 3879622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 3880420 3880842 gene locus_tag LOCUS_30770 3880420 3880842 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_30770 3881071 3882162 gene locus_tag LOCUS_30780 3881071 3882162 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_30780 3882208 3882606 gene locus_tag LOCUS_30790 3882208 3882606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30790 3882627 3882983 gene locus_tag LOCUS_30800 3882627 3882983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30800 3883348 3883004 gene locus_tag LOCUS_30810 3883348 3883004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3885607 3883409 gene locus_tag LOCUS_30820 3885607 3883409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3885695 3886993 gene locus_tag LOCUS_30830 3885695 3886993 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_30830 3887171 3887647 gene locus_tag LOCUS_30840 3887171 3887647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3888348 3887761 gene locus_tag LOCUS_30850 gene rfbC 3888348 3887761 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_30850 3889540 3888413 gene locus_tag LOCUS_30860 3889540 3888413 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_30860 3889928 3891160 gene locus_tag LOCUS_30870 gene hflX 3889928 3891160 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_30870 3891325 3891807 gene locus_tag LOCUS_30880 3891325 3891807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 3891965 3892357 gene locus_tag LOCUS_30890 3891965 3892357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3892599 3893150 gene locus_tag LOCUS_30900 3892599 3893150 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970075.1 protein_id gnl|my_center|LOCUS_30900 3893304 3893588 gene locus_tag LOCUS_30910 3893304 3893588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 3893843 3894013 gene locus_tag LOCUS_30920 3893843 3894013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 3894084 3894632 gene locus_tag LOCUS_30930 3894084 3894632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 3894875 3895369 gene locus_tag LOCUS_30940 3894875 3895369 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_30940 3895452 3897518 gene locus_tag LOCUS_30950 gene ppk1 3895452 3897518 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_30950 3897769 3898509 gene locus_tag LOCUS_30960 gene lmtA 3897769 3898509 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_30960 3898588 3898818 gene locus_tag LOCUS_30970 3898588 3898818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3903087 3899296 gene locus_tag LOCUS_30980 3903087 3899296 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_30980 3903506 3904714 gene locus_tag LOCUS_30990 3903506 3904714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 3905563 3905030 gene locus_tag LOCUS_31000 3905563 3905030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 3906492 3905920 gene locus_tag LOCUS_31010 3906492 3905920 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083338.1 protein_id gnl|my_center|LOCUS_31010 3907443 3906640 gene locus_tag LOCUS_31020 3907443 3906640 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_31020 3907687 3908370 gene locus_tag LOCUS_31030 3907687 3908370 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_31030 3908476 3909357 gene locus_tag LOCUS_31040 3908476 3909357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 3909443 3910231 gene locus_tag LOCUS_31050 3909443 3910231 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_31050 3911161 3910718 gene locus_tag LOCUS_31060 3911161 3910718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31060 3911266 3912480 gene locus_tag LOCUS_31070 3911266 3912480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3912484 3913857 gene locus_tag LOCUS_31080 3912484 3913857 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_31080 3913952 3915343 gene locus_tag LOCUS_31090 3913952 3915343 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_31090 3915652 3916224 gene locus_tag LOCUS_31100 3915652 3916224 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_31100 3917598 3916306 gene locus_tag LOCUS_31110 3917598 3916306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3917713 3918837 gene locus_tag LOCUS_31120 3917713 3918837 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_31120 3918853 3919998 gene locus_tag LOCUS_31130 3918853 3919998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3920106 3920462 gene locus_tag LOCUS_31140 3920106 3920462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3920514 3920720 gene locus_tag LOCUS_31150 3920514 3920720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 3920713 3921768 gene locus_tag LOCUS_31160 3920713 3921768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 3921802 3922821 gene locus_tag LOCUS_31170 3921802 3922821 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822199.1 protein_id gnl|my_center|LOCUS_31170 3922858 3923037 gene locus_tag LOCUS_31180 3922858 3923037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3923086 3923424 gene locus_tag LOCUS_31190 3923086 3923424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3923367 3923894 gene locus_tag LOCUS_31200 3923367 3923894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3926016 3923911 gene locus_tag LOCUS_31210 3926016 3923911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31210 3926159 3925989 gene locus_tag LOCUS_31220 3926159 3925989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3926380 3928791 gene locus_tag LOCUS_31230 3926380 3928791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 3929402 3928959 gene locus_tag LOCUS_31240 3929402 3928959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3930287 3931558 gene locus_tag LOCUS_31250 3930287 3931558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 3932019 3931765 gene locus_tag LOCUS_31260 3932019 3931765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 3932820 3932158 gene locus_tag LOCUS_31270 3932820 3932158 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 protein_id gnl|my_center|LOCUS_31270 3932830 3932997 gene locus_tag LOCUS_31280 3932830 3932997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 3933216 3933022 gene locus_tag LOCUS_31290 3933216 3933022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 3933911 3933330 gene locus_tag LOCUS_31300 3933911 3933330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3934333 3934145 gene locus_tag LOCUS_31310 3934333 3934145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3934513 3936915 gene locus_tag LOCUS_31320 3934513 3936915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 3939969 3937000 gene locus_tag LOCUS_31330 gene dnaE 3939969 3937000 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673740.1 protein_id gnl|my_center|LOCUS_31330 3941129 3939966 gene locus_tag LOCUS_31340 3941129 3939966 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987090.1 protein_id gnl|my_center|LOCUS_31340 3941955 3941266 gene locus_tag LOCUS_31350 3941955 3941266 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_31350 3942284 3942607 gene locus_tag LOCUS_31360 3942284 3942607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 3942796 3943530 gene locus_tag LOCUS_31370 3942796 3943530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 3943822 3943532 gene locus_tag LOCUS_31380 3943822 3943532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3943981 3944598 gene locus_tag LOCUS_31390 3943981 3944598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3944672 3945253 gene locus_tag LOCUS_31400 3944672 3945253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 3945261 3945497 gene locus_tag LOCUS_31410 3945261 3945497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 3946940 3945564 gene locus_tag LOCUS_31420 3946940 3945564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 3947087 3948076 gene locus_tag LOCUS_31430 3947087 3948076 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_31430 3948506 3948147 gene locus_tag LOCUS_31440 3948506 3948147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3948955 3948503 gene locus_tag LOCUS_31450 3948955 3948503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31450 3949702 3949046 gene locus_tag LOCUS_31460 3949702 3949046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3951440 3950067 gene locus_tag LOCUS_31470 3951440 3950067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31470 3951982 3951410 gene locus_tag LOCUS_31480 3951982 3951410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3953251 3952274 gene locus_tag LOCUS_31490 3953251 3952274 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_31490 3953717 3953301 gene locus_tag LOCUS_31500 gene mscL 3953717 3953301 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022450.1 protein_id gnl|my_center|LOCUS_31500 3953922 3954704 gene locus_tag LOCUS_31510 3953922 3954704 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_31510 3954905 3956401 gene locus_tag LOCUS_31520 3954905 3956401 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_31520 3956533 3956967 gene locus_tag LOCUS_31530 gene dut 3956533 3956967 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_31530 3957095 3958084 gene locus_tag LOCUS_31540 3957095 3958084 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_31540 3958091 3959878 gene locus_tag LOCUS_31550 3958091 3959878 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_31550 3959871 3960638 gene locus_tag LOCUS_31560 3959871 3960638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 3960837 3962114 gene locus_tag LOCUS_31570 3960837 3962114 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129254226.1 protein_id gnl|my_center|LOCUS_31570 3962459 3962671 gene locus_tag LOCUS_31580 3962459 3962671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3962680 3962889 gene locus_tag LOCUS_31590 3962680 3962889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3962886 3964328 gene locus_tag LOCUS_31600 gene gatA 3962886 3964328 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931960.1 protein_id gnl|my_center|LOCUS_31600 3964339 3965895 gene locus_tag LOCUS_31610 3964339 3965895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 3966113 3968440 gene locus_tag LOCUS_31620 3966113 3968440 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_31620 3968604 3969194 gene locus_tag LOCUS_31630 gene ruvA 3968604 3969194 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_31630 3969267 3972497 gene locus_tag LOCUS_31640 3969267 3972497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31640 3972569 3976534 gene locus_tag LOCUS_31650 3972569 3976534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31650 3976677 3977057 gene locus_tag LOCUS_31660 gene gcvH 3976677 3977057 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_31660 3977249 3977506 gene locus_tag LOCUS_31670 3977249 3977506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 3978507 3977518 gene locus_tag LOCUS_31680 3978507 3977518 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056558.1 protein_id gnl|my_center|LOCUS_31680 3979416 3978544 gene locus_tag LOCUS_31690 3979416 3978544 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_31690 3979624 3979878 gene locus_tag LOCUS_31700 3979624 3979878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 3979981 3980706 gene locus_tag LOCUS_31710 gene purQ 3979981 3980706 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_31710 3984155 3980880 gene locus_tag LOCUS_31720 3984155 3980880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3985238 3984165 gene locus_tag LOCUS_31730 3985238 3984165 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_31730 3985444 3986079 gene locus_tag LOCUS_31740 3985444 3986079 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_31740 3986103 3986813 gene locus_tag LOCUS_31750 gene pssA 3986103 3986813 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_31750 3986810 3987067 gene locus_tag LOCUS_31760 gene purS 3986810 3987067 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_31760 3987167 3990652 gene locus_tag LOCUS_31770 gene porU 3987167 3990652 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_31770 3990703 3991839 gene locus_tag LOCUS_31780 gene porV 3990703 3991839 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_31780 3991847 3993127 gene locus_tag LOCUS_31790 3991847 3993127 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_31790 3995591 3993318 gene locus_tag LOCUS_31800 3995591 3993318 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038090.1 protein_id gnl|my_center|LOCUS_31800 3997891 3995888 gene locus_tag LOCUS_31810 3997891 3995888 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_31810 3998868 3997912 gene locus_tag LOCUS_31820 3998868 3997912 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_31820 4001896 3998882 gene locus_tag LOCUS_31830 4001896 3998882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 4003031 4002138 gene locus_tag LOCUS_31840 gene lipA 4003031 4002138 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_31840 4004055 4003297 gene locus_tag LOCUS_31850 4004055 4003297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 4004887 4004546 gene locus_tag LOCUS_31860 gene ytxJ 4004887 4004546 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_31860 4005268 4004918 gene locus_tag LOCUS_31870 4005268 4004918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 4005609 4005301 gene locus_tag LOCUS_31880 4005609 4005301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 4007847 4005868 gene locus_tag LOCUS_31890 4007847 4005868 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_31890 4008153 4009409 gene locus_tag LOCUS_31900 4008153 4009409 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_31900 4010997 4010005 gene locus_tag LOCUS_31910 4010997 4010005 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975361.1 protein_id gnl|my_center|LOCUS_31910 4012229 4011237 gene locus_tag LOCUS_31920 4012229 4011237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 4012764 4012273 gene locus_tag LOCUS_31930 4012764 4012273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 4014483 4013122 gene locus_tag LOCUS_31940 4014483 4013122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 4016188 4014794 gene locus_tag LOCUS_31950 4016188 4014794 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_31950 4017243 4016212 gene locus_tag LOCUS_31960 4017243 4016212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31960 4017461 4017249 gene locus_tag LOCUS_31970 4017461 4017249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 4017870 4018784 gene locus_tag LOCUS_31980 4017870 4018784 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 protein_id gnl|my_center|LOCUS_31980 4018852 4019175 gene locus_tag LOCUS_31990 4018852 4019175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 4019259 4019723 gene locus_tag LOCUS_32000 4019259 4019723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 4019733 4020728 gene locus_tag LOCUS_32010 4019733 4020728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 4021419 4020817 gene locus_tag LOCUS_32020 4021419 4020817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32020 4021735 4021571 gene locus_tag LOCUS_32030 4021735 4021571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 4022988 4021864 gene locus_tag LOCUS_32040 4022988 4021864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 4024908 4023244 gene locus_tag LOCUS_32050 gene ettA 4024908 4023244 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_32050 4025180 4026490 gene locus_tag LOCUS_32060 4025180 4026490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 4026814 4027035 gene locus_tag LOCUS_32070 4026814 4027035 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_32070 4027113 4027829 gene locus_tag LOCUS_32080 4027113 4027829 CDS product amonabactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705836.1 protein_id gnl|my_center|LOCUS_32080 4028644 4027856 gene locus_tag LOCUS_32090 4028644 4027856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 4028840 4030468 gene locus_tag LOCUS_32100 4028840 4030468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 4030872 4030477 gene locus_tag LOCUS_32110 4030872 4030477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 4032197 4031154 gene locus_tag LOCUS_32120 4032197 4031154 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198300.1 protein_id gnl|my_center|LOCUS_32120 4033040 4032435 gene locus_tag LOCUS_32130 4033040 4032435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 4033803 4033486 gene locus_tag LOCUS_32140 4033803 4033486 CDS product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_32140 4034714 4033824 gene locus_tag LOCUS_32150 4034714 4033824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 4035179 4034850 gene locus_tag LOCUS_32160 4035179 4034850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 4036447 4035248 gene locus_tag LOCUS_32170 4036447 4035248 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966748.1 protein_id gnl|my_center|LOCUS_32170 4037313 4036765 gene locus_tag LOCUS_32180 4037313 4036765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 4038106 4037462 gene locus_tag LOCUS_32190 4038106 4037462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 4039164 4038388 gene locus_tag LOCUS_32200 4039164 4038388 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_32200 4040801 4039230 gene locus_tag LOCUS_32210 4040801 4039230 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_32210 4042432 4040933 gene locus_tag LOCUS_32220 4042432 4040933 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_32220 4043102 4042659 gene locus_tag LOCUS_32230 4043102 4042659 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932328.1 protein_id gnl|my_center|LOCUS_32230 4045389 4044199 gene locus_tag LOCUS_32240 4045389 4044199 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_32240 4046038 4045553 gene locus_tag LOCUS_32250 4046038 4045553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 4046741 4046052 gene locus_tag LOCUS_32260 gene deoC 4046741 4046052 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563099.1 protein_id gnl|my_center|LOCUS_32260 4050099 4046731 gene locus_tag LOCUS_32270 gene secA 4050099 4046731 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962742.1 protein_id gnl|my_center|LOCUS_32270 4051509 4050565 gene locus_tag LOCUS_32280 4051509 4050565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 4052420 4051506 gene locus_tag LOCUS_32290 4052420 4051506 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_32290 4052677 4053453 gene locus_tag LOCUS_32300 gene dapF 4052677 4053453 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135464474.1 protein_id gnl|my_center|LOCUS_32300 4053470 4053991 gene locus_tag LOCUS_32310 4053470 4053991 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_32310 4054446 4055684 gene locus_tag LOCUS_32320 4054446 4055684 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_32320 4055740 4056933 gene locus_tag LOCUS_32330 gene glf 4055740 4056933 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872005.1 protein_id gnl|my_center|LOCUS_32330 4056920 4059169 gene locus_tag LOCUS_32340 4056920 4059169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 4059325 4060389 gene locus_tag LOCUS_32350 4059325 4060389 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_32350 4061268 4060441 gene locus_tag LOCUS_32360 4061268 4060441 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964232.1 protein_id gnl|my_center|LOCUS_32360 4061833 4061597 gene locus_tag LOCUS_32370 4061833 4061597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 4063254 4061977 gene locus_tag LOCUS_32380 gene eno 4063254 4061977 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963441.1 protein_id gnl|my_center|LOCUS_32380 4063562 4063335 gene locus_tag LOCUS_32390 4063562 4063335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32390 4064437 4063493 gene locus_tag LOCUS_32400 gene carA 4064437 4063493 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32400 4065050 4064523 gene locus_tag LOCUS_32410 gene rplQ 4065050 4064523 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_32410 4066006 4065056 gene locus_tag LOCUS_32420 4066006 4065056 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_32420 4066692 4066087 gene locus_tag LOCUS_32430 gene rpsD 4066692 4066087 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_32430 4067131 4066739 gene locus_tag LOCUS_32440 gene rpsK 4067131 4066739 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_32440 4067519 4067142 gene locus_tag LOCUS_32450 gene rpsM 4067519 4067142 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_32450 4067873 4067655 gene locus_tag LOCUS_32460 gene infA 4067873 4067655 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_32460 4068647 4067880 gene locus_tag LOCUS_32470 gene map 4068647 4067880 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_32470 4069965 4068649 gene locus_tag LOCUS_32480 gene secY 4069965 4068649 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_32480 4070417 4069971 gene locus_tag LOCUS_32490 gene rplO 4070417 4069971 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_32490 4070599 4070420 gene locus_tag LOCUS_32500 gene rpmD 4070599 4070420 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720933.1 protein_id gnl|my_center|LOCUS_32500 4071123 4070605 gene locus_tag LOCUS_32510 gene rpsE 4071123 4070605 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_32510 4071477 4071127 gene locus_tag LOCUS_32520 gene rplR 4071477 4071127 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_32520 4072041 4071487 gene locus_tag LOCUS_32530 gene rplF 4072041 4071487 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_32530 4072451 4072053 gene locus_tag LOCUS_32540 gene rpsH 4072451 4072053 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_32540 4072789 4072520 gene locus_tag LOCUS_32550 gene rpsN 4072789 4072520 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_32550 4073348 4072794 gene locus_tag LOCUS_32560 gene rplE 4073348 4072794 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 protein_id gnl|my_center|LOCUS_32560 4073682 4073350 gene locus_tag LOCUS_32570 gene rplX 4073682 4073350 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_32570 4074053 4073685 gene locus_tag LOCUS_32580 gene rplN 4074053 4073685 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776366.1 protein_id gnl|my_center|LOCUS_32580 4074314 4074057 gene locus_tag LOCUS_32590 gene rpsQ 4074314 4074057 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_32590 4074528 4074322 gene locus_tag LOCUS_32600 gene rpmC 4074528 4074322 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_32600 4074953 4074531 gene locus_tag LOCUS_32610 gene rplP 4074953 4074531 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_32610 4075839 4074985 gene locus_tag LOCUS_32620 gene rpsC 4075839 4074985 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_32620 4076236 4075847 gene locus_tag LOCUS_32630 gene rplV 4076236 4075847 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_32630 4076517 4076239 gene locus_tag LOCUS_32640 gene rpsS 4076517 4076239 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_32640 4077344 4076520 gene locus_tag LOCUS_32650 gene rplB 4077344 4076520 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_32650 4077642 4077355 gene locus_tag LOCUS_32660 gene rplW 4077642 4077355 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_32660 4078274 4077645 gene locus_tag LOCUS_32670 gene rplD 4078274 4077645 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_32670 4078893 4078276 gene locus_tag LOCUS_32680 gene rplC 4078893 4078276 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_32680 4079368 4079063 gene locus_tag LOCUS_32690 gene rpsJ 4079368 4079063 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_32690 4081479 4079380 gene locus_tag LOCUS_32700 gene fusA 4081479 4079380 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_32700 4081949 4081482 gene locus_tag LOCUS_32710 gene rpsG 4081949 4081482 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_32710 4082387 4081965 gene locus_tag LOCUS_32720 gene rpsL 4082387 4081965 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_32720 4083183 4082857 gene locus_tag LOCUS_32730 4083183 4082857 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_32730 4087205 4083183 gene locus_tag LOCUS_32740 gene rpoC 4087205 4083183 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_32740 4087495 4087313 gene locus_tag LOCUS_32750 4087495 4087313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32750 4091449 4087592 gene locus_tag LOCUS_32760 gene rpoB 4091449 4087592 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_32760 4092006 4091623 gene locus_tag LOCUS_32770 gene rplL 4092006 4091623 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_32770 4092588 4092046 gene locus_tag LOCUS_32780 gene rplJ 4092588 4092046 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_32780 4093291 4092593 gene locus_tag LOCUS_32790 gene rplA 4093291 4092593 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_32790 4093747 4093304 gene locus_tag LOCUS_32800 gene rplK 4093747 4093304 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963316.1 protein_id gnl|my_center|LOCUS_32800 4094401 4093844 gene locus_tag LOCUS_32810 gene nusG 4094401 4093844 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_32810 4094604 4094413 gene locus_tag LOCUS_32820 gene secE 4094604 4094413 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_32820 4094704 4094631 gene locus_tag LOCUS_t00320 4094704 4094631 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4096001 4094814 gene locus_tag LOCUS_32830 gene tuf 4096001 4094814 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_32830 4096168 4096096 gene locus_tag LOCUS_t00330 4096168 4096096 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4096293 4096220 gene locus_tag LOCUS_t00340 4096293 4096220 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4096429 4096346 gene locus_tag LOCUS_t00350 4096429 4096346 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4099199 4096647 gene locus_tag LOCUS_32840 4099199 4096647 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_32840 4099323 4099820 gene locus_tag LOCUS_32850 4099323 4099820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 4100053 4100763 gene locus_tag LOCUS_32860 gene pyrH 4100053 4100763 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_32860 4100878 4101441 gene locus_tag LOCUS_32870 gene frr 4100878 4101441 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_32870 4101757 4103778 gene locus_tag LOCUS_32880 4101757 4103778 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_32880 4104041 4104667 gene locus_tag LOCUS_32890 gene lacC 4104041 4104667 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_32890 4104739 4106439 gene locus_tag LOCUS_32900 4104739 4106439 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_32900 4107856 4106528 gene locus_tag LOCUS_32910 4107856 4106528 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_32910 4108243 4110663 gene locus_tag LOCUS_32920 4108243 4110663 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_32920 4111805 4110729 gene locus_tag LOCUS_32930 gene fbaA 4111805 4110729 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 protein_id gnl|my_center|LOCUS_32930 4113336 4111984 gene locus_tag LOCUS_32940 4113336 4111984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 4113904 4115145 gene locus_tag LOCUS_32950 4113904 4115145 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055852.1 protein_id gnl|my_center|LOCUS_32950 4116071 4115241 gene locus_tag LOCUS_32960 gene purU 4116071 4115241 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705222.1 protein_id gnl|my_center|LOCUS_32960 4116479 4116177 gene locus_tag LOCUS_32970 4116479 4116177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4117513 4116758 gene locus_tag LOCUS_32980 4117513 4116758 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_32980 4117711 4118811 gene locus_tag LOCUS_32990 4117711 4118811 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403653.1 protein_id gnl|my_center|LOCUS_32990 4120649 4118808 gene locus_tag LOCUS_33000 4120649 4118808 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_33000 4121441 4120824 gene locus_tag LOCUS_33010 4121441 4120824 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_33010 4121705 4123312 gene locus_tag LOCUS_33020 4121705 4123312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 4123687 4123926 gene locus_tag LOCUS_33030 4123687 4123926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 4123923 4124327 gene locus_tag LOCUS_33040 4123923 4124327 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846392.1 protein_id gnl|my_center|LOCUS_33040 4127416 4124507 gene locus_tag LOCUS_33050 4127416 4124507 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_33050 4128209 4127637 gene locus_tag LOCUS_33060 gene nadD 4128209 4127637 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_33060 4128790 4128206 gene locus_tag LOCUS_33070 gene gmk 4128790 4128206 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_33070 4129075 4128797 gene locus_tag LOCUS_33080 4129075 4128797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 4129803 4129198 gene locus_tag LOCUS_33090 4129803 4129198 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_33090 4129960 4129772 gene locus_tag LOCUS_33100 4129960 4129772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 4131322 4130048 gene locus_tag LOCUS_33110 4131322 4130048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 4132471 4131446 gene locus_tag LOCUS_33120 4132471 4131446 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 protein_id gnl|my_center|LOCUS_33120 4133220 4132468 gene locus_tag LOCUS_33130 4133220 4132468 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_33130 4134758 4133451 gene locus_tag LOCUS_33140 gene ahcY 4134758 4133451 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_33140 4135086 4136288 gene locus_tag LOCUS_33150 4135086 4136288 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303089.1 protein_id gnl|my_center|LOCUS_33150 4136847 4136527 gene locus_tag LOCUS_33160 4136847 4136527 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 protein_id gnl|my_center|LOCUS_33160 4137220 4138104 gene locus_tag LOCUS_33170 4137220 4138104 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533207.1 protein_id gnl|my_center|LOCUS_33170 4138301 4139227 gene locus_tag LOCUS_33180 4138301 4139227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 4141308 4139923 gene locus_tag LOCUS_33190 4141308 4139923 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850092.1 protein_id gnl|my_center|LOCUS_33190 4142411 4141305 gene locus_tag LOCUS_33200 4142411 4141305 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969513.1 protein_id gnl|my_center|LOCUS_33200 4142839 4143441 gene locus_tag LOCUS_33210 4142839 4143441 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_33210 4144681 4144265 gene locus_tag LOCUS_33220 4144681 4144265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 4146633 4144678 gene locus_tag LOCUS_33230 4146633 4144678 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_33230 4147101 4148429 gene locus_tag LOCUS_33240 4147101 4148429 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_33240 4148893 4149849 gene locus_tag LOCUS_33250 4148893 4149849 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_33250 4150094 4150699 gene locus_tag LOCUS_33260 4150094 4150699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 4150783 4152711 gene locus_tag LOCUS_33270 4150783 4152711 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839794.1 protein_id gnl|my_center|LOCUS_33270 4152983 4153492 gene locus_tag LOCUS_33280 4152983 4153492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 4154873 4153557 gene locus_tag LOCUS_33290 gene ltrA 4154873 4153557 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_33290 4155444 4155980 gene locus_tag LOCUS_33300 4155444 4155980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 4156132 4156434 gene locus_tag LOCUS_33310 4156132 4156434 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_33310 4156424 4156756 gene locus_tag LOCUS_33320 4156424 4156756 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_33320 4156842 4157507 gene locus_tag LOCUS_33330 4156842 4157507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 4158381 4157731 gene locus_tag LOCUS_33340 4158381 4157731 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_33340 4158888 4158439 gene locus_tag LOCUS_33350 4158888 4158439 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_33350 4159216 4160364 gene locus_tag LOCUS_33360 4159216 4160364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 4160648 4160953 gene locus_tag LOCUS_33370 4160648 4160953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 4161411 4162130 gene locus_tag LOCUS_33380 4161411 4162130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 4163499 4162486 gene locus_tag LOCUS_33390 4163499 4162486 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_33390 4163867 4165144 gene locus_tag LOCUS_33400 gene gltP 4163867 4165144 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096956.1 protein_id gnl|my_center|LOCUS_33400 4165219 4165743 gene locus_tag LOCUS_33410 4165219 4165743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 4166312 4167718 gene locus_tag LOCUS_33420 4166312 4167718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 4167963 4167877 gene locus_tag LOCUS_t00360 4167963 4167877 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4168158 4168745 gene locus_tag LOCUS_33430 gene thpR 4168158 4168745 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_33430 4168805 4169299 gene locus_tag LOCUS_33440 4168805 4169299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 4170400 4169513 gene locus_tag LOCUS_33450 4170400 4169513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 4170515 4171180 gene locus_tag LOCUS_33460 4170515 4171180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 4171389 4173215 gene locus_tag LOCUS_33470 4171389 4173215 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_33470 4173295 4173615 gene locus_tag LOCUS_33480 4173295 4173615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 4173865 4174863 gene locus_tag LOCUS_33490 4173865 4174863 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765092.1 protein_id gnl|my_center|LOCUS_33490 4175291 4176757 gene locus_tag LOCUS_33500 4175291 4176757 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_33500 4177565 4176810 gene locus_tag LOCUS_33510 4177565 4176810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 4178153 4179004 gene locus_tag LOCUS_33520 4178153 4179004 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_33520 4179045 4182119 gene locus_tag LOCUS_33530 4179045 4182119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 4182576 4183427 gene locus_tag LOCUS_33540 4182576 4183427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 4183894 4184379 gene locus_tag LOCUS_33550 gene folK 4183894 4184379 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_33550 4185408 4184533 gene locus_tag LOCUS_33560 gene fabD 4185408 4184533 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_33560 4186448 4185684 gene locus_tag LOCUS_33570 4186448 4185684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 4187599 4186412 gene locus_tag LOCUS_33580 4187599 4186412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 4188429 4187695 gene locus_tag LOCUS_33590 4188429 4187695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 4191292 4188779 gene locus_tag LOCUS_33600 4191292 4188779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 4191819 4192490 gene locus_tag LOCUS_33610 4191819 4192490 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927180.1 protein_id gnl|my_center|LOCUS_33610 4192509 4194422 gene locus_tag LOCUS_33620 4192509 4194422 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_33620 4194614 4195399 gene locus_tag LOCUS_33630 4194614 4195399 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_33630 4195563 4196087 gene locus_tag LOCUS_33640 4195563 4196087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 4196268 4196675 gene locus_tag LOCUS_33650 4196268 4196675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 4198735 4196912 gene locus_tag LOCUS_33660 gene htpG 4198735 4196912 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_33660 4199111 4201435 gene locus_tag LOCUS_33670 4199111 4201435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 4203284 4201944 gene locus_tag LOCUS_33680 4203284 4201944 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_33680 4203690 4204091 gene locus_tag LOCUS_33690 4203690 4204091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33690 4204277 4207324 gene locus_tag LOCUS_33700 4204277 4207324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33700 4207407 4208387 gene locus_tag LOCUS_33710 4207407 4208387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 4208906 4209109 gene locus_tag LOCUS_33720 4208906 4209109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 4209304 4209549 gene locus_tag LOCUS_33730 4209304 4209549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 4209577 4210650 gene locus_tag LOCUS_33740 4209577 4210650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 4211842 4214862 gene locus_tag LOCUS_33750 4211842 4214862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 4215146 4219681 gene locus_tag LOCUS_33760 4215146 4219681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 4220780 4225231 gene locus_tag LOCUS_33770 4220780 4225231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 4225569 4230140 gene locus_tag LOCUS_33780 4225569 4230140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 4230603 4236602 gene locus_tag LOCUS_33790 4230603 4236602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 4236903 4241378 gene locus_tag LOCUS_33800 4236903 4241378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 4241877 4242971 gene locus_tag LOCUS_33810 4241877 4242971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33810 4243067 4246333 gene locus_tag LOCUS_33820 4243067 4246333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 4246642 4247262 gene locus_tag LOCUS_33830 4246642 4247262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33830 4247371 4251234 gene locus_tag LOCUS_33840 4247371 4251234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33840 4251666 4256102 gene locus_tag LOCUS_33850 4251666 4256102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 4256485 4261002 gene locus_tag LOCUS_33860 4256485 4261002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 4261351 4265934 gene locus_tag LOCUS_33870 4261351 4265934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 4266202 4270764 gene locus_tag LOCUS_33880 4266202 4270764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 4271143 4275738 gene locus_tag LOCUS_33890 4271143 4275738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 4276225 4278882 gene locus_tag LOCUS_33900 4276225 4278882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33900 4278879 4280900 gene locus_tag LOCUS_33910 4278879 4280900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33910 4281309 4282223 gene locus_tag LOCUS_33920 4281309 4282223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 4284520 4282523 gene locus_tag LOCUS_33930 4284520 4282523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 4285136 4286131 gene locus_tag LOCUS_33940 4285136 4286131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 4286365 4287246 gene locus_tag LOCUS_33950 gene galU 4286365 4287246 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965632.1 protein_id gnl|my_center|LOCUS_33950 4287567 4287974 gene locus_tag LOCUS_33960 4287567 4287974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 4288478 4288050 gene locus_tag LOCUS_33970 4288478 4288050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 4289299 4288559 gene locus_tag LOCUS_33980 4289299 4288559 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932350.1 protein_id gnl|my_center|LOCUS_33980 4290525 4289485 gene locus_tag LOCUS_33990 gene aroF 4290525 4289485 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_33990 4290990 4290697 gene locus_tag LOCUS_34000 4290990 4290697 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265599.1 protein_id gnl|my_center|LOCUS_34000 4291906 4291112 gene locus_tag LOCUS_34010 gene trpA 4291906 4291112 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_34010 4293089 4291896 gene locus_tag LOCUS_34020 gene trpB 4293089 4291896 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_34020 4294014 4293346 gene locus_tag LOCUS_34030 4294014 4293346 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962673.1 protein_id gnl|my_center|LOCUS_34030 4294842 4294036 gene locus_tag LOCUS_34040 gene trpC 4294842 4294036 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_34040 4296086 4295100 gene locus_tag LOCUS_34050 gene trpD 4296086 4295100 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_34050 4296682 4296083 gene locus_tag LOCUS_34060 4296682 4296083 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_34060 4297131 4296751 gene locus_tag LOCUS_34070 4297131 4296751 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_34070 4298571 4297159 gene locus_tag LOCUS_34080 4298571 4297159 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_34080 4299963 4298890 gene locus_tag LOCUS_34090 4299963 4298890 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_34090 4300575 4301435 gene locus_tag LOCUS_34100 4300575 4301435 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_34100 4301624 4302568 gene locus_tag LOCUS_34110 4301624 4302568 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_34110 4302707 4303678 gene locus_tag LOCUS_34120 4302707 4303678 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_34120 4303945 4304700 gene locus_tag LOCUS_34130 4303945 4304700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 4304731 4305891 gene locus_tag LOCUS_34140 4304731 4305891 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963656.1 protein_id gnl|my_center|LOCUS_34140 4306851 4307405 gene locus_tag LOCUS_34150 4306851 4307405 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_34150 4307722 4308384 gene locus_tag LOCUS_34160 4307722 4308384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 4310438 4308516 gene locus_tag LOCUS_34170 4310438 4308516 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695564.1 protein_id gnl|my_center|LOCUS_34170 4311099 4311935 gene locus_tag LOCUS_34180 4311099 4311935 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768991.1 protein_id gnl|my_center|LOCUS_34180 4312144 4313541 gene locus_tag LOCUS_34190 4312144 4313541 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_34190 4313708 4314532 gene locus_tag LOCUS_34200 4313708 4314532 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_34200 4314936 4315718 gene locus_tag LOCUS_34210 4314936 4315718 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_34210 4316005 4316859 gene locus_tag LOCUS_34220 4316005 4316859 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_34220 4317362 4320979 gene locus_tag LOCUS_34230 4317362 4320979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 4321256 4322596 gene locus_tag LOCUS_34240 4321256 4322596 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_34240 4322600 4323433 gene locus_tag LOCUS_34250 4322600 4323433 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224948.1 protein_id gnl|my_center|LOCUS_34250 4323528 4324403 gene locus_tag LOCUS_34260 4323528 4324403 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_34260 4324800 4326161 gene locus_tag LOCUS_34270 gene lutB 4324800 4326161 CDS product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 protein_id gnl|my_center|LOCUS_34270 4326468 4327304 gene locus_tag LOCUS_34280 4326468 4327304 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_34280 4327409 4327861 gene locus_tag LOCUS_34290 4327409 4327861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 4327831 4328253 gene locus_tag LOCUS_34300 4327831 4328253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 4328514 4329482 gene locus_tag LOCUS_34310 4328514 4329482 CDS product IS5-like element ISSod12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074424.1 protein_id gnl|my_center|LOCUS_34310 4329779 4330558 gene locus_tag LOCUS_34320 4329779 4330558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 4330704 4331306 gene locus_tag LOCUS_34330 4330704 4331306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 4333227 4332010 gene locus_tag LOCUS_34340 gene ackA 4333227 4332010 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_34340 4335662 4333572 gene locus_tag LOCUS_34350 gene pta 4335662 4333572 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_34350 4336115 4337167 gene locus_tag LOCUS_34360 4336115 4337167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 4337358 4338077 gene locus_tag LOCUS_34370 4337358 4338077 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_34370 4338859 4338074 gene locus_tag LOCUS_34380 4338859 4338074 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_34380 4340049 4343183 gene locus_tag LOCUS_34390 4340049 4343183 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_34390 4343210 4344778 gene locus_tag LOCUS_34400 4343210 4344778 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_34400 4345014 4345586 gene locus_tag LOCUS_34410 4345014 4345586 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_34410 4345780 4346751 gene locus_tag LOCUS_34420 4345780 4346751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 4346838 4347155 gene locus_tag LOCUS_34430 4346838 4347155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 4347291 4348766 gene locus_tag LOCUS_34440 4347291 4348766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 4348787 4350919 gene locus_tag LOCUS_34450 4348787 4350919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 4351293 4351976 gene locus_tag LOCUS_34460 4351293 4351976 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_34460 4352090 4352764 gene locus_tag LOCUS_34470 4352090 4352764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 4352939 4356346 gene locus_tag LOCUS_34480 4352939 4356346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 4356527 4360012 gene locus_tag LOCUS_34490 4356527 4360012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 4360455 4362284 gene locus_tag LOCUS_34500 4360455 4362284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 4362278 4364470 gene locus_tag LOCUS_34510 4362278 4364470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 4364701 4365573 gene locus_tag LOCUS_34520 4364701 4365573 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_34520 4365761 4366294 gene locus_tag LOCUS_34530 4365761 4366294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 4366359 4366802 gene locus_tag LOCUS_34540 4366359 4366802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 4368635 4367205 gene locus_tag LOCUS_34550 4368635 4367205 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_34550 4371777 4368628 gene locus_tag LOCUS_34560 4371777 4368628 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_34560 4372954 4371854 gene locus_tag LOCUS_34570 4372954 4371854 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_34570 4374254 4375096 gene locus_tag LOCUS_34580 4374254 4375096 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568382.1 protein_id gnl|my_center|LOCUS_34580 4375523 4375936 gene locus_tag LOCUS_34590 4375523 4375936 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_34590 4376383 4377270 gene locus_tag LOCUS_34600 gene yghX 4376383 4377270 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_34600 4378020 4377823 gene locus_tag LOCUS_34610 4378020 4377823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34610 4378639 4379397 gene locus_tag LOCUS_34620 gene map 4378639 4379397 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_34620 4379562 4380458 gene locus_tag LOCUS_34630 4379562 4380458 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_34630 4380543 4381397 gene locus_tag LOCUS_34640 4380543 4381397 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192727398.1 protein_id gnl|my_center|LOCUS_34640 4381746 4381919 gene locus_tag LOCUS_34650 4381746 4381919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 4381955 4383082 gene locus_tag LOCUS_34660 4381955 4383082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 4383811 4383209 gene locus_tag LOCUS_34670 4383811 4383209 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148797.1 protein_id gnl|my_center|LOCUS_34670 4383899 4384477 gene locus_tag LOCUS_34680 4383899 4384477 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810329.1 protein_id gnl|my_center|LOCUS_34680 4385433 4387397 gene locus_tag LOCUS_34690 4385433 4387397 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694585.1 protein_id gnl|my_center|LOCUS_34690 4387479 4388567 gene locus_tag LOCUS_34700 4387479 4388567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_34700 4388935 4388657 gene locus_tag LOCUS_34710 4388935 4388657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 4389527 4390036 gene locus_tag LOCUS_34720 4389527 4390036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 4391007 4392545 gene locus_tag LOCUS_34730 4391007 4392545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088844313.1 protein_id gnl|my_center|LOCUS_34730 4392768 4393688 gene locus_tag LOCUS_34740 4392768 4393688 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765023.1 protein_id gnl|my_center|LOCUS_34740 4394758 4394036 gene locus_tag LOCUS_34750 4394758 4394036 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_34750 4394886 4395797 gene locus_tag LOCUS_34760 4394886 4395797 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_34760 4395885 4398122 gene locus_tag LOCUS_34770 4395885 4398122 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_34770 4399330 4398809 gene locus_tag LOCUS_34780 4399330 4398809 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101563.1 protein_id gnl|my_center|LOCUS_34780 4399730 4399356 gene locus_tag LOCUS_34790 4399730 4399356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 4400035 4399730 gene locus_tag LOCUS_34800 4400035 4399730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 4400728 4400159 gene locus_tag LOCUS_34810 4400728 4400159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 4401174 4400752 gene locus_tag LOCUS_34820 4401174 4400752 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_34820 4403287 4401263 gene locus_tag LOCUS_34830 gene uvrB 4403287 4401263 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_34830 4403981 4403781 gene locus_tag LOCUS_34840 4403981 4403781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 4404667 4404032 gene locus_tag LOCUS_34850 4404667 4404032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 4405367 4405008 gene locus_tag LOCUS_34860 4405367 4405008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 4405867 4405364 gene locus_tag LOCUS_34870 4405867 4405364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 4407161 4406130 gene locus_tag LOCUS_34880 4407161 4406130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 4407787 4407359 gene locus_tag LOCUS_34890 4407787 4407359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 4408343 4407768 gene locus_tag LOCUS_34900 4408343 4407768 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_34900 4409331 4408597 gene locus_tag LOCUS_34910 4409331 4408597 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_34910 4410171 4409494 gene locus_tag LOCUS_34920 4410171 4409494 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_34920 4411044 4410268 gene locus_tag LOCUS_34930 4411044 4410268 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_34930 4412630 4411233 gene locus_tag LOCUS_34940 4412630 4411233 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_34940 4413693 4412713 gene locus_tag LOCUS_34950 4413693 4412713 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_34950 4414392 4413721 gene locus_tag LOCUS_34960 4414392 4413721 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_34960 4416915 4414480 gene locus_tag LOCUS_34970 4416915 4414480 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_34970 4417721 4416954 gene locus_tag LOCUS_34980 4417721 4416954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 4418084 4419223 gene locus_tag LOCUS_34990 gene acdA 4418084 4419223 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_34990 4419557 4419751 gene locus_tag LOCUS_35000 gene rpsU 4419557 4419751 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_35000 4419822 4420700 gene locus_tag LOCUS_35010 gene xerC 4419822 4420700 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_35010 4420725 4421024 gene locus_tag LOCUS_35020 gene raiA 4420725 4421024 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_35020 4422411 4421143 gene locus_tag LOCUS_35030 gene metK 4422411 4421143 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_35030 4423201 4422509 gene locus_tag LOCUS_35040 4423201 4422509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 4423382 4424191 gene locus_tag LOCUS_35050 4423382 4424191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 4424663 4424211 gene locus_tag LOCUS_35060 4424663 4424211 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_35060 4427079 4424773 gene locus_tag LOCUS_35070 4427079 4424773 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_35070 4430138 4427688 gene locus_tag LOCUS_35080 4430138 4427688 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_35080 4431481 4430324 gene locus_tag LOCUS_35090 4431481 4430324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 4431753 4431827 gene locus_tag LOCUS_t00370 4431753 4431827 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4432510 4432761 gene locus_tag LOCUS_35100 4432510 4432761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 4433517 4433155 gene locus_tag LOCUS_35110 4433517 4433155 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_35110 4435701 4434112 gene locus_tag LOCUS_35120 4435701 4434112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 4437279 4435729 gene locus_tag LOCUS_35130 4437279 4435729 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_35130 4438339 4437617 gene locus_tag LOCUS_35140 4438339 4437617 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886838.1 protein_id gnl|my_center|LOCUS_35140 4438536 4440182 gene locus_tag LOCUS_35150 4438536 4440182 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_35150 4440328 4441209 gene locus_tag LOCUS_35160 4440328 4441209 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_35160 4441430 4442296 gene locus_tag LOCUS_35170 4441430 4442296 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_35170 4442692 4443105 gene locus_tag LOCUS_35180 4442692 4443105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 4443310 4444113 gene locus_tag LOCUS_35190 gene rsbQ 4443310 4444113 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_35190 4444122 4444763 gene locus_tag LOCUS_35200 4444122 4444763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 4445271 4444915 gene locus_tag LOCUS_35210 4445271 4444915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35210 4445474 4445319 gene locus_tag LOCUS_35220 4445474 4445319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 4445889 4447013 gene locus_tag LOCUS_35230 4445889 4447013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 4447452 4447093 gene locus_tag LOCUS_35240 4447452 4447093 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_35240 4448269 4447460 gene locus_tag LOCUS_35250 4448269 4447460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 4448915 4448325 gene locus_tag LOCUS_35260 4448915 4448325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 4449218 4449024 gene locus_tag LOCUS_35270 4449218 4449024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 4449249 4449671 gene locus_tag LOCUS_35280 4449249 4449671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 4449677 4449940 gene locus_tag LOCUS_35290 4449677 4449940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 4451162 4450380 gene locus_tag LOCUS_35300 4451162 4450380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 4452216 4451155 gene locus_tag LOCUS_35310 4452216 4451155 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_35310 4453629 4452802 gene locus_tag LOCUS_35320 4453629 4452802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 4454011 4453652 gene locus_tag LOCUS_35330 4454011 4453652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 4454194 4454541 gene locus_tag LOCUS_35340 4454194 4454541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 4454543 4454788 gene locus_tag LOCUS_35350 4454543 4454788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 4454839 4457118 gene locus_tag LOCUS_35360 4454839 4457118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 4457891 4457688 gene locus_tag LOCUS_35370 4457891 4457688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 4460180 4457922 gene locus_tag LOCUS_35380 4460180 4457922 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_35380 4460658 4460191 gene locus_tag LOCUS_35390 4460658 4460191 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_35390 4461222 4460725 gene locus_tag LOCUS_35400 4461222 4460725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 4461980 4461234 gene locus_tag LOCUS_35410 4461980 4461234 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477521.1 protein_id gnl|my_center|LOCUS_35410 4462771 4462145 gene locus_tag LOCUS_35420 4462771 4462145 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_35420 4463313 4462849 gene locus_tag LOCUS_35430 4463313 4462849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 4463944 4463492 gene locus_tag LOCUS_35440 4463944 4463492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4465289 4464126 gene locus_tag LOCUS_35450 4465289 4464126 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368609.1 protein_id gnl|my_center|LOCUS_35450 4466338 4465355 gene locus_tag LOCUS_35460 4466338 4465355 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_35460 4467209 4466358 gene locus_tag LOCUS_35470 4467209 4466358 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174466.1 protein_id gnl|my_center|LOCUS_35470 4467367 4468263 gene locus_tag LOCUS_35480 4467367 4468263 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_35480 4468363 4468593 gene locus_tag LOCUS_35490 4468363 4468593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 4469235 4471487 gene locus_tag LOCUS_35500 4469235 4471487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 4472647 4471949 gene locus_tag LOCUS_35510 4472647 4471949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 4473710 4472853 gene locus_tag LOCUS_35520 4473710 4472853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 4474053 4473808 gene locus_tag LOCUS_35530 4474053 4473808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 4474291 4474575 gene locus_tag LOCUS_35540 4474291 4474575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 4474554 4475018 gene locus_tag LOCUS_35550 4474554 4475018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 4475019 4475210 gene locus_tag LOCUS_35560 4475019 4475210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 4475203 4475835 gene locus_tag LOCUS_35570 4475203 4475835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 4475847 4477673 gene locus_tag LOCUS_35580 4475847 4477673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 4477687 4477998 gene locus_tag LOCUS_35590 4477687 4477998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 4478058 4478516 gene locus_tag LOCUS_35600 4478058 4478516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 4478588 4479184 gene locus_tag LOCUS_35610 4478588 4479184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 4479320 4479694 gene locus_tag LOCUS_35620 4479320 4479694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 4479678 4479974 gene locus_tag LOCUS_35630 4479678 4479974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 4479976 4480845 gene locus_tag LOCUS_35640 4479976 4480845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 4480848 4482869 gene locus_tag LOCUS_35650 4480848 4482869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 4482876 4483187 gene locus_tag LOCUS_35660 4482876 4483187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 4483555 4484496 gene locus_tag LOCUS_35670 4483555 4484496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4484500 4484685 gene locus_tag LOCUS_35680 4484500 4484685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4484714 4485433 gene locus_tag LOCUS_35690 4484714 4485433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 4485551 4486195 gene locus_tag LOCUS_35700 4485551 4486195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 4486204 4486782 gene locus_tag LOCUS_35710 4486204 4486782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 4486858 4487541 gene locus_tag LOCUS_35720 4486858 4487541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 4487644 4492374 gene locus_tag LOCUS_35730 4487644 4492374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 4492478 4493467 gene locus_tag LOCUS_35740 4492478 4493467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 4493419 4494189 gene locus_tag LOCUS_35750 4493419 4494189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 4494199 4494540 gene locus_tag LOCUS_35760 4494199 4494540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 4494775 4494948 gene locus_tag LOCUS_35770 4494775 4494948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 4495510 4494932 gene locus_tag LOCUS_35780 4495510 4494932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 4495995 4495747 gene locus_tag LOCUS_35790 4495995 4495747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 4496561 4496088 gene locus_tag LOCUS_35800 4496561 4496088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 4497146 4496649 gene locus_tag LOCUS_35810 4497146 4496649 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027607744.1 protein_id gnl|my_center|LOCUS_35810 4497406 4497143 gene locus_tag LOCUS_35820 4497406 4497143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 4497694 4497419 gene locus_tag LOCUS_35830 4497694 4497419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 4497891 4498163 gene locus_tag LOCUS_35840 4497891 4498163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 4499408 4498191 gene locus_tag LOCUS_35850 4499408 4498191 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107088.1 protein_id gnl|my_center|LOCUS_35850 4499610 4499524 gene locus_tag LOCUS_t00380 4499610 4499524 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4500013 4500876 gene locus_tag LOCUS_35860 4500013 4500876 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057690.1 protein_id gnl|my_center|LOCUS_35860 4501001 4501465 gene locus_tag LOCUS_35870 4501001 4501465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_35870 4503248 4501521 gene locus_tag LOCUS_35880 4503248 4501521 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783447.1 protein_id gnl|my_center|LOCUS_35880 4506629 4503294 gene locus_tag LOCUS_35890 4506629 4503294 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_35890 4506957 4507481 gene locus_tag LOCUS_35900 4506957 4507481 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_35900 4512028 4507559 gene locus_tag LOCUS_35910 4512028 4507559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 4512456 4512887 gene locus_tag LOCUS_35920 4512456 4512887 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762404.1 protein_id gnl|my_center|LOCUS_35920 4513091 4514446 gene locus_tag LOCUS_35930 4513091 4514446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 4514526 4515737 gene locus_tag LOCUS_35940 4514526 4515737 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_35940 4516195 4517397 gene locus_tag LOCUS_35950 4516195 4517397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 4518419 4517997 gene locus_tag LOCUS_35960 4518419 4517997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 4521496 4518485 gene locus_tag LOCUS_35970 4521496 4518485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 4522449 4521541 gene locus_tag LOCUS_35980 4522449 4521541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 4522979 4522617 gene locus_tag LOCUS_35990 4522979 4522617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 4527458 4522989 gene locus_tag LOCUS_36000 4527458 4522989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 4528713 4528345 gene locus_tag LOCUS_36010 4528713 4528345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 4529678 4530514 gene locus_tag LOCUS_36020 4529678 4530514 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_36020 4530511 4531686 gene locus_tag LOCUS_36030 4530511 4531686 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962425.1 protein_id gnl|my_center|LOCUS_36030 4531683 4532804 gene locus_tag LOCUS_36040 4531683 4532804 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_36040 4534279 4532897 gene locus_tag LOCUS_36050 4534279 4532897 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_36050 4534537 4534914 gene locus_tag LOCUS_36060 4534537 4534914 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_36060 4534907 4536631 gene locus_tag LOCUS_36070 4534907 4536631 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203545.1 protein_id gnl|my_center|LOCUS_36070 4536710 4539028 gene locus_tag LOCUS_36080 4536710 4539028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 4539922 4539110 gene locus_tag LOCUS_36090 gene surE 4539922 4539110 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_36090 4540127 4540816 gene locus_tag LOCUS_36100 4540127 4540816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 4542816 4540879 gene locus_tag LOCUS_36110 4542816 4540879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 4545308 4543095 gene locus_tag LOCUS_36120 4545308 4543095 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_36120 4545774 4546424 gene locus_tag LOCUS_36130 4545774 4546424 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040016.1 protein_id gnl|my_center|LOCUS_36130 4547645 4546875 gene locus_tag LOCUS_36140 4547645 4546875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 4548553 4547831 gene locus_tag LOCUS_36150 gene accD 4548553 4547831 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36150 4548974 4548726 gene locus_tag LOCUS_36160 4548974 4548726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 4549171 4550166 gene locus_tag LOCUS_36170 4549171 4550166 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_36170 4551439 4550300 gene locus_tag LOCUS_36180 4551439 4550300 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_36180 4551669 4552379 gene locus_tag LOCUS_36190 4551669 4552379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 4552448 4552522 gene locus_tag LOCUS_t00390 4552448 4552522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4553747 4553641 gene locus_tag LOCUS_r00070 4553747 4553641 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4556793 4553911 gene locus_tag LOCUS_r00080 4556793 4553911 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4557086 4557012 gene locus_tag LOCUS_t00400 4557086 4557012 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4557173 4557099 gene locus_tag LOCUS_t00410 4557173 4557099 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4558901 4557384 gene locus_tag LOCUS_r00090 4558901 4557384 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4559975 4560262 gene locus_tag LOCUS_36200 4559975 4560262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 4560409 4560738 gene locus_tag LOCUS_36210 4560409 4560738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36210 4560784 4563561 gene locus_tag LOCUS_36220 4560784 4563561 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_36220 4563562 4564740 gene locus_tag LOCUS_36230 4563562 4564740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 4564776 4567217 gene locus_tag LOCUS_36240 4564776 4567217 CDS product Plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658068.1 protein_id gnl|my_center|LOCUS_36240 4568630 4567281 gene locus_tag LOCUS_36250 4568630 4567281 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_36250 4569066 4570625 gene locus_tag LOCUS_36260 4569066 4570625 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_36260 4572420 4570852 gene locus_tag LOCUS_36270 4572420 4570852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36270 4573814 4572348 gene locus_tag LOCUS_36280 4573814 4572348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582828.1 protein_id gnl|my_center|LOCUS_36280 4575519 4574251 gene locus_tag LOCUS_36290 4575519 4574251 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223621.1 protein_id gnl|my_center|LOCUS_36290 4576134 4576922 gene locus_tag LOCUS_36300 4576134 4576922 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_36300 4578338 4576980 gene locus_tag LOCUS_36310 4578338 4576980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 4581970 4578521 gene locus_tag LOCUS_36320 4581970 4578521 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_36320 4585271 4581939 gene locus_tag LOCUS_36330 4585271 4581939 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_36330 4586931 4585447 gene locus_tag LOCUS_36340 4586931 4585447 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_36340 4590043 4587011 gene locus_tag LOCUS_36350 4590043 4587011 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_36350 4590698 4593001 gene locus_tag LOCUS_36360 4590698 4593001 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_36360 4593006 4594031 gene locus_tag LOCUS_36370 4593006 4594031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 4594105 4595409 gene locus_tag LOCUS_36380 4594105 4595409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 4596806 4595490 gene locus_tag LOCUS_36390 4596806 4595490 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_36390 4597510 4596842 gene locus_tag LOCUS_36400 4597510 4596842 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_36400 4598712 4597681 gene locus_tag LOCUS_36410 4598712 4597681 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_36410 4599705 4598944 gene locus_tag LOCUS_36420 4599705 4598944 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_36420 4600376 4599951 gene locus_tag LOCUS_36430 4600376 4599951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 4601348 4600629 gene locus_tag LOCUS_36440 4601348 4600629 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_36440 4601613 4602599 gene locus_tag LOCUS_36450 4601613 4602599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 4603007 4602633 gene locus_tag LOCUS_36460 4603007 4602633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 4603249 4603509 gene locus_tag LOCUS_36470 4603249 4603509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 4603940 4603680 gene locus_tag LOCUS_36480 4603940 4603680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 4607533 4604066 gene locus_tag LOCUS_36490 4607533 4604066 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_36490 4608572 4608297 gene locus_tag LOCUS_36500 4608572 4608297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 4608787 4609989 gene locus_tag LOCUS_36510 4608787 4609989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 4611769 4610084 gene locus_tag LOCUS_36520 4611769 4610084 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_36520 4612203 4611832 gene locus_tag LOCUS_36530 4612203 4611832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 4612756 4614474 gene locus_tag LOCUS_36540 4612756 4614474 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_36540 4614871 4614593 gene locus_tag LOCUS_36550 4614871 4614593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 4614870 4615265 gene locus_tag LOCUS_36560 4614870 4615265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 4615262 4615603 gene locus_tag LOCUS_36570 4615262 4615603 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044173324.1 protein_id gnl|my_center|LOCUS_36570 4615676 4616125 gene locus_tag LOCUS_36580 4615676 4616125 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948556.1 protein_id gnl|my_center|LOCUS_36580 4617196 4616282 gene locus_tag LOCUS_36590 4617196 4616282 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_36590 4619135 4617435 gene locus_tag LOCUS_36600 4619135 4617435 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_36600 4619346 4619951 gene locus_tag LOCUS_36610 4619346 4619951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 4620885 4621322 gene locus_tag LOCUS_36620 4620885 4621322 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_36620 4621896 4621426 gene locus_tag LOCUS_36630 4621896 4621426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 4622228 4622845 gene locus_tag LOCUS_36640 4622228 4622845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 4622973 4625156 gene locus_tag LOCUS_36650 4622973 4625156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 4626097 4625462 gene locus_tag LOCUS_36660 4626097 4625462 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_36660 4626591 4627082 gene locus_tag LOCUS_36670 4626591 4627082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 4627206 4629215 gene locus_tag LOCUS_36680 gene ligA 4627206 4629215 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_36680 4629279 4629671 gene locus_tag LOCUS_36690 4629279 4629671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 4629869 4630732 gene locus_tag LOCUS_36700 gene dapA 4629869 4630732 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_36700 4631594 4631142 gene locus_tag LOCUS_36710 4631594 4631142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223324.1 protein_id gnl|my_center|LOCUS_36710 4631751 4631587 gene locus_tag LOCUS_36720 4631751 4631587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 4632591 4631854 gene locus_tag LOCUS_36730 4632591 4631854 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_36730 4633443 4632595 gene locus_tag LOCUS_36740 4633443 4632595 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_36740 4633721 4634608 gene locus_tag LOCUS_36750 4633721 4634608 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_36750 4636941 4634662 gene locus_tag LOCUS_36760 4636941 4634662 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_36760 4636961 4637116 gene locus_tag LOCUS_36770 4636961 4637116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 4639092 4637137 gene locus_tag LOCUS_36780 gene gyrB 4639092 4637137 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_36780 4639656 4640990 gene locus_tag LOCUS_36790 4639656 4640990 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964001.1 protein_id gnl|my_center|LOCUS_36790 4641287 4642501 gene locus_tag LOCUS_36800 4641287 4642501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 4642971 4644134 gene locus_tag LOCUS_36810 4642971 4644134 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796113.1 protein_id gnl|my_center|LOCUS_36810 4644792 4644382 gene locus_tag LOCUS_36820 4644792 4644382 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_36820 4644966 4645613 gene locus_tag LOCUS_36830 4644966 4645613 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_36830 4645639 4645977 gene locus_tag LOCUS_36840 4645639 4645977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 4646089 4647405 gene locus_tag LOCUS_36850 4646089 4647405 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084102.1 protein_id gnl|my_center|LOCUS_36850 4647909 4648550 gene locus_tag LOCUS_36860 gene nreC 4647909 4648550 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_36860 4648721 4649257 gene locus_tag LOCUS_36870 4648721 4649257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 4649382 4649786 gene locus_tag LOCUS_36880 4649382 4649786 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_36880 4649908 4651020 gene locus_tag LOCUS_36890 4649908 4651020 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_36890 4651525 4652079 gene locus_tag LOCUS_36900 gene msrA 4651525 4652079 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230812.1 protein_id gnl|my_center|LOCUS_36900 4652985 4652149 gene locus_tag LOCUS_36910 4652985 4652149 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_36910 4654331 4653282 gene locus_tag LOCUS_36920 4654331 4653282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 4655160 4654378 gene locus_tag LOCUS_36930 4655160 4654378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 4655546 4655253 gene locus_tag LOCUS_36940 4655546 4655253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 4655688 4656944 gene locus_tag LOCUS_36950 4655688 4656944 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_36950 4658359 4657139 gene locus_tag LOCUS_36960 4658359 4657139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 4659274 4658654 gene locus_tag LOCUS_36970 4659274 4658654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 4660014 4659355 gene locus_tag LOCUS_36980 4660014 4659355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 4660426 4660815 gene locus_tag LOCUS_36990 4660426 4660815 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 protein_id gnl|my_center|LOCUS_36990 4660812 4663100 gene locus_tag LOCUS_37000 4660812 4663100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 4663340 4665472 gene locus_tag LOCUS_37010 4663340 4665472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 4665760 4665551 gene locus_tag LOCUS_37020 4665760 4665551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37020 4667523 4665757 gene locus_tag LOCUS_37030 4667523 4665757 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_37030 4668198 4668527 gene locus_tag LOCUS_37040 4668198 4668527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 4669072 4668821 gene locus_tag LOCUS_37050 4669072 4668821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 4670585 4669305 gene locus_tag LOCUS_37060 4670585 4669305 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853131.1 protein_id gnl|my_center|LOCUS_37060 4670906 4672225 gene locus_tag LOCUS_37070 4670906 4672225 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_37070 4672302 4674368 gene locus_tag LOCUS_37080 4672302 4674368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 4675580 4674657 gene locus_tag LOCUS_37090 4675580 4674657 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_37090 4675886 4676593 gene locus_tag LOCUS_37100 4675886 4676593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 4677057 4676719 gene locus_tag LOCUS_37110 4677057 4676719 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978015.1 protein_id gnl|my_center|LOCUS_37110 4677245 4678138 gene locus_tag LOCUS_37120 4677245 4678138 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_37120 4678534 4679967 gene locus_tag LOCUS_37130 4678534 4679967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 4680478 4683186 gene locus_tag LOCUS_37140 4680478 4683186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 4683234 4684622 gene locus_tag LOCUS_37150 4683234 4684622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 4684732 4685685 gene locus_tag LOCUS_37160 gene metF 4684732 4685685 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_37160 4685867 4686595 gene locus_tag LOCUS_37170 4685867 4686595 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258526.1 protein_id gnl|my_center|LOCUS_37170 4686920 4687624 gene locus_tag LOCUS_37180 4686920 4687624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 4688458 4689204 gene locus_tag LOCUS_37190 4688458 4689204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 4689488 4690423 gene locus_tag LOCUS_37200 4689488 4690423 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_37200 4690439 4691359 gene locus_tag LOCUS_37210 4690439 4691359 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 protein_id gnl|my_center|LOCUS_37210 4691500 4691748 gene locus_tag LOCUS_37220 4691500 4691748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 4691745 4692674 gene locus_tag LOCUS_37230 4691745 4692674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37230 4693672 4692776 gene locus_tag LOCUS_37240 4693672 4692776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 4694056 4693703 gene locus_tag LOCUS_37250 4694056 4693703 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184933.1 protein_id gnl|my_center|LOCUS_37250 4694901 4694083 gene locus_tag LOCUS_37260 4694901 4694083 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_37260 4696026 4695007 gene locus_tag LOCUS_37270 4696026 4695007 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_37270 4696983 4696042 gene locus_tag LOCUS_37280 4696983 4696042 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_37280 4698114 4697239 gene locus_tag LOCUS_37290 4698114 4697239 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_37290 4698919 4699935 gene locus_tag LOCUS_37300 4698919 4699935 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_37300 4700179 4700514 gene locus_tag LOCUS_37310 4700179 4700514 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369371.1 protein_id gnl|my_center|LOCUS_37310 4701941 4701084 gene locus_tag LOCUS_37320 4701941 4701084 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_37320 4702982 4702095 gene locus_tag LOCUS_37330 4702982 4702095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 4706589 4703407 gene locus_tag LOCUS_37340 4706589 4703407 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663427.1 protein_id gnl|my_center|LOCUS_37340 4708313 4706805 gene locus_tag LOCUS_37350 4708313 4706805 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_37350 4710345 4708339 gene locus_tag LOCUS_37360 4710345 4708339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 4711391 4710345 gene locus_tag LOCUS_37370 4711391 4710345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37370 4714627 4711988 gene locus_tag LOCUS_37380 4714627 4711988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 4716472 4715222 gene locus_tag LOCUS_37390 4716472 4715222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 4717337 4717173 gene locus_tag LOCUS_37400 4717337 4717173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 4718756 4717413 gene locus_tag LOCUS_37410 4718756 4717413 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_37410 4719600 4720064 gene locus_tag LOCUS_37420 4719600 4720064 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_37420 4721919 4720174 gene locus_tag LOCUS_37430 gene aspS 4721919 4720174 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_37430 4722514 4722308 gene locus_tag LOCUS_37440 4722514 4722308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 4723022 4723573 gene locus_tag LOCUS_37450 4723022 4723573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 4723648 4724094 gene locus_tag LOCUS_37460 4723648 4724094 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_37460 4724170 4724781 gene locus_tag LOCUS_37470 4724170 4724781 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_37470 4725017 4726255 gene locus_tag LOCUS_37480 4725017 4726255 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_37480 4726750 4728138 gene locus_tag LOCUS_37490 4726750 4728138 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_37490 4728386 4729915 gene locus_tag LOCUS_37500 4728386 4729915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 4730146 4731399 gene locus_tag LOCUS_37510 4730146 4731399 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_37510 4731490 4732395 gene locus_tag LOCUS_37520 4731490 4732395 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_37520 4734087 4732606 gene locus_tag LOCUS_37530 gene cysS 4734087 4732606 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_37530 4735195 4734227 gene locus_tag LOCUS_37540 4735195 4734227 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_37540 4735635 4736108 gene locus_tag LOCUS_37550 4735635 4736108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 4736117 4737370 gene locus_tag LOCUS_37560 gene nusA 4736117 4737370 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_37560 4737568 4740729 gene locus_tag LOCUS_37570 gene infB 4737568 4740729 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012779652.1 protein_id gnl|my_center|LOCUS_37570 4740871 4741698 gene locus_tag LOCUS_37580 4740871 4741698 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_37580 4741775 4742761 gene locus_tag LOCUS_37590 4741775 4742761 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_37590 4743324 4742905 gene locus_tag LOCUS_37600 4743324 4742905 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_37600 4743682 4744701 gene locus_tag LOCUS_37610 4743682 4744701 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_37610 4744722 4745663 gene locus_tag LOCUS_37620 4744722 4745663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 4745844 4746428 gene locus_tag LOCUS_37630 4745844 4746428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 4746438 4746962 gene locus_tag LOCUS_37640 4746438 4746962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 4747881 4747102 gene locus_tag LOCUS_37650 4747881 4747102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 4750370 4748064 gene locus_tag LOCUS_37660 4750370 4748064 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_37660 4750709 4750428 gene locus_tag LOCUS_37670 4750709 4750428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 4751329 4750802 gene locus_tag LOCUS_37680 4751329 4750802 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_37680 4751812 4751489 gene locus_tag LOCUS_37690 4751812 4751489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 4751852 4752985 gene locus_tag LOCUS_37700 4751852 4752985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 4754334 4753060 gene locus_tag LOCUS_37710 gene rodA 4754334 4753060 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_37710 4756179 4754338 gene locus_tag LOCUS_37720 gene mrdA 4756179 4754338 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_37720 4757108 4756584 gene locus_tag LOCUS_37730 4757108 4756584 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_37730 4758000 4757101 gene locus_tag LOCUS_37740 gene mreC 4758000 4757101 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_37740 4758323 4758009 gene locus_tag LOCUS_37750 4758323 4758009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37750 4759033 4758323 gene locus_tag LOCUS_37760 4759033 4758323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37760 4760893 4759376 gene locus_tag LOCUS_37770 gene purH 4760893 4759376 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762746.1 protein_id gnl|my_center|LOCUS_37770 4761653 4761072 gene locus_tag LOCUS_37780 gene purN 4761653 4761072 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_37780 4761955 4763190 gene locus_tag LOCUS_37790 4761955 4763190 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116062060.1 protein_id gnl|my_center|LOCUS_37790 4763510 4763343 gene locus_tag LOCUS_37800 4763510 4763343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 4764154 4763486 gene locus_tag LOCUS_37810 4764154 4763486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37810 4764518 4764324 gene locus_tag LOCUS_37820 4764518 4764324 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_37820 4765122 4764628 gene locus_tag LOCUS_37830 4765122 4764628 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_37830 4766023 4765214 gene locus_tag LOCUS_37840 4766023 4765214 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_37840 4766703 4766110 gene locus_tag LOCUS_37850 4766703 4766110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 4767995 4766712 gene locus_tag LOCUS_37860 4767995 4766712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37860 4768699 4767974 gene locus_tag LOCUS_37870 4768699 4767974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37870 4769264 4768842 gene locus_tag LOCUS_37880 4769264 4768842 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_37880 4769625 4769350 gene locus_tag LOCUS_37890 4769625 4769350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 4770277 4769609 gene locus_tag LOCUS_37900 gene ccsA 4770277 4769609 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_37900 4771094 4770429 gene locus_tag LOCUS_37910 4771094 4770429 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956994.1 protein_id gnl|my_center|LOCUS_37910 4771385 4774213 gene locus_tag LOCUS_37920 4771385 4774213 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918060.1 protein_id gnl|my_center|LOCUS_37920 4774265 4775656 gene locus_tag LOCUS_37930 4774265 4775656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 4775967 4776464 gene locus_tag LOCUS_37940 4775967 4776464 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_37940 4776984 4776556 gene locus_tag LOCUS_37950 4776984 4776556 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_37950 4777598 4777029 gene locus_tag LOCUS_37960 4777598 4777029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 4777986 4777636 gene locus_tag LOCUS_37970 4777986 4777636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 4778672 4779955 gene locus_tag LOCUS_37980 4778672 4779955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 4779918 4780202 gene locus_tag LOCUS_37990 4779918 4780202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 4780163 4780633 gene locus_tag LOCUS_38000 4780163 4780633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 4780582 4782114 gene locus_tag LOCUS_38010 4780582 4782114 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38010 4782066 4782932 gene locus_tag LOCUS_38020 4782066 4782932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38020 4783091 4783267 gene locus_tag LOCUS_38030 4783091 4783267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 4784526 4783531 gene locus_tag LOCUS_38040 4784526 4783531 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_38040 4784954 4784583 gene locus_tag LOCUS_38050 4784954 4784583 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_38050 4785368 4785916 gene locus_tag LOCUS_38060 4785368 4785916 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_38060 4786774 4786271 gene locus_tag LOCUS_38070 4786774 4786271 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_38070 4788354 4786822 gene locus_tag LOCUS_38080 gene gntK 4788354 4786822 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 protein_id gnl|my_center|LOCUS_38080 4788731 4789954 gene locus_tag LOCUS_38090 4788731 4789954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_38090 4790135 4790497 gene locus_tag LOCUS_38100 4790135 4790497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 4790571 4791062 gene locus_tag LOCUS_38110 4790571 4791062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 4791111 4791356 gene locus_tag LOCUS_38120 4791111 4791356 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_38120 4791701 4792675 gene locus_tag LOCUS_38130 4791701 4792675 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_38130 4792873 4793391 gene locus_tag LOCUS_38140 4792873 4793391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 4793782 4793447 gene locus_tag LOCUS_38150 4793782 4793447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 4794124 4794702 gene locus_tag LOCUS_38160 4794124 4794702 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_38160 4794699 4795106 gene locus_tag LOCUS_38170 4794699 4795106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 4795119 4795436 gene locus_tag LOCUS_38180 4795119 4795436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 4795493 4795885 gene locus_tag LOCUS_38190 4795493 4795885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 4797037 4796042 gene locus_tag LOCUS_38200 4797037 4796042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 4798015 4797398 gene locus_tag LOCUS_38210 4798015 4797398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38210 4798563 4798033 gene locus_tag LOCUS_38220 4798563 4798033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38220 4799467 4798628 gene locus_tag LOCUS_38230 4799467 4798628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38230 4800174 4799506 gene locus_tag LOCUS_38240 4800174 4799506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38240 4800547 4800975 gene locus_tag LOCUS_38250 4800547 4800975 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_38250 4802626 4801355 gene locus_tag LOCUS_38260 gene sufS 4802626 4801355 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_38260 4804574 4803450 gene locus_tag LOCUS_38270 4804574 4803450 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 protein_id gnl|my_center|LOCUS_38270 4805035 4804595 gene locus_tag LOCUS_38280 4805035 4804595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 4806552 4805083 gene locus_tag LOCUS_38290 4806552 4805083 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_38290 4809901 4806704 gene locus_tag LOCUS_38300 4809901 4806704 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_38300 4811248 4812102 gene locus_tag LOCUS_38310 4811248 4812102 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_38310 4812099 4813109 gene locus_tag LOCUS_38320 4812099 4813109 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_38320 4813450 4814805 gene locus_tag LOCUS_38330 4813450 4814805 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_38330 4815555 4815187 gene locus_tag LOCUS_38340 4815555 4815187 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971377.1 protein_id gnl|my_center|LOCUS_38340 4815867 4816427 gene locus_tag LOCUS_38350 4815867 4816427 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823962.1 protein_id gnl|my_center|LOCUS_38350 4816424 4817230 gene locus_tag LOCUS_38360 4816424 4817230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 4817243 4818109 gene locus_tag LOCUS_38370 4817243 4818109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 4818857 4819687 gene locus_tag LOCUS_38380 4818857 4819687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 4820193 4819840 gene locus_tag LOCUS_38390 4820193 4819840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 4821496 4820606 gene locus_tag LOCUS_38400 4821496 4820606 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_38400 4822949 4821783 gene locus_tag LOCUS_38410 4822949 4821783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_38410 4823948 4823262 gene locus_tag LOCUS_38420 4823948 4823262 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762145.1 protein_id gnl|my_center|LOCUS_38420 4824176 4824643 gene locus_tag LOCUS_38430 4824176 4824643 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_38430 4824904 4825773 gene locus_tag LOCUS_38440 gene floA 4824904 4825773 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_38440 4825826 4826971 gene locus_tag LOCUS_38450 4825826 4826971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 4827046 4829943 gene locus_tag LOCUS_38460 4827046 4829943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 4830244 4830771 gene locus_tag LOCUS_38470 4830244 4830771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 4831245 4830814 gene locus_tag LOCUS_38480 4831245 4830814 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_38480 4831921 4831400 gene locus_tag LOCUS_38490 4831921 4831400 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_38490 4832164 4832628 gene locus_tag LOCUS_38500 4832164 4832628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 4832664 4833452 gene locus_tag LOCUS_38510 4832664 4833452 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_38510 4834922 4833447 gene locus_tag LOCUS_38520 4834922 4833447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 4835851 4835063 gene locus_tag LOCUS_38530 4835851 4835063 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_38530 4838284 4836074 gene locus_tag LOCUS_38540 4838284 4836074 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_38540 4838468 4839358 gene locus_tag LOCUS_38550 4838468 4839358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 4841043 4839520 gene locus_tag LOCUS_38560 4841043 4839520 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_38560 4842374 4841061 gene locus_tag LOCUS_38570 4842374 4841061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185273247.1 protein_id gnl|my_center|LOCUS_38570 4842548 4844023 gene locus_tag LOCUS_38580 gene proS 4842548 4844023 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_38580 4844463 4845536 gene locus_tag LOCUS_38590 4844463 4845536 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_38590 4846859 4845837 gene locus_tag LOCUS_38600 4846859 4845837 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_38600 4848620 4847460 gene locus_tag LOCUS_38610 gene galK 4848620 4847460 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_38610 4849743 4848703 gene locus_tag LOCUS_38620 4849743 4848703 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_38620 4850601 4850206 gene locus_tag LOCUS_38630 4850601 4850206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 4851140 4853431 gene locus_tag LOCUS_38640 4851140 4853431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 4854626 4853571 gene locus_tag LOCUS_38650 4854626 4853571 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767184.1 protein_id gnl|my_center|LOCUS_38650 4855147 4854692 gene locus_tag LOCUS_38660 4855147 4854692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 4856144 4855179 gene locus_tag LOCUS_38670 4856144 4855179 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_38670 4857604 4856513 gene locus_tag LOCUS_38680 4857604 4856513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 4859159 4857819 gene locus_tag LOCUS_38690 4859159 4857819 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_38690 4859969 4859199 gene locus_tag LOCUS_38700 4859969 4859199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 4860922 4859996 gene locus_tag LOCUS_38710 gene iolE 4860922 4859996 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973915.1 protein_id gnl|my_center|LOCUS_38710 4862778 4861159 gene locus_tag LOCUS_38720 4862778 4861159 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_38720 4865790 4862800 gene locus_tag LOCUS_38730 4865790 4862800 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_38730 4866796 4866563 gene locus_tag LOCUS_38740 4866796 4866563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 4868207 4867098 gene locus_tag LOCUS_38750 4868207 4867098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 4869367 4868216 gene locus_tag LOCUS_38760 4869367 4868216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 4871245 4869608 gene locus_tag LOCUS_38770 4871245 4869608 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_38770 4871646 4871482 gene locus_tag LOCUS_38780 4871646 4871482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 4872020 4873444 gene locus_tag LOCUS_38790 4872020 4873444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 4875219 4873525 gene locus_tag LOCUS_38800 4875219 4873525 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_38800 4876283 4875585 gene locus_tag LOCUS_38810 4876283 4875585 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_38810 4877559 4876318 gene locus_tag LOCUS_38820 4877559 4876318 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100623.1 protein_id gnl|my_center|LOCUS_38820 4878421 4877705 gene locus_tag LOCUS_38830 4878421 4877705 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_38830 4878586 4881768 gene locus_tag LOCUS_38840 4878586 4881768 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_38840 4883825 4881903 gene locus_tag LOCUS_38850 4883825 4881903 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_38850 4884865 4883924 gene locus_tag LOCUS_38860 4884865 4883924 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_38860 4890121 4884995 gene locus_tag LOCUS_38870 4890121 4884995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4891854 4890706 gene locus_tag LOCUS_38880 4891854 4890706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 4892473 4891925 gene locus_tag LOCUS_38890 4892473 4891925 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_38890 4892843 4893541 gene locus_tag LOCUS_38900 4892843 4893541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_38900 4893580 4893885 gene locus_tag LOCUS_38910 4893580 4893885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 4894002 4896509 gene locus_tag LOCUS_38920 4894002 4896509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_38920 4896913 4896524 gene locus_tag LOCUS_38930 4896913 4896524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 4897217 4898059 gene locus_tag LOCUS_38940 4897217 4898059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 4900245 4898971 gene locus_tag LOCUS_38950 gene ilvA 4900245 4898971 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_38950 4901442 4900396 gene locus_tag LOCUS_38960 gene ilvC 4901442 4900396 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_38960 4902156 4901593 gene locus_tag LOCUS_38970 gene ilvN 4902156 4901593 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_38970 4904042 4902297 gene locus_tag LOCUS_38980 gene ilvB 4904042 4902297 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_38980 4904761 4904183 gene locus_tag LOCUS_38990 4904761 4904183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 4906609 4904906 gene locus_tag LOCUS_39000 gene ilvD 4906609 4904906 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_39000 4908293 4907469 gene locus_tag LOCUS_39010 4908293 4907469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 4909849 4908425 gene locus_tag LOCUS_39020 4909849 4908425 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_39020 4910726 4910511 gene locus_tag LOCUS_39030 4910726 4910511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 4911045 4913489 gene locus_tag LOCUS_39040 gene thrA 4911045 4913489 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_39040 4913647 4914645 gene locus_tag LOCUS_39050 4913647 4914645 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_39050 4914761 4915198 gene locus_tag LOCUS_39060 4914761 4915198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 4915238 4916539 gene locus_tag LOCUS_39070 gene thrC 4915238 4916539 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_39070 4916992 4918176 gene locus_tag LOCUS_39080 4916992 4918176 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_39080 4918185 4919597 gene locus_tag LOCUS_39090 gene leuC 4918185 4919597 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072959918.1 protein_id gnl|my_center|LOCUS_39090 4919751 4920380 gene locus_tag LOCUS_39100 gene leuD 4919751 4920380 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_39100 4921238 4920588 gene locus_tag LOCUS_39110 4921238 4920588 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_39110 4921851 4921516 gene locus_tag LOCUS_39120 4921851 4921516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4922277 4924637 gene locus_tag LOCUS_39130 4922277 4924637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39130 4924897 4926195 gene locus_tag LOCUS_39140 4924897 4926195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39140 4926170 4927168 gene locus_tag LOCUS_39150 4926170 4927168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39150 4927172 4927333 gene locus_tag LOCUS_39160 4927172 4927333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39160 4927902 4927447 gene locus_tag LOCUS_39170 4927902 4927447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 4927983 4928426 gene locus_tag LOCUS_39180 4927983 4928426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39180 4929121 4928765 gene locus_tag LOCUS_39190 4929121 4928765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4929465 4929280 gene locus_tag LOCUS_39200 4929465 4929280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 4929646 4929422 gene locus_tag LOCUS_39210 4929646 4929422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 4930020 4929679 gene locus_tag LOCUS_39220 4930020 4929679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39220 4931283 4930753 gene locus_tag LOCUS_39230 4931283 4930753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 4931799 4931332 gene locus_tag LOCUS_39240 4931799 4931332 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_39240 4932206 4932658 gene locus_tag LOCUS_39250 4932206 4932658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 4932676 4933008 gene locus_tag LOCUS_39260 4932676 4933008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 4933392 4933051 gene locus_tag LOCUS_39270 4933392 4933051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 4933602 4935056 gene locus_tag LOCUS_39280 4933602 4935056 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_39280 4935069 4936466 gene locus_tag LOCUS_39290 4935069 4936466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39290 4936783 4937034 gene locus_tag LOCUS_39300 4936783 4937034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 4937416 4937216 gene locus_tag LOCUS_39310 4937416 4937216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 4938875 4937925 gene locus_tag LOCUS_39320 4938875 4937925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 4939441 4939022 gene locus_tag LOCUS_39330 4939441 4939022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 4940903 4939575 gene locus_tag LOCUS_39340 4940903 4939575 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_39340 4941622 4941008 gene locus_tag LOCUS_39350 4941622 4941008 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_39350 4942417 4941698 gene locus_tag LOCUS_39360 4942417 4941698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 4942762 4944063 gene locus_tag LOCUS_39370 4942762 4944063 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_39370 4944417 4944214 gene locus_tag LOCUS_39380 4944417 4944214 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_39380 4945060 4944422 gene locus_tag LOCUS_39390 4945060 4944422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 4945266 4945514 gene locus_tag LOCUS_39400 4945266 4945514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 4945580 4948189 gene locus_tag LOCUS_39410 4945580 4948189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 4948916 4948350 gene locus_tag LOCUS_39420 4948916 4948350 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_39420 4949379 4949056 gene locus_tag LOCUS_39430 4949379 4949056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 4950644 4949538 gene locus_tag LOCUS_39440 gene recF 4950644 4949538 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_39440 4950792 4951739 gene locus_tag LOCUS_39450 gene pdhA 4950792 4951739 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_39450 4951873 4952583 gene locus_tag LOCUS_39460 4951873 4952583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 4952935 4952750 gene locus_tag LOCUS_39470 4952935 4952750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 4953116 4952892 gene locus_tag LOCUS_39480 4953116 4952892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 4953535 4953149 gene locus_tag LOCUS_39490 4953535 4953149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39490 4954124 4956481 gene locus_tag LOCUS_39500 4954124 4956481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_39500 4956577 4958970 gene locus_tag LOCUS_39510 4956577 4958970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39510 4959058 4961436 gene locus_tag LOCUS_39520 4959058 4961436 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39520 4962185 4961541 gene locus_tag LOCUS_39530 4962185 4961541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39530 4962952 4962158 gene locus_tag LOCUS_39540 4962952 4962158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39540 4963429 4965846 gene locus_tag LOCUS_39550 4963429 4965846 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39550 4965901 4968315 gene locus_tag LOCUS_39560 4965901 4968315 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39560 4968452 4970905 gene locus_tag LOCUS_39570 4968452 4970905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39570 4971038 4971868 gene locus_tag LOCUS_39580 4971038 4971868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 4971888 4972406 gene locus_tag LOCUS_39590 4971888 4972406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 4972647 4973216 gene locus_tag LOCUS_39600 4972647 4973216 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226992.1 protein_id gnl|my_center|LOCUS_39600 4973722 4973459 gene locus_tag LOCUS_39610 4973722 4973459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 4974365 4974727 gene locus_tag LOCUS_39620 4974365 4974727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 4974979 4975365 gene locus_tag LOCUS_39630 4974979 4975365 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404633.1 protein_id gnl|my_center|LOCUS_39630 4975767 4978127 gene locus_tag LOCUS_39640 4975767 4978127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_39640 4978427 4979218 gene locus_tag LOCUS_39650 4978427 4979218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 4979640 4981970 gene locus_tag LOCUS_39660 4979640 4981970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39660 4982356 4983762 gene locus_tag LOCUS_39670 4982356 4983762 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_39670 4984284 4984751 gene locus_tag LOCUS_39680 4984284 4984751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 4984820 4985380 gene locus_tag LOCUS_39690 4984820 4985380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 4985465 4985845 gene locus_tag LOCUS_39700 4985465 4985845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 4986309 4986818 gene locus_tag LOCUS_39710 4986309 4986818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 4986948 4987178 gene locus_tag LOCUS_39720 4986948 4987178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4987168 4987512 gene locus_tag LOCUS_39730 4987168 4987512 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_39730 4987844 4988176 gene locus_tag LOCUS_39740 4987844 4988176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 4988326 4988619 gene locus_tag LOCUS_39750 4988326 4988619 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_39750 4988630 4988986 gene locus_tag LOCUS_39760 4988630 4988986 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_39760 4989248 4989706 gene locus_tag LOCUS_39770 4989248 4989706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39770 4990008 4989727 gene locus_tag LOCUS_39780 4990008 4989727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 4990125 4990607 gene locus_tag LOCUS_39790 4990125 4990607 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143451.1 protein_id gnl|my_center|LOCUS_39790 4992432 4991143 gene locus_tag LOCUS_39800 4992432 4991143 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073644.1 protein_id gnl|my_center|LOCUS_39800 4993649 4993987 gene locus_tag LOCUS_39810 4993649 4993987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39810 4994133 4995239 gene locus_tag LOCUS_39820 4994133 4995239 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_39820 4995375 4995935 gene locus_tag LOCUS_39830 4995375 4995935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 4996528 4996154 gene locus_tag LOCUS_39840 4996528 4996154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 4996682 4997590 gene locus_tag LOCUS_39850 4996682 4997590 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_39850 4997844 4998311 gene locus_tag LOCUS_39860 4997844 4998311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 4998453 4998827 gene locus_tag LOCUS_39870 4998453 4998827 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_39870 4998934 4999392 gene locus_tag LOCUS_39880 4998934 4999392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 5000222 4999710 gene locus_tag LOCUS_39890 5000222 4999710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 5000426 5000283 gene locus_tag LOCUS_39900 5000426 5000283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 5001301 5000426 gene locus_tag LOCUS_39910 5001301 5000426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 5002018 5005059 gene locus_tag LOCUS_39920 5002018 5005059 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_39920 5005089 5006627 gene locus_tag LOCUS_39930 5005089 5006627 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_39930 5007384 5008592 gene locus_tag LOCUS_39940 5007384 5008592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 5009135 5012035 gene locus_tag LOCUS_39950 5009135 5012035 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_39950 5012236 5012571 gene locus_tag LOCUS_39960 5012236 5012571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 5013633 5012743 gene locus_tag LOCUS_39970 5013633 5012743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 5013827 5013630 gene locus_tag LOCUS_39980 5013827 5013630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 5016004 5014697 gene locus_tag LOCUS_39990 5016004 5014697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_39990 5016701 5016057 gene locus_tag LOCUS_40000 gene eda 5016701 5016057 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_40000 5017711 5016698 gene locus_tag LOCUS_40010 5017711 5016698 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090023.1 protein_id gnl|my_center|LOCUS_40010 5018241 5019266 gene locus_tag LOCUS_40020 5018241 5019266 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227893.1 protein_id gnl|my_center|LOCUS_40020 5019436 5020677 gene locus_tag LOCUS_40030 gene rspA 5019436 5020677 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 protein_id gnl|my_center|LOCUS_40030 5020800 5022056 gene locus_tag LOCUS_40040 gene dgoD 5020800 5022056 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_40040 5022723 5025854 gene locus_tag LOCUS_40050 5022723 5025854 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_40050 5025876 5027456 gene locus_tag LOCUS_40060 5025876 5027456 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150090626.1 protein_id gnl|my_center|LOCUS_40060 5027534 5028895 gene locus_tag LOCUS_40070 5027534 5028895 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691039.1 protein_id gnl|my_center|LOCUS_40070 5029052 5032144 gene locus_tag LOCUS_40080 5029052 5032144 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_40080 5032166 5033632 gene locus_tag LOCUS_40090 5032166 5033632 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_40090 5033737 5035194 gene locus_tag LOCUS_40100 5033737 5035194 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_40100 5035628 5036620 gene locus_tag LOCUS_40110 5035628 5036620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 5036624 5038858 gene locus_tag LOCUS_40120 5036624 5038858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 5039403 5038969 gene locus_tag LOCUS_40130 5039403 5038969 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622221.1 protein_id gnl|my_center|LOCUS_40130 5040030 5040905 gene locus_tag LOCUS_40140 5040030 5040905 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_40140 5041403 5041900 gene locus_tag LOCUS_40150 5041403 5041900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 5042020 5042571 gene locus_tag LOCUS_40160 5042020 5042571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 5042666 5043220 gene locus_tag LOCUS_40170 5042666 5043220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 5044719 5043946 gene locus_tag LOCUS_40180 5044719 5043946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 5044975 5044706 gene locus_tag LOCUS_40190 5044975 5044706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 5045601 5045020 gene locus_tag LOCUS_40200 5045601 5045020 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_40200 5045765 5046730 gene locus_tag LOCUS_40210 5045765 5046730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 5046876 5047427 gene locus_tag LOCUS_40220 5046876 5047427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 5048738 5047587 gene locus_tag LOCUS_40230 5048738 5047587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 5049193 5049909 gene locus_tag LOCUS_40240 5049193 5049909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 5050559 5050134 gene locus_tag LOCUS_40250 5050559 5050134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 5051125 5050592 gene locus_tag LOCUS_40260 5051125 5050592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 5053811 5051424 gene locus_tag LOCUS_40270 5053811 5051424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40270 5056210 5054609 gene locus_tag LOCUS_40280 5056210 5054609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 5056499 5058826 gene locus_tag LOCUS_40290 5056499 5058826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 5058910 5059671 gene locus_tag LOCUS_40300 5058910 5059671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 5060723 5060064 gene locus_tag LOCUS_40310 5060723 5060064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 5061285 5060725 gene locus_tag LOCUS_40320 5061285 5060725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 5061725 5062570 gene locus_tag LOCUS_40330 5061725 5062570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 5063123 5063932 gene locus_tag LOCUS_40340 5063123 5063932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40340 5063978 5067211 gene locus_tag LOCUS_40350 5063978 5067211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 5067830 5072155 gene locus_tag LOCUS_40360 5067830 5072155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 5072356 5073885 gene locus_tag LOCUS_40370 5072356 5073885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 5074256 5075467 gene locus_tag LOCUS_40380 5074256 5075467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 5078382 5075980 gene locus_tag LOCUS_40390 5078382 5075980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40390 5080953 5078482 gene locus_tag LOCUS_40400 5080953 5078482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_40400 5083338 5080981 gene locus_tag LOCUS_40410 5083338 5080981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_40410 5083932 5084771 gene locus_tag LOCUS_40420 5083932 5084771 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839268.1 protein_id gnl|my_center|LOCUS_40420 5084956 5085393 gene locus_tag LOCUS_40430 5084956 5085393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 5088142 5085857 gene locus_tag LOCUS_40440 5088142 5085857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 5088520 5088155 gene locus_tag LOCUS_40450 5088520 5088155 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_40450 5091064 5088662 gene locus_tag LOCUS_40460 5091064 5088662 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40460 5093530 5091122 gene locus_tag LOCUS_40470 5093530 5091122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_40470 5095944 5093581 gene locus_tag LOCUS_40480 5095944 5093581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40480 5098396 5095988 gene locus_tag LOCUS_40490 5098396 5095988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40490 5099228 5100322 gene locus_tag LOCUS_40500 5099228 5100322 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_40500 5100306 5101160 gene locus_tag LOCUS_40510 gene ilvE 5100306 5101160 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583718.1 protein_id gnl|my_center|LOCUS_40510 5102287 5101157 gene locus_tag LOCUS_40520 5102287 5101157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 5103765 5105783 gene locus_tag LOCUS_40530 5103765 5105783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 5105788 5106537 gene locus_tag LOCUS_40540 5105788 5106537 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_40540 5107187 5107564 gene locus_tag LOCUS_40550 5107187 5107564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 5108132 5108785 gene locus_tag LOCUS_40560 5108132 5108785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 5109008 5110795 gene locus_tag LOCUS_40570 5109008 5110795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 5113470 5111050 gene locus_tag LOCUS_40580 5113470 5111050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40580 5115912 5113609 gene locus_tag LOCUS_40590 5115912 5113609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40590 5118479 5116056 gene locus_tag LOCUS_40600 5118479 5116056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40600 5121010 5118647 gene locus_tag LOCUS_40610 5121010 5118647 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_40610 5123456 5121129 gene locus_tag LOCUS_40620 5123456 5121129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40620 5124214 5124059 gene locus_tag LOCUS_40630 5124214 5124059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 5125201 5124695 gene locus_tag LOCUS_40640 5125201 5124695 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_40640 5125910 5125335 gene locus_tag LOCUS_40650 5125910 5125335 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_40650 5126327 5125929 gene locus_tag LOCUS_40660 5126327 5125929 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_40660 5126799 5126311 gene locus_tag LOCUS_40670 5126799 5126311 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_40670 5127129 5126806 gene locus_tag LOCUS_40680 5127129 5126806 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529706.1 protein_id gnl|my_center|LOCUS_40680 5128345 5127659 gene locus_tag LOCUS_40690 5128345 5127659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40690 5130270 5128351 gene locus_tag LOCUS_40700 5130270 5128351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40700 5130734 5130282 gene locus_tag LOCUS_40710 5130734 5130282 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230242.1 protein_id gnl|my_center|LOCUS_40710 5131632 5131054 gene locus_tag LOCUS_40720 5131632 5131054 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_40720 5132025 5131642 gene locus_tag LOCUS_40730 5132025 5131642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 5132356 5132138 gene locus_tag LOCUS_40740 5132356 5132138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 5132837 5132310 gene locus_tag LOCUS_40750 5132837 5132310 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_40750 5133855 5133118 gene locus_tag LOCUS_40760 5133855 5133118 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974415.1 protein_id gnl|my_center|LOCUS_40760 5134502 5133933 gene locus_tag LOCUS_40770 5134502 5133933 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_40770 5135541 5135083 gene locus_tag LOCUS_40780 5135541 5135083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 5136264 5135803 gene locus_tag LOCUS_40790 5136264 5135803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 5136876 5136430 gene locus_tag LOCUS_40800 5136876 5136430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 5137500 5137030 gene locus_tag LOCUS_40810 5137500 5137030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 5138175 5137618 gene locus_tag LOCUS_40820 5138175 5137618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 5139659 5138370 gene locus_tag LOCUS_40830 5139659 5138370 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_40830 5140679 5139900 gene locus_tag LOCUS_40840 5140679 5139900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 5141728 5141099 gene locus_tag LOCUS_40850 5141728 5141099 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_40850 5142314 5141940 gene locus_tag LOCUS_40860 5142314 5141940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 5144711 5142339 gene locus_tag LOCUS_40870 5144711 5142339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_40870 5146691 5145279 gene locus_tag LOCUS_40880 5146691 5145279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 5149275 5146864 gene locus_tag LOCUS_40890 5149275 5146864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40890 5151400 5149952 gene locus_tag LOCUS_40900 5151400 5149952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 5151866 5151612 gene locus_tag LOCUS_40910 5151866 5151612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 5152092 5151850 gene locus_tag LOCUS_40920 5152092 5151850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 5153402 5152383 gene locus_tag LOCUS_40930 5153402 5152383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 5153744 5155387 gene locus_tag LOCUS_40940 5153744 5155387 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_40940 5156206 5155460 gene locus_tag LOCUS_40950 5156206 5155460 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140159.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40950 5161664 5156496 gene locus_tag LOCUS_40960 5161664 5156496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 5162329 5161679 gene locus_tag LOCUS_40970 5162329 5161679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 5162779 5163615 gene locus_tag LOCUS_40980 5162779 5163615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 5163856 5166552 gene locus_tag LOCUS_40990 5163856 5166552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 5167129 5166719 gene locus_tag LOCUS_41000 5167129 5166719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 5167761 5167120 gene locus_tag LOCUS_41010 5167761 5167120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 5170526 5168220 gene locus_tag LOCUS_41020 5170526 5168220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_41020 5172574 5170865 gene locus_tag LOCUS_41030 5172574 5170865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 5175125 5172657 gene locus_tag LOCUS_41040 5175125 5172657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_41040 5175782 5177035 gene locus_tag LOCUS_41050 5175782 5177035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 5177204 5177560 gene locus_tag LOCUS_41060 5177204 5177560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 5180172 5177755 gene locus_tag LOCUS_41070 5180172 5177755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_41070 5180946 5180254 gene locus_tag LOCUS_41080 5180946 5180254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_41080 5182376 5181114 gene locus_tag LOCUS_41090 5182376 5181114 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_41090 5184027 5182690 gene locus_tag LOCUS_41100 5184027 5182690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104951.1 protein_id gnl|my_center|LOCUS_41100 5184501 5185016 gene locus_tag LOCUS_41110 5184501 5185016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057175.1 protein_id gnl|my_center|LOCUS_41110 5185727 5185548 gene locus_tag LOCUS_41120 5185727 5185548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 5187039 5185744 gene locus_tag LOCUS_41130 5187039 5185744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 5187236 5189497 gene locus_tag LOCUS_41140 5187236 5189497 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_41140 5189774 5189616 gene locus_tag LOCUS_41150 5189774 5189616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 5190249 5190761 gene locus_tag LOCUS_41160 5190249 5190761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 5190867 5192198 gene locus_tag LOCUS_41170 5190867 5192198 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_41170 5194807 5192216 gene locus_tag LOCUS_41180 5194807 5192216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 5195438 5195629 gene locus_tag LOCUS_41190 5195438 5195629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 5195677 5195937 gene locus_tag LOCUS_41200 5195677 5195937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 5196617 5196030 gene locus_tag LOCUS_41210 5196617 5196030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 5196759 5196556 gene locus_tag LOCUS_41220 5196759 5196556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 5196922 5197383 gene locus_tag LOCUS_41230 5196922 5197383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 5199236 5197485 gene locus_tag LOCUS_41240 5199236 5197485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 5199704 5200927 gene locus_tag LOCUS_41250 5199704 5200927 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072448.1 protein_id gnl|my_center|LOCUS_41250 5201527 5204310 gene locus_tag LOCUS_41260 5201527 5204310 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898759.1 protein_id gnl|my_center|LOCUS_41260 5204799 5206676 gene locus_tag LOCUS_41270 5204799 5206676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 5209568 5206710 gene locus_tag LOCUS_41280 5209568 5206710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157307892.1 protein_id gnl|my_center|LOCUS_41280 5209887 5211254 gene locus_tag LOCUS_41290 5209887 5211254 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_41290 5211285 5212658 gene locus_tag LOCUS_41300 5211285 5212658 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_41300 5212762 5212965 gene locus_tag LOCUS_41310 5212762 5212965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 5212962 5213111 gene locus_tag LOCUS_41320 5212962 5213111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 5213116 5213403 gene locus_tag LOCUS_41330 5213116 5213403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 5214102 5213404 gene locus_tag LOCUS_41340 5214102 5213404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 5214371 5214132 gene locus_tag LOCUS_41350 5214371 5214132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 5215754 5215122 gene locus_tag LOCUS_41360 5215754 5215122 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 protein_id gnl|my_center|LOCUS_41360 5216467 5215778 gene locus_tag LOCUS_41370 5216467 5215778 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920670.1 protein_id gnl|my_center|LOCUS_41370 5217529 5216801 gene locus_tag LOCUS_41380 5217529 5216801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 5217807 5218739 gene locus_tag LOCUS_41390 5217807 5218739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 5219336 5218920 gene locus_tag LOCUS_41400 5219336 5218920 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_41400 5219547 5219317 gene locus_tag LOCUS_41410 5219547 5219317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 5220612 5219614 gene locus_tag LOCUS_41420 5220612 5219614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963134.1 protein_id gnl|my_center|LOCUS_41420 5221455 5220748 gene locus_tag LOCUS_41430 5221455 5220748 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_41430 5223075 5221672 gene locus_tag LOCUS_41440 5223075 5221672 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_41440 5223378 5223869 gene locus_tag LOCUS_41450 5223378 5223869 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_41450 5224034 5224327 gene locus_tag LOCUS_41460 5224034 5224327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 5224676 5225224 gene locus_tag LOCUS_41470 5224676 5225224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 5225602 5227947 gene locus_tag LOCUS_41480 5225602 5227947 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_41480 5227969 5228757 gene locus_tag LOCUS_41490 5227969 5228757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 5229336 5228881 gene locus_tag LOCUS_41500 5229336 5228881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 5230130 5229498 gene locus_tag LOCUS_41510 5230130 5229498 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_41510 5231195 5230194 gene locus_tag LOCUS_41520 5231195 5230194 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_41520 5233517 5231208 gene locus_tag LOCUS_41530 gene rnr 5233517 5231208 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_41530 5235501 5233696 gene locus_tag LOCUS_41540 5235501 5233696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_41540 5236433 5235771 gene locus_tag LOCUS_41550 5236433 5235771 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_41550 5239958 5236557 gene locus_tag LOCUS_41560 gene ileS 5239958 5236557 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_41560 5240550 5241200 gene locus_tag LOCUS_41570 5240550 5241200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 5243092 5241278 gene locus_tag LOCUS_41580 5243092 5241278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 5244195 5243116 gene locus_tag LOCUS_41590 5244195 5243116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 5245910 5244339 gene locus_tag LOCUS_41600 5245910 5244339 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_41600 5246353 5247552 gene locus_tag LOCUS_41610 5246353 5247552 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085806.1 protein_id gnl|my_center|LOCUS_41610 5248091 5247624 gene locus_tag LOCUS_41620 5248091 5247624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 5248650 5248156 gene locus_tag LOCUS_41630 5248650 5248156 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126352787.1 protein_id gnl|my_center|LOCUS_41630 5250762 5249176 gene locus_tag LOCUS_41640 5250762 5249176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 5251811 5250918 gene locus_tag LOCUS_41650 5251811 5250918 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_41650 5253677 5251812 gene locus_tag LOCUS_41660 gene mnmG 5253677 5251812 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_41660 5254170 5253724 gene locus_tag LOCUS_41670 gene ybeY 5254170 5253724 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_41670 5254570 5254163 gene locus_tag LOCUS_41680 5254570 5254163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 5257945 5254604 gene locus_tag LOCUS_41690 5257945 5254604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 5258891 5258118 gene locus_tag LOCUS_41700 5258891 5258118 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_41700 5259248 5258892 gene locus_tag LOCUS_41710 5259248 5258892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_41710 5259590 5259249 gene locus_tag LOCUS_41720 5259590 5259249 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_41720 5259703 5260407 gene locus_tag LOCUS_41730 5259703 5260407 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_41730 5261701 5260460 gene locus_tag LOCUS_41740 5261701 5260460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 5262774 5261761 gene locus_tag LOCUS_41750 5262774 5261761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 5262952 5265954 gene locus_tag LOCUS_41760 5262952 5265954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 5266614 5266285 gene locus_tag LOCUS_41770 5266614 5266285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 5267210 5266746 gene locus_tag LOCUS_41780 gene dinB 5267210 5266746 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234141.1 protein_id gnl|my_center|LOCUS_41780 5268476 5267304 gene locus_tag LOCUS_41790 5268476 5267304 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109096.1 protein_id gnl|my_center|LOCUS_41790 5269609 5268680 gene locus_tag LOCUS_41800 5269609 5268680 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031548.1 protein_id gnl|my_center|LOCUS_41800 5269803 5269988 gene locus_tag LOCUS_41810 5269803 5269988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 5270925 5270290 gene locus_tag LOCUS_41820 5270925 5270290 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_41820 5271174 5272154 gene locus_tag LOCUS_41830 5271174 5272154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 5273101 5272208 gene locus_tag LOCUS_41840 5273101 5272208 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_41840 5275811 5273265 gene locus_tag LOCUS_41850 gene hrpB 5275811 5273265 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169533525.1 protein_id gnl|my_center|LOCUS_41850 5275914 5276774 gene locus_tag LOCUS_41860 5275914 5276774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 5278037 5276853 gene locus_tag LOCUS_41870 5278037 5276853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 5278402 5278599 gene locus_tag LOCUS_41880 5278402 5278599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 5279007 5278792 gene locus_tag LOCUS_41890 5279007 5278792 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_41890 5279258 5281144 gene locus_tag LOCUS_41900 5279258 5281144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 5281884 5281219 gene locus_tag LOCUS_41910 5281884 5281219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 5282715 5282278 gene locus_tag LOCUS_41920 5282715 5282278 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_41920 5284011 5282851 gene locus_tag LOCUS_41930 5284011 5282851 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_41930 5285759 5284263 gene locus_tag LOCUS_41940 5285759 5284263 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 protein_id gnl|my_center|LOCUS_41940 5286529 5286194 gene locus_tag LOCUS_41950 5286529 5286194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 5288304 5286751 gene locus_tag LOCUS_41960 5288304 5286751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 5290489 5288705 gene locus_tag LOCUS_41970 5290489 5288705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964054.1 protein_id gnl|my_center|LOCUS_41970 5290773 5292437 gene locus_tag LOCUS_41980 5290773 5292437 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_41980 5293722 5292706 gene locus_tag LOCUS_41990 5293722 5292706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 5294448 5293933 gene locus_tag LOCUS_42000 5294448 5293933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 5295229 5294723 gene locus_tag LOCUS_42010 5295229 5294723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 5296999 5295893 gene locus_tag LOCUS_42020 5296999 5295893 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042596355.1 protein_id gnl|my_center|LOCUS_42020 5297415 5298968 gene locus_tag LOCUS_42030 5297415 5298968 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_42030 5299603 5299145 gene locus_tag LOCUS_42040 5299603 5299145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 5299830 5300321 gene locus_tag LOCUS_42050 5299830 5300321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 5300330 5300890 gene locus_tag LOCUS_42060 5300330 5300890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42060 5301085 5301621 gene locus_tag LOCUS_42070 5301085 5301621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42070 5303204 5301804 gene locus_tag LOCUS_42080 gene fumC 5303204 5301804 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_42080 5304135 5303566 gene locus_tag LOCUS_42090 5304135 5303566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 5304592 5305836 gene locus_tag LOCUS_42100 5304592 5305836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_42100 5305979 5306593 gene locus_tag LOCUS_42110 5305979 5306593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 5307134 5306745 gene locus_tag LOCUS_42120 5307134 5306745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 5308123 5307269 gene locus_tag LOCUS_42130 5308123 5307269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42130 5308434 5308141 gene locus_tag LOCUS_42140 5308434 5308141 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118081.1 protein_id gnl|my_center|LOCUS_42140 5308874 5310250 gene locus_tag LOCUS_42150 gene radA 5308874 5310250 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_42150 5310746 5311774 gene locus_tag LOCUS_42160 5310746 5311774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 5311977 5312396 gene locus_tag LOCUS_42170 5311977 5312396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 5312401 5313345 gene locus_tag LOCUS_42180 5312401 5313345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 5313804 5313472 gene locus_tag LOCUS_42190 5313804 5313472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 5314076 5314489 gene locus_tag LOCUS_42200 5314076 5314489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 5314753 5314565 gene locus_tag LOCUS_42210 5314753 5314565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 5315708 5314917 gene locus_tag LOCUS_42220 5315708 5314917 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_42220 5316885 5315806 gene locus_tag LOCUS_42230 5316885 5315806 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_42230 5317885 5317199 gene locus_tag LOCUS_42240 gene rsmI 5317885 5317199 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_42240 5318189 5317941 gene locus_tag LOCUS_42250 5318189 5317941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 5318437 5319294 gene locus_tag LOCUS_42260 5318437 5319294 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479707.1 protein_id gnl|my_center|LOCUS_42260 5319385 5319891 gene locus_tag LOCUS_42270 5319385 5319891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 5320094 5320330 gene locus_tag LOCUS_42280 5320094 5320330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 5320792 5324430 gene locus_tag LOCUS_42290 5320792 5324430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 5324653 5325927 gene locus_tag LOCUS_42300 5324653 5325927 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_42300 5325950 5326792 gene locus_tag LOCUS_42310 gene tatC 5325950 5326792 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_42310 5326882 5327331 gene locus_tag LOCUS_42320 gene rpiB 5326882 5327331 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_42320 5328833 5327469 gene locus_tag LOCUS_42330 5328833 5327469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 5329127 5329522 gene locus_tag LOCUS_42340 gene rbfA 5329127 5329522 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_42340 5329581 5330390 gene locus_tag LOCUS_42350 5329581 5330390 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_42350 5330704 5331927 gene locus_tag LOCUS_42360 5330704 5331927 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_42360 5332437 5332868 gene locus_tag LOCUS_42370 5332437 5332868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 5332826 5335396 gene locus_tag LOCUS_42380 5332826 5335396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 5336292 5335546 gene locus_tag LOCUS_42390 5336292 5335546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 5336631 5336347 gene locus_tag LOCUS_42400 5336631 5336347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_42400 5336765 5338240 gene locus_tag LOCUS_42410 gene crtI 5336765 5338240 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_42410 5338341 5338907 gene locus_tag LOCUS_42420 5338341 5338907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 5339421 5342846 gene locus_tag LOCUS_42430 5339421 5342846 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108709.1 protein_id gnl|my_center|LOCUS_42430 5342964 5344430 gene locus_tag LOCUS_42440 5342964 5344430 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787024.1 protein_id gnl|my_center|LOCUS_42440 5344451 5345335 gene locus_tag LOCUS_42450 5344451 5345335 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762851.1 protein_id gnl|my_center|LOCUS_42450 5345386 5346717 gene locus_tag LOCUS_42460 5345386 5346717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 5346897 5347598 gene locus_tag LOCUS_42470 gene sodA 5346897 5347598 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 protein_id gnl|my_center|LOCUS_42470 5347880 5348863 gene locus_tag LOCUS_42480 5347880 5348863 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_42480 5349200 5350327 gene locus_tag LOCUS_42490 5349200 5350327 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_42490 5350763 5350341 gene locus_tag LOCUS_42500 5350763 5350341 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_42500 5352241 5350760 gene locus_tag LOCUS_42510 5352241 5350760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 5352616 5353584 gene locus_tag LOCUS_42520 5352616 5353584 CDS product IS5-like element ISSod12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074424.1 protein_id gnl|my_center|LOCUS_42520 5354945 5353875 gene locus_tag LOCUS_42530 gene prfA 5354945 5353875 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_42530 5355205 5355888 gene locus_tag LOCUS_42540 5355205 5355888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 5356009 5356176 gene locus_tag LOCUS_42550 5356009 5356176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 5356379 5356705 gene locus_tag LOCUS_42560 5356379 5356705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 5357813 5356968 gene locus_tag LOCUS_42570 5357813 5356968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 5358766 5357861 gene locus_tag LOCUS_42580 5358766 5357861 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_42580 5359935 5358763 gene locus_tag LOCUS_42590 5359935 5358763 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770586.1 protein_id gnl|my_center|LOCUS_42590 5361781 5360234 gene locus_tag LOCUS_42600 5361781 5360234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 5364128 5361996 gene locus_tag LOCUS_42610 5364128 5361996 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_42610 5366189 5364690 gene locus_tag LOCUS_42620 5366189 5364690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 5367682 5366387 gene locus_tag LOCUS_42630 5367682 5366387 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 protein_id gnl|my_center|LOCUS_42630 5368483 5367887 gene locus_tag LOCUS_42640 5368483 5367887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 5370022 5368493 gene locus_tag LOCUS_42650 gene gpmI 5370022 5368493 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_42650 5370163 5370570 gene locus_tag LOCUS_42660 5370163 5370570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 5370809 5371669 gene locus_tag LOCUS_42670 gene nadC 5370809 5371669 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_42670 5371835 5372308 gene locus_tag LOCUS_42680 5371835 5372308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 5372442 5372741 gene locus_tag LOCUS_42690 5372442 5372741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 5372815 5373099 gene locus_tag LOCUS_42700 5372815 5373099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 5373817 5374554 gene locus_tag LOCUS_42710 5373817 5374554 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_42710 5374568 5375317 gene locus_tag LOCUS_42720 5374568 5375317 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130094389.1 protein_id gnl|my_center|LOCUS_42720 5375494 5375697 gene locus_tag LOCUS_42730 5375494 5375697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 5379819 5376028 gene locus_tag LOCUS_42740 5379819 5376028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 5380678 5380283 gene locus_tag LOCUS_42750 5380678 5380283 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003307318.1 protein_id gnl|my_center|LOCUS_42750 5381121 5380687 gene locus_tag LOCUS_42760 5381121 5380687 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598099.1 protein_id gnl|my_center|LOCUS_42760 5381983 5381312 gene locus_tag LOCUS_42770 5381983 5381312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 5382742 5382314 gene locus_tag LOCUS_42780 5382742 5382314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 5383127 5383813 gene locus_tag LOCUS_42790 5383127 5383813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 5383981 5384340 gene locus_tag LOCUS_42800 5383981 5384340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 5385444 5384404 gene locus_tag LOCUS_42810 5385444 5384404 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_42810 5387170 5385680 gene locus_tag LOCUS_42820 5387170 5385680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 5387907 5388101 gene locus_tag LOCUS_42830 5387907 5388101 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_42830 5388340 5388735 gene locus_tag LOCUS_42840 5388340 5388735 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_42840 5389082 5389537 gene locus_tag LOCUS_42850 5389082 5389537 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_42850 5389881 5390174 gene locus_tag LOCUS_42860 5389881 5390174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 5390784 5390254 gene locus_tag LOCUS_42870 5390784 5390254 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_42870 5391139 5391867 gene locus_tag LOCUS_42880 5391139 5391867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 5391874 5392239 gene locus_tag LOCUS_42890 5391874 5392239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 5392239 5392778 gene locus_tag LOCUS_42900 5392239 5392778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 5395250 5392872 gene locus_tag LOCUS_42910 5395250 5392872 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_42910 5396399 5395440 gene locus_tag LOCUS_42920 5396399 5395440 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_42920 5396789 5397097 gene locus_tag LOCUS_42930 5396789 5397097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 5397176 5397472 gene locus_tag LOCUS_42940 gene rpmA 5397176 5397472 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_42940 5398247 5399359 gene locus_tag LOCUS_42950 5398247 5399359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 5402109 5400208 gene locus_tag LOCUS_42960 5402109 5400208 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962713.1 protein_id gnl|my_center|LOCUS_42960 5402222 5402818 gene locus_tag LOCUS_42970 5402222 5402818 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_42970 5402805 5404172 gene locus_tag LOCUS_42980 5402805 5404172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 5404482 5404847 gene locus_tag LOCUS_42990 5404482 5404847 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403069.1 protein_id gnl|my_center|LOCUS_42990 5405331 5404960 gene locus_tag LOCUS_43000 5405331 5404960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783718.1 protein_id gnl|my_center|LOCUS_43000 5405797 5406264 gene locus_tag LOCUS_43010 5405797 5406264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 5406746 5406345 gene locus_tag LOCUS_43020 5406746 5406345 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800661.1 protein_id gnl|my_center|LOCUS_43020 5408148 5406832 gene locus_tag LOCUS_43030 5408148 5406832 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_43030 5409750 5408371 gene locus_tag LOCUS_43040 5409750 5408371 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272364.1 protein_id gnl|my_center|LOCUS_43040 5411271 5409928 gene locus_tag LOCUS_43050 5411271 5409928 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963804.1 protein_id gnl|my_center|LOCUS_43050 5416194 5411461 gene locus_tag LOCUS_43060 5416194 5411461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 5417617 5416586 gene locus_tag LOCUS_43070 5417617 5416586 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_43070 5418470 5417637 gene locus_tag LOCUS_43080 5418470 5417637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 5420030 5418579 gene locus_tag LOCUS_43090 5420030 5418579 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994208.1 protein_id gnl|my_center|LOCUS_43090 5421433 5420195 gene locus_tag LOCUS_43100 5421433 5420195 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_43100 5422773 5421661 gene locus_tag LOCUS_43110 5422773 5421661 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_43110 5424359 5423448 gene locus_tag LOCUS_43120 5424359 5423448 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_43120 5427943 5424440 gene locus_tag LOCUS_43130 5427943 5424440 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090339627.1 protein_id gnl|my_center|LOCUS_43130 5428491 5428715 gene locus_tag LOCUS_43140 5428491 5428715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 5429626 5428817 gene locus_tag LOCUS_43150 5429626 5428817 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_43150 5429774 5430628 gene locus_tag LOCUS_43160 5429774 5430628 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_43160 5431028 5431924 gene locus_tag LOCUS_43170 5431028 5431924 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_43170 5432915 5431944 gene locus_tag LOCUS_43180 5432915 5431944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 5433298 5433723 gene locus_tag LOCUS_43190 5433298 5433723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 5434288 5433806 gene locus_tag LOCUS_43200 5434288 5433806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 5435267 5434497 gene locus_tag LOCUS_43210 5435267 5434497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 5436650 5435487 gene locus_tag LOCUS_43220 5436650 5435487 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_43220 5437318 5436851 gene locus_tag LOCUS_43230 5437318 5436851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 5439262 5437349 gene locus_tag LOCUS_43240 5439262 5437349 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_43240 5439928 5439443 gene locus_tag LOCUS_43250 5439928 5439443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_43250 5441011 5440205 gene locus_tag LOCUS_43260 5441011 5440205 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_43260 5442391 5441207 gene locus_tag LOCUS_43270 5442391 5441207 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_43270 5442704 5442779 gene locus_tag LOCUS_t00420 5442704 5442779 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5443826 5442972 gene locus_tag LOCUS_43280 5443826 5442972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 5445616 5444054 gene locus_tag LOCUS_43290 5445616 5444054 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_43290 5446498 5445662 gene locus_tag LOCUS_43300 5446498 5445662 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_43300 5447467 5446670 gene locus_tag LOCUS_43310 5447467 5446670 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229010.1 protein_id gnl|my_center|LOCUS_43310 5451908 5447823 gene locus_tag LOCUS_43320 5451908 5447823 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_43320 5453565 5452672 gene locus_tag LOCUS_43330 5453565 5452672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 5454742 5453579 gene locus_tag LOCUS_43340 5454742 5453579 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_43340 5455655 5454747 gene locus_tag LOCUS_43350 5455655 5454747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 5457287 5455722 gene locus_tag LOCUS_43360 5457287 5455722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 5458569 5457628 gene locus_tag LOCUS_43370 5458569 5457628 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_43370 5459240 5460472 gene locus_tag LOCUS_43380 5459240 5460472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43380 5460487 5461461 gene locus_tag LOCUS_43390 5460487 5461461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43390 5461576 5462412 gene locus_tag LOCUS_43400 5461576 5462412 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_43400 5463521 5462583 gene locus_tag LOCUS_43410 5463521 5462583 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_43410 5464481 5463558 gene locus_tag LOCUS_43420 5464481 5463558 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_43420 5466067 5464520 gene locus_tag LOCUS_43430 5466067 5464520 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_43430 5467243 5466173 gene locus_tag LOCUS_43440 5467243 5466173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 5469222 5467519 gene locus_tag LOCUS_43450 5469222 5467519 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_43450 5472385 5469245 gene locus_tag LOCUS_43460 5472385 5469245 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_43460 5473308 5474642 gene locus_tag LOCUS_43470 5473308 5474642 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256802.1 protein_id gnl|my_center|LOCUS_43470 5475068 5474895 gene locus_tag LOCUS_43480 5475068 5474895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 5475146 5476594 gene locus_tag LOCUS_43490 5475146 5476594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 5478313 5476679 gene locus_tag LOCUS_43500 gene katX 5478313 5476679 CDS product catalase KatX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243042.1 protein_id gnl|my_center|LOCUS_43500 5479631 5478543 gene locus_tag LOCUS_43510 5479631 5478543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 5479791 5480165 gene locus_tag LOCUS_43520 5479791 5480165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 5480162 5480320 gene locus_tag LOCUS_43530 5480162 5480320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 5480314 5480751 gene locus_tag LOCUS_43540 5480314 5480751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 5480741 5481517 gene locus_tag LOCUS_43550 5480741 5481517 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_43550 5482508 5481585 gene locus_tag LOCUS_43560 5482508 5481585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 5483805 5482666 gene locus_tag LOCUS_43570 5483805 5482666 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_43570 5484831 5484151 gene locus_tag LOCUS_43580 5484831 5484151 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_43580 5485333 5484839 gene locus_tag LOCUS_43590 gene rfaE2 5485333 5484839 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_43590 5486369 5485314 gene locus_tag LOCUS_43600 5486369 5485314 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_43600 5486730 5486383 gene locus_tag LOCUS_43610 5486730 5486383 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_43610 5487687 5486839 gene locus_tag LOCUS_43620 gene panC 5487687 5486839 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_43620 5487828 5488646 gene locus_tag LOCUS_43630 5487828 5488646 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_43630 5488630 5490045 gene locus_tag LOCUS_43640 5488630 5490045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 5490092 5490856 gene locus_tag LOCUS_43650 5490092 5490856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43650 5490850 5491926 gene locus_tag LOCUS_43660 5490850 5491926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43660 5492147 5492533 gene locus_tag LOCUS_43670 5492147 5492533 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_43670 5493538 5492576 gene locus_tag LOCUS_43680 5493538 5492576 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_43680 5493765 5495303 gene locus_tag LOCUS_43690 gene gltX 5493765 5495303 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_43690 5495605 5495922 gene locus_tag LOCUS_43700 5495605 5495922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 5496000 5496764 gene locus_tag LOCUS_43710 5496000 5496764 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_43710 5498515 5497004 gene locus_tag LOCUS_43720 5498515 5497004 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_43720 5499338 5498607 gene locus_tag LOCUS_43730 gene lptB 5499338 5498607 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_43730 5499908 5499630 gene locus_tag LOCUS_43740 5499908 5499630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 5500116 5500502 gene locus_tag LOCUS_43750 5500116 5500502 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227644.1 protein_id gnl|my_center|LOCUS_43750 5500665 5502446 gene locus_tag LOCUS_43760 5500665 5502446 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_43760 5502680 5503600 gene locus_tag LOCUS_43770 5502680 5503600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 5505400 5503691 gene locus_tag LOCUS_43780 gene recJ 5505400 5503691 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_43780 5505733 5506410 gene locus_tag LOCUS_43790 5505733 5506410 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_43790 5506407 5507669 gene locus_tag LOCUS_43800 5506407 5507669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 5509539 5507779 gene locus_tag LOCUS_43810 5509539 5507779 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_43810 5511999 5509891 gene locus_tag LOCUS_43820 5511999 5509891 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_43820 5513754 5512435 gene locus_tag LOCUS_43830 5513754 5512435 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_43830 5514460 5514029 gene locus_tag LOCUS_43840 5514460 5514029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 5515914 5514613 gene locus_tag LOCUS_43850 5515914 5514613 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_43850 5516626 5515907 gene locus_tag LOCUS_43860 5516626 5515907 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_43860 5518550 5516718 gene locus_tag LOCUS_43870 5518550 5516718 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791757.1 protein_id gnl|my_center|LOCUS_43870 5519152 5518589 gene locus_tag LOCUS_43880 gene scpB 5519152 5518589 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_43880 5519543 5519160 gene locus_tag LOCUS_43890 5519543 5519160 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_43890 5519920 5520840 gene locus_tag LOCUS_43900 5519920 5520840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 5521870 5521388 gene locus_tag LOCUS_43910 gene ribH 5521870 5521388 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_43910 5522007 5522393 gene locus_tag LOCUS_43920 5522007 5522393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43920 5522426 5522650 gene locus_tag LOCUS_43930 5522426 5522650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 5522607 5522792 gene locus_tag LOCUS_43940 5522607 5522792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 5525643 5522866 gene locus_tag LOCUS_43950 5525643 5522866 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_43950 5525843 5526475 gene locus_tag LOCUS_43960 5525843 5526475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 5527060 5526647 gene locus_tag LOCUS_43970 5527060 5526647 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_43970 5527192 5528100 gene locus_tag LOCUS_43980 5527192 5528100 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723412.1 protein_id gnl|my_center|LOCUS_43980 5528464 5529837 gene locus_tag LOCUS_43990 5528464 5529837 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_43990 5529827 5531194 gene locus_tag LOCUS_44000 5529827 5531194 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_44000 5531543 5531295 gene locus_tag LOCUS_44010 5531543 5531295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 5531700 5532197 gene locus_tag LOCUS_44020 5531700 5532197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 5532430 5532723 gene locus_tag LOCUS_44030 5532430 5532723 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_44030 5532765 5533133 gene locus_tag LOCUS_44040 5532765 5533133 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_44040 5533489 5533875 gene locus_tag LOCUS_44050 5533489 5533875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 5534002 5534763 gene locus_tag LOCUS_44060 5534002 5534763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 5540899 5534948 gene locus_tag LOCUS_44070 5540899 5534948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 5541800 5543221 gene locus_tag LOCUS_44080 5541800 5543221 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_44080 5543459 5544481 gene locus_tag LOCUS_44090 5543459 5544481 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_44090 5545479 5546069 gene locus_tag LOCUS_44100 5545479 5546069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44100 5546165 5546344 gene locus_tag LOCUS_44110 5546165 5546344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 5546353 5546745 gene locus_tag LOCUS_44120 5546353 5546745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44120 5547213 5546992 gene locus_tag LOCUS_44130 5547213 5546992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 5547724 5547230 gene locus_tag LOCUS_44140 5547724 5547230 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_44140 5548307 5548005 gene locus_tag LOCUS_44150 5548307 5548005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531822.1 protein_id gnl|my_center|LOCUS_44150 5548817 5548560 gene locus_tag LOCUS_44160 5548817 5548560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 5549202 5549014 gene locus_tag LOCUS_44170 5549202 5549014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 5549693 5551408 gene locus_tag LOCUS_44180 gene kdpA 5549693 5551408 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963802.1 protein_id gnl|my_center|LOCUS_44180 5551615 5553657 gene locus_tag LOCUS_44190 gene kdpB 5551615 5553657 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963801.1 protein_id gnl|my_center|LOCUS_44190 5553937 5554512 gene locus_tag LOCUS_44200 5553937 5554512 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963800.1 protein_id gnl|my_center|LOCUS_44200 5555202 5556296 gene locus_tag LOCUS_44210 5555202 5556296 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_44210 5556425 5557552 gene locus_tag LOCUS_44220 5556425 5557552 CDS product two-component system sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963798.1 protein_id gnl|my_center|LOCUS_44220 5557552 5559315 gene locus_tag LOCUS_44230 5557552 5559315 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_44230 5559476 5561263 gene locus_tag LOCUS_44240 5559476 5561263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 5561644 5563596 gene locus_tag LOCUS_44250 5561644 5563596 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_44250 5563849 5563631 gene locus_tag LOCUS_44260 5563849 5563631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 5565274 5564219 gene locus_tag LOCUS_44270 gene leuB 5565274 5564219 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_44270 5565723 5566613 gene locus_tag LOCUS_44280 5565723 5566613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 5568045 5566891 gene locus_tag LOCUS_44290 5568045 5566891 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922308.1 protein_id gnl|my_center|LOCUS_44290 5569910 5568474 gene locus_tag LOCUS_44300 5569910 5568474 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_44300 5570867 5570262 gene locus_tag LOCUS_44310 5570867 5570262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 5571196 5570897 gene locus_tag LOCUS_44320 5571196 5570897 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_44320 5571831 5571193 gene locus_tag LOCUS_44330 5571831 5571193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303162.1 protein_id gnl|my_center|LOCUS_44330 5572354 5572602 gene locus_tag LOCUS_44340 5572354 5572602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 5573119 5573445 gene locus_tag LOCUS_44350 5573119 5573445 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_44350 5573453 5573938 gene locus_tag LOCUS_44360 5573453 5573938 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898141.1 protein_id gnl|my_center|LOCUS_44360 5574100 5574531 gene locus_tag LOCUS_44370 5574100 5574531 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407498.1 protein_id gnl|my_center|LOCUS_44370 5574959 5574666 gene locus_tag LOCUS_44380 5574959 5574666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 5575306 5576583 gene locus_tag LOCUS_44390 5575306 5576583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 5578396 5576891 gene locus_tag LOCUS_44400 5578396 5576891 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159678901.1 protein_id gnl|my_center|LOCUS_44400 5578498 5578815 gene locus_tag LOCUS_44410 5578498 5578815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 5579113 5579532 gene locus_tag LOCUS_44420 5579113 5579532 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707487.1 protein_id gnl|my_center|LOCUS_44420 5579827 5580351 gene locus_tag LOCUS_44430 5579827 5580351 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704154.1 protein_id gnl|my_center|LOCUS_44430 5581270 5581731 gene locus_tag LOCUS_44440 5581270 5581731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 5581872 5582351 gene locus_tag LOCUS_44450 5581872 5582351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 5582814 5583038 gene locus_tag LOCUS_44460 5582814 5583038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 5583059 5583538 gene locus_tag LOCUS_44470 5583059 5583538 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107259.1 protein_id gnl|my_center|LOCUS_44470 5584865 5583696 gene locus_tag LOCUS_44480 5584865 5583696 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_44480 5586702 5585191 gene locus_tag LOCUS_44490 5586702 5585191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44490 5588045 5586732 gene locus_tag LOCUS_44500 5588045 5586732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44500 5588210 5588689 gene locus_tag LOCUS_44510 5588210 5588689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 5588821 5589033 gene locus_tag LOCUS_44520 5588821 5589033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 5589151 5589438 gene locus_tag LOCUS_44530 5589151 5589438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 5589476 5593207 gene locus_tag LOCUS_44540 5589476 5593207 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_44540 5593613 5594518 gene locus_tag LOCUS_44550 5593613 5594518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 5595187 5594624 gene locus_tag LOCUS_44560 5595187 5594624 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_44560 5595476 5595240 gene locus_tag LOCUS_44570 5595476 5595240 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 protein_id gnl|my_center|LOCUS_44570 5595693 5595457 gene locus_tag LOCUS_44580 5595693 5595457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 5596674 5595883 gene locus_tag LOCUS_44590 5596674 5595883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 5597256 5596783 gene locus_tag LOCUS_44600 5597256 5596783 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_44600 5597954 5597376 gene locus_tag LOCUS_44610 5597954 5597376 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_44610 5598523 5599860 gene locus_tag LOCUS_44620 5598523 5599860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088462992.1 protein_id gnl|my_center|LOCUS_44620 5599933 5600334 gene locus_tag LOCUS_44630 5599933 5600334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 5600688 5602136 gene locus_tag LOCUS_44640 5600688 5602136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142959.1 protein_id gnl|my_center|LOCUS_44640 5602384 5605854 gene locus_tag LOCUS_44650 5602384 5605854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 5605987 5607345 gene locus_tag LOCUS_44660 5605987 5607345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 5607489 5609252 gene locus_tag LOCUS_44670 5607489 5609252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 5609466 5610125 gene locus_tag LOCUS_44680 5609466 5610125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 5610292 5612502 gene locus_tag LOCUS_44690 5610292 5612502 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_44690 5612581 5612766 gene locus_tag LOCUS_44700 5612581 5612766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 5612900 5613382 gene locus_tag LOCUS_44710 5612900 5613382 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096684.1 protein_id gnl|my_center|LOCUS_44710 5613824 5613516 gene locus_tag LOCUS_44720 5613824 5613516 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_44720 5616797 5614365 gene locus_tag LOCUS_44730 5616797 5614365 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_44730 5617607 5618524 gene locus_tag LOCUS_44740 5617607 5618524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 5619173 5618700 gene locus_tag LOCUS_44750 5619173 5618700 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_44750 5619191 5620858 gene locus_tag LOCUS_44760 gene pgi 5619191 5620858 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_44760 5621076 5621819 gene locus_tag LOCUS_44770 gene lipB 5621076 5621819 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_44770 5621803 5622210 gene locus_tag LOCUS_44780 5621803 5622210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_44780 5622358 5623380 gene locus_tag LOCUS_44790 5622358 5623380 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_44790 5623409 5624560 gene locus_tag LOCUS_44800 5623409 5624560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 5624628 5625419 gene locus_tag LOCUS_44810 5624628 5625419 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_44810 5625584 5626546 gene locus_tag LOCUS_44820 5625584 5626546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 5626703 5627785 gene locus_tag LOCUS_44830 5626703 5627785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 5627906 5628697 gene locus_tag LOCUS_44840 5627906 5628697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 5628747 5630330 gene locus_tag LOCUS_44850 5628747 5630330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 5630342 5631370 gene locus_tag LOCUS_44860 5630342 5631370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 5633636 5631423 gene locus_tag LOCUS_44870 5633636 5631423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 5635540 5633729 gene locus_tag LOCUS_44880 gene uvrC 5635540 5633729 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_44880 5637988 5635679 gene locus_tag LOCUS_44890 5637988 5635679 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_44890 5640988 5637992 gene locus_tag LOCUS_44900 5640988 5637992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 5641280 5641516 gene locus_tag LOCUS_44910 5641280 5641516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 5641705 5642088 gene locus_tag LOCUS_44920 5641705 5642088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 5642131 5643186 gene locus_tag LOCUS_44930 gene atpB 5642131 5643186 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_44930 5643224 5643493 gene locus_tag LOCUS_44940 5643224 5643493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 5643659 5644153 gene locus_tag LOCUS_44950 5643659 5644153 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_44950 5644234 5644794 gene locus_tag LOCUS_44960 gene atpH 5644234 5644794 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_44960 5644797 5646377 gene locus_tag LOCUS_44970 gene atpA 5644797 5646377 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_44970 5646502 5647398 gene locus_tag LOCUS_44980 gene atpG 5646502 5647398 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_44980 5647804 5649270 gene locus_tag LOCUS_44990 5647804 5649270 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_44990 5649379 5649942 gene locus_tag LOCUS_45000 5649379 5649942 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_45000 5650221 5651036 gene locus_tag LOCUS_45010 5650221 5651036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_45010 5652601 5651069 gene locus_tag LOCUS_45020 5652601 5651069 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_45020 5653913 5652711 gene locus_tag LOCUS_45030 5653913 5652711 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_45030 5654922 5654005 gene locus_tag LOCUS_45040 5654922 5654005 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_45040 5655563 5655012 gene locus_tag LOCUS_45050 5655563 5655012 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_45050 5656192 5655623 gene locus_tag LOCUS_45060 5656192 5655623 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_45060 5656751 5656245 gene locus_tag LOCUS_45070 gene ndhC 5656751 5656245 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_45070 5656981 5658405 gene locus_tag LOCUS_45080 5656981 5658405 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_45080 5658792 5659220 gene locus_tag LOCUS_45090 5658792 5659220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 5659291 5660445 gene locus_tag LOCUS_45100 5659291 5660445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 5661127 5660588 gene locus_tag LOCUS_45110 5661127 5660588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 5661455 5661691 gene locus_tag LOCUS_45120 5661455 5661691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 5662978 5662073 gene locus_tag LOCUS_45130 5662978 5662073 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202474.1 protein_id gnl|my_center|LOCUS_45130 5664188 5662980 gene locus_tag LOCUS_45140 5664188 5662980 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_45140 5665481 5664378 gene locus_tag LOCUS_45150 5665481 5664378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 5667447 5666227 gene locus_tag LOCUS_45160 5667447 5666227 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953461.1 protein_id gnl|my_center|LOCUS_45160 5669020 5667839 gene locus_tag LOCUS_45170 5669020 5667839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 5671026 5670010 gene locus_tag LOCUS_45180 5671026 5670010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 5672320 5671403 gene locus_tag LOCUS_45190 5672320 5671403 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_45190 5673314 5672427 gene locus_tag LOCUS_45200 5673314 5672427 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902760.1 protein_id gnl|my_center|LOCUS_45200 5675057 5673597 gene locus_tag LOCUS_45210 5675057 5673597 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_45210 5677659 5675317 gene locus_tag LOCUS_45220 5677659 5675317 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107358.1 protein_id gnl|my_center|LOCUS_45220 5678386 5677670 gene locus_tag LOCUS_45230 5678386 5677670 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766005.1 protein_id gnl|my_center|LOCUS_45230 5680735 5679485 gene locus_tag LOCUS_45240 5680735 5679485 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983670.1 protein_id gnl|my_center|LOCUS_45240 5681420 5681052 gene locus_tag LOCUS_45250 5681420 5681052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 5691376 5681672 gene locus_tag LOCUS_45260 5691376 5681672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 5692291 5692998 gene locus_tag LOCUS_45270 5692291 5692998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 5693061 5693873 gene locus_tag LOCUS_45280 5693061 5693873 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920429.1 protein_id gnl|my_center|LOCUS_45280 5693948 5694322 gene locus_tag LOCUS_45290 5693948 5694322 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258306.1 protein_id gnl|my_center|LOCUS_45290 5694905 5696443 gene locus_tag LOCUS_45300 gene lysS 5694905 5696443 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_45300 5697167 5696754 gene locus_tag LOCUS_45310 5697167 5696754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 5697688 5697287 gene locus_tag LOCUS_45320 5697688 5697287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 5697964 5698185 gene locus_tag LOCUS_45330 5697964 5698185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 5698244 5698612 gene locus_tag LOCUS_45340 5698244 5698612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 5699552 5698740 gene locus_tag LOCUS_45350 5699552 5698740 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_45350 5701416 5699764 gene locus_tag LOCUS_45360 gene recN 5701416 5699764 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_45360 5701647 5701420 gene locus_tag LOCUS_45370 5701647 5701420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 5702800 5701892 gene locus_tag LOCUS_45380 5702800 5701892 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_45380 5703449 5702793 gene locus_tag LOCUS_45390 5703449 5702793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45390 5703996 5703436 gene locus_tag LOCUS_45400 5703996 5703436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45400 5704328 5704005 gene locus_tag LOCUS_45410 5704328 5704005 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_45410 5705385 5704549 gene locus_tag LOCUS_45420 gene bamD 5705385 5704549 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_45420 5707057 5705462 gene locus_tag LOCUS_45430 5707057 5705462 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_45430 5707147 5708469 gene locus_tag LOCUS_45440 gene tilS 5707147 5708469 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_45440 5708723 5709667 gene locus_tag LOCUS_45450 gene mdh 5708723 5709667 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_45450 5710147 5710560 gene locus_tag LOCUS_45460 5710147 5710560 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_45460 5710683 5711903 gene locus_tag LOCUS_45470 5710683 5711903 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_45470 5712194 5712397 gene locus_tag LOCUS_45480 5712194 5712397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 5712943 5716611 gene locus_tag LOCUS_45490 5712943 5716611 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816917.1 protein_id gnl|my_center|LOCUS_45490 5716647 5717396 gene locus_tag LOCUS_45500 5716647 5717396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 5717900 5720959 gene locus_tag LOCUS_45510 5717900 5720959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 5721142 5721420 gene locus_tag LOCUS_45520 5721142 5721420 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_45520 5723364 5721679 gene locus_tag LOCUS_45530 5723364 5721679 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_45530 5725372 5724080 gene locus_tag LOCUS_45540 5725372 5724080 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_45540 5725684 5726817 gene locus_tag LOCUS_45550 5725684 5726817 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_45550 5726878 5728113 gene locus_tag LOCUS_45560 5726878 5728113 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_45560 5728261 5728905 gene locus_tag LOCUS_45570 5728261 5728905 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_45570 5730281 5729604 gene locus_tag LOCUS_45580 5730281 5729604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 5731235 5730597 gene locus_tag LOCUS_45590 5731235 5730597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 5731641 5733005 gene locus_tag LOCUS_45600 5731641 5733005 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811709.1 protein_id gnl|my_center|LOCUS_45600 5734078 5735742 gene locus_tag LOCUS_45610 5734078 5735742 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_45610 5735775 5736056 gene locus_tag LOCUS_45620 5735775 5736056 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343080.1 protein_id gnl|my_center|LOCUS_45620 5736744 5737478 gene locus_tag LOCUS_45630 5736744 5737478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963857.1 protein_id gnl|my_center|LOCUS_45630 5737626 5738393 gene locus_tag LOCUS_45640 5737626 5738393 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_45640 5738732 5739712 gene locus_tag LOCUS_45650 5738732 5739712 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_45650 5739868 5740536 gene locus_tag LOCUS_45660 5739868 5740536 CDS product DUF4184 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963374.1 protein_id gnl|my_center|LOCUS_45660 5741660 5742397 gene locus_tag LOCUS_45670 5741660 5742397 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_45670 5742435 5744756 gene locus_tag LOCUS_45680 5742435 5744756 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202999.1 protein_id gnl|my_center|LOCUS_45680 5744811 5746109 gene locus_tag LOCUS_45690 5744811 5746109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 5746163 5747095 gene locus_tag LOCUS_45700 5746163 5747095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 5747550 5748524 gene locus_tag LOCUS_45710 5747550 5748524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 5748558 5749688 gene locus_tag LOCUS_45720 5748558 5749688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 5749690 5750283 gene locus_tag LOCUS_45730 5749690 5750283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 5750294 5751568 gene locus_tag LOCUS_45740 5750294 5751568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 5751604 5752977 gene locus_tag LOCUS_45750 5751604 5752977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 5752984 5754135 gene locus_tag LOCUS_45760 5752984 5754135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 5754272 5754802 gene locus_tag LOCUS_45770 5754272 5754802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 5754866 5755195 gene locus_tag LOCUS_45780 5754866 5755195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 5755195 5756100 gene locus_tag LOCUS_45790 5755195 5756100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 5756356 5756676 gene locus_tag LOCUS_45800 5756356 5756676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 5757446 5757865 gene locus_tag LOCUS_45810 5757446 5757865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 5757881 5758702 gene locus_tag LOCUS_45820 5757881 5758702 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_45820 5758734 5759147 gene locus_tag LOCUS_45830 5758734 5759147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 5759256 5759756 gene locus_tag LOCUS_45840 5759256 5759756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45840 5759828 5760499 gene locus_tag LOCUS_45850 5759828 5760499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45850 5760800 5761669 gene locus_tag LOCUS_45860 5760800 5761669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_45860 5761681 5761947 gene locus_tag LOCUS_45870 5761681 5761947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 5761977 5762954 gene locus_tag LOCUS_45880 5761977 5762954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45880 5763115 5764209 gene locus_tag LOCUS_45890 5763115 5764209 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407602.1 protein_id gnl|my_center|LOCUS_45890 5764356 5764925 gene locus_tag LOCUS_45900 5764356 5764925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 5764938 5765921 gene locus_tag LOCUS_45910 5764938 5765921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 5766173 5766814 gene locus_tag LOCUS_45920 5766173 5766814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 5766855 5767556 gene locus_tag LOCUS_45930 5766855 5767556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 5767589 5768524 gene locus_tag LOCUS_45940 5767589 5768524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 5769638 5768622 gene locus_tag LOCUS_45950 5769638 5768622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 5769894 5770847 gene locus_tag LOCUS_45960 5769894 5770847 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289068.1 protein_id gnl|my_center|LOCUS_45960 5772294 5771500 gene locus_tag LOCUS_45970 5772294 5771500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 5772921 5772685 gene locus_tag LOCUS_45980 5772921 5772685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 5772884 5774650 gene locus_tag LOCUS_45990 5772884 5774650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 5774797 5776596 gene locus_tag LOCUS_46000 5774797 5776596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 5777830 5776898 gene locus_tag LOCUS_46010 5777830 5776898 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_46010 5778943 5777831 gene locus_tag LOCUS_46020 gene gmd 5778943 5777831 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036868.1 protein_id gnl|my_center|LOCUS_46020 5779552 5780946 gene locus_tag LOCUS_46030 5779552 5780946 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 protein_id gnl|my_center|LOCUS_46030 5782067 5781636 gene locus_tag LOCUS_46040 5782067 5781636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46040 5782660 5782001 gene locus_tag LOCUS_46050 5782660 5782001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46050 5783005 5783913 gene locus_tag LOCUS_46060 gene rfbD 5783005 5783913 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_46060 5784130 5785104 gene locus_tag LOCUS_46070 5784130 5785104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 5785215 5786069 gene locus_tag LOCUS_46080 5785215 5786069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 5786227 5787102 gene locus_tag LOCUS_46090 5786227 5787102 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_46090 5787324 5789264 gene locus_tag LOCUS_46100 5787324 5789264 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090974988.1 protein_id gnl|my_center|LOCUS_46100 5789386 5792352 gene locus_tag LOCUS_46110 5789386 5792352 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_46110 5793370 5792636 gene locus_tag LOCUS_46120 gene rlmB 5793370 5792636 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_46120 5794575 5793373 gene locus_tag LOCUS_46130 5794575 5793373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 5797808 5794842 gene locus_tag LOCUS_46140 5797808 5794842 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_46140 5798491 5797934 gene locus_tag LOCUS_46150 5798491 5797934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 5799693 5798935 gene locus_tag LOCUS_46160 5799693 5798935 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_46160 5799795 5800124 gene locus_tag LOCUS_46170 gene rsfS 5799795 5800124 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_46170 5800185 5800766 gene locus_tag LOCUS_46180 5800185 5800766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 5800742 5802328 gene locus_tag LOCUS_46190 5800742 5802328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46190 5802357 5803007 gene locus_tag LOCUS_46200 5802357 5803007 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192015.1 protein_id gnl|my_center|LOCUS_46200 5803012 5803761 gene locus_tag LOCUS_46210 5803012 5803761 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_46210 5803808 5804593 gene locus_tag LOCUS_46220 5803808 5804593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 5804815 5805972 gene locus_tag LOCUS_46230 5804815 5805972 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966646.1 protein_id gnl|my_center|LOCUS_46230 5806374 5807693 gene locus_tag LOCUS_46240 gene ricT 5806374 5807693 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_46240 5807693 5808169 gene locus_tag LOCUS_46250 gene gldH 5807693 5808169 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766923.1 protein_id gnl|my_center|LOCUS_46250 5808435 5809343 gene locus_tag LOCUS_46260 5808435 5809343 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_46260 5809712 5809521 gene locus_tag LOCUS_46270 5809712 5809521 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_46270 5810358 5812025 gene locus_tag LOCUS_46280 5810358 5812025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 5812216 5812584 gene locus_tag LOCUS_tm00010 5812216 5812584 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5813339 5812896 gene locus_tag LOCUS_46290 5813339 5812896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 5814142 5813423 gene locus_tag LOCUS_46300 5814142 5813423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 5814699 5816456 gene locus_tag LOCUS_46310 5814699 5816456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 5816747 5817163 gene locus_tag LOCUS_46320 5816747 5817163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 5817840 5821019 gene locus_tag LOCUS_46330 5817840 5821019 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_46330 5822206 5821394 gene locus_tag LOCUS_46340 5822206 5821394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 5823319 5822438 gene locus_tag LOCUS_46350 5823319 5822438 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 protein_id gnl|my_center|LOCUS_46350 5826320 5823852 gene locus_tag LOCUS_46360 5826320 5823852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 5827046 5827249 gene locus_tag LOCUS_46370 5827046 5827249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46370 5827402 5828253 gene locus_tag LOCUS_46380 5827402 5828253 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_46380 5828988 5829479 gene locus_tag LOCUS_46390 5828988 5829479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 5830855 5829539 gene locus_tag LOCUS_46400 gene ltrA 5830855 5829539 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_46400 5831398 5831754 gene locus_tag LOCUS_46410 5831398 5831754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 5832675 5832154 gene locus_tag LOCUS_46420 5832675 5832154 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143257.1 protein_id gnl|my_center|LOCUS_46420 5833150 5832764 gene locus_tag LOCUS_46430 5833150 5832764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 5838033 5833486 gene locus_tag LOCUS_46440 5838033 5833486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 5839034 5838618 gene locus_tag LOCUS_46450 5839034 5838618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 5839463 5839732 gene locus_tag LOCUS_46460 5839463 5839732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 5840434 5839997 gene locus_tag LOCUS_46470 5840434 5839997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 5840876 5841490 gene locus_tag LOCUS_46480 5840876 5841490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 5841858 5844038 gene locus_tag LOCUS_46490 5841858 5844038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 5844358 5845233 gene locus_tag LOCUS_46500 5844358 5845233 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391020.1 protein_id gnl|my_center|LOCUS_46500 5845502 5847046 gene locus_tag LOCUS_46510 5845502 5847046 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256483.1 protein_id gnl|my_center|LOCUS_46510 5848114 5847671 gene locus_tag LOCUS_46520 5848114 5847671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46520 5848299 5848538 gene locus_tag LOCUS_46530 5848299 5848538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 5849868 5848552 gene locus_tag LOCUS_46540 gene ltrA 5849868 5848552 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_46540 5850654 5850914 gene locus_tag LOCUS_46550 5850654 5850914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 5851021 5851791 gene locus_tag LOCUS_46560 5851021 5851791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439798.1 protein_id gnl|my_center|LOCUS_46560 5851951 5852232 gene locus_tag LOCUS_46570 5851951 5852232 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_46570 5852238 5852537 gene locus_tag LOCUS_46580 5852238 5852537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 5852646 5853245 gene locus_tag LOCUS_46590 5852646 5853245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 5853327 5853752 gene locus_tag LOCUS_46600 5853327 5853752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 5853912 5854844 gene locus_tag LOCUS_46610 5853912 5854844 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_46610 5854936 5855700 gene locus_tag LOCUS_46620 5854936 5855700 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_46620 5855872 5856087 gene locus_tag LOCUS_46630 5855872 5856087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 5856127 5857026 gene locus_tag LOCUS_46640 5856127 5857026 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_46640 5857039 5857962 gene locus_tag LOCUS_46650 5857039 5857962 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_46650 5859058 5859432 gene locus_tag LOCUS_46660 5859058 5859432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 5859429 5860316 gene locus_tag LOCUS_46670 5859429 5860316 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_46670 5860594 5861520 gene locus_tag LOCUS_46680 5860594 5861520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 5863340 5862219 gene locus_tag LOCUS_46690 5863340 5862219 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201948.1 protein_id gnl|my_center|LOCUS_46690 5863887 5863618 gene locus_tag LOCUS_46700 5863887 5863618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 5864512 5863859 gene locus_tag LOCUS_46710 5864512 5863859 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_46710 5864852 5866639 gene locus_tag LOCUS_46720 5864852 5866639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 5866917 5867075 gene locus_tag LOCUS_46730 5866917 5867075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 5867971 5867102 gene locus_tag LOCUS_46740 5867971 5867102 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202094.1 protein_id gnl|my_center|LOCUS_46740 5868067 5869008 gene locus_tag LOCUS_46750 5868067 5869008 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204065824.1 protein_id gnl|my_center|LOCUS_46750 5870547 5869669 gene locus_tag LOCUS_46760 5870547 5869669 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692220.1 protein_id gnl|my_center|LOCUS_46760 5870755 5870994 gene locus_tag LOCUS_46770 5870755 5870994 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192803789.1 protein_id gnl|my_center|LOCUS_46770 5870996 5872246 gene locus_tag LOCUS_46780 gene fabF 5870996 5872246 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_46780 5873913 5872297 gene locus_tag LOCUS_46790 5873913 5872297 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_46790 5874060 5875430 gene locus_tag LOCUS_46800 5874060 5875430 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_46800 5877868 5875520 gene locus_tag LOCUS_46810 5877868 5875520 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_46810 5878283 5879506 gene locus_tag LOCUS_46820 5878283 5879506 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_46820 5879610 5881529 gene locus_tag LOCUS_46830 5879610 5881529 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_46830 5882555 5881692 gene locus_tag LOCUS_46840 gene ephM 5882555 5881692 CDS product epoxide hydrolase EphM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243419.1 protein_id gnl|my_center|LOCUS_46840 5882746 5883351 gene locus_tag LOCUS_46850 5882746 5883351 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_46850 5884281 5883604 gene locus_tag LOCUS_46860 5884281 5883604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 5885077 5884388 gene locus_tag LOCUS_46870 5885077 5884388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 5886459 5885119 gene locus_tag LOCUS_46880 5886459 5885119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 5886995 5886453 gene locus_tag LOCUS_46890 5886995 5886453 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962711.1 protein_id gnl|my_center|LOCUS_46890 5887716 5887384 gene locus_tag LOCUS_46900 5887716 5887384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 5887979 5887698 gene locus_tag LOCUS_46910 5887979 5887698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 5889602 5888421 gene locus_tag LOCUS_46920 5889602 5888421 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073169944.1 protein_id gnl|my_center|LOCUS_46920 5891417 5889771 gene locus_tag LOCUS_46930 5891417 5889771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 5892067 5891588 gene locus_tag LOCUS_46940 gene ispF 5892067 5891588 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_46940 5894228 5892759 gene locus_tag LOCUS_46950 5894228 5892759 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_46950 5894845 5895525 gene locus_tag LOCUS_46960 5894845 5895525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 5896613 5895546 gene locus_tag LOCUS_46970 5896613 5895546 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244349.1 protein_id gnl|my_center|LOCUS_46970 5896888 5897352 gene locus_tag LOCUS_46980 5896888 5897352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 5898446 5901532 gene locus_tag LOCUS_46990 5898446 5901532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 5902271 5901627 gene locus_tag LOCUS_47000 5902271 5901627 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446319.1 protein_id gnl|my_center|LOCUS_47000 5903328 5902534 gene locus_tag LOCUS_47010 5903328 5902534 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763945.1 protein_id gnl|my_center|LOCUS_47010 5903860 5904852 gene locus_tag LOCUS_47020 5903860 5904852 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_47020 5904914 5906263 gene locus_tag LOCUS_47030 5904914 5906263 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_47030 5907171 5907773 gene locus_tag LOCUS_47040 5907171 5907773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 5909086 5908460 gene locus_tag LOCUS_47050 gene paiB 5909086 5908460 CDS product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 protein_id gnl|my_center|LOCUS_47050 5910116 5909328 gene locus_tag LOCUS_47060 5910116 5909328 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_47060 5910746 5910315 gene locus_tag LOCUS_47070 5910746 5910315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 5911023 5910772 gene locus_tag LOCUS_47080 5911023 5910772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 5912509 5911154 gene locus_tag LOCUS_47090 5912509 5911154 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 protein_id gnl|my_center|LOCUS_47090 5913949 5912708 gene locus_tag LOCUS_47100 5913949 5912708 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 protein_id gnl|my_center|LOCUS_47100 5914641 5914267 gene locus_tag LOCUS_47110 5914641 5914267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 5914840 5914679 gene locus_tag LOCUS_47120 5914840 5914679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 5915691 5915233 gene locus_tag LOCUS_47130 5915691 5915233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 5916263 5915703 gene locus_tag LOCUS_47140 5916263 5915703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 5916647 5916474 gene locus_tag LOCUS_47150 5916647 5916474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 5917151 5916747 gene locus_tag LOCUS_47160 5917151 5916747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 5917314 5917475 gene locus_tag LOCUS_47170 5917314 5917475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 5918552 5918046 gene locus_tag LOCUS_47180 5918552 5918046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 5919684 5918905 gene locus_tag LOCUS_47190 gene budA 5919684 5918905 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244457.1 protein_id gnl|my_center|LOCUS_47190 5920272 5919775 gene locus_tag LOCUS_47200 5920272 5919775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 5921928 5920402 gene locus_tag LOCUS_47210 5921928 5920402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 5922838 5922215 gene locus_tag LOCUS_47220 5922838 5922215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 5923634 5923068 gene locus_tag LOCUS_47230 5923634 5923068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 5924670 5924230 gene locus_tag LOCUS_47240 5924670 5924230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 5926232 5924940 gene locus_tag LOCUS_47250 5926232 5924940 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_47250 5926920 5926255 gene locus_tag LOCUS_47260 5926920 5926255 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_47260 5927874 5926951 gene locus_tag LOCUS_47270 5927874 5926951 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355185.1 protein_id gnl|my_center|LOCUS_47270 5928715 5928218 gene locus_tag LOCUS_47280 5928715 5928218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 5929554 5928715 gene locus_tag LOCUS_47290 5929554 5928715 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337347.1 protein_id gnl|my_center|LOCUS_47290 5930471 5929800 gene locus_tag LOCUS_47300 5930471 5929800 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_47300 5931565 5930693 gene locus_tag LOCUS_47310 5931565 5930693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 5933173 5932325 gene locus_tag LOCUS_47320 5933173 5932325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 5934156 5933278 gene locus_tag LOCUS_47330 5934156 5933278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 5934845 5934459 gene locus_tag LOCUS_47340 5934845 5934459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 5934992 5935768 gene locus_tag LOCUS_47350 5934992 5935768 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886838.1 protein_id gnl|my_center|LOCUS_47350 5936978 5935932 gene locus_tag LOCUS_47360 5936978 5935932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 5937706 5936993 gene locus_tag LOCUS_47370 5937706 5936993 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_47370 5938471 5937710 gene locus_tag LOCUS_47380 5938471 5937710 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_47380 5939398 5938811 gene locus_tag LOCUS_47390 5939398 5938811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 5940498 5939449 gene locus_tag LOCUS_47400 gene selD 5940498 5939449 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211671.1 protein_id gnl|my_center|LOCUS_47400 5941730 5940669 gene locus_tag LOCUS_47410 gene mnmH 5941730 5940669 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937872.1 protein_id gnl|my_center|LOCUS_47410 5942454 5941741 gene locus_tag LOCUS_47420 5942454 5941741 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_47420 5942815 5943276 gene locus_tag LOCUS_47430 5942815 5943276 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_47430 5943284 5943802 gene locus_tag LOCUS_47440 5943284 5943802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 5943853 5944422 gene locus_tag LOCUS_47450 5943853 5944422 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262695.1 protein_id gnl|my_center|LOCUS_47450 5944454 5945212 gene locus_tag LOCUS_47460 5944454 5945212 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_47460 5945294 5945959 gene locus_tag LOCUS_47470 5945294 5945959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 5946026 5947411 gene locus_tag LOCUS_47480 5946026 5947411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 5947420 5948301 gene locus_tag LOCUS_47490 5947420 5948301 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_47490 5948413 5949453 gene locus_tag LOCUS_47500 5948413 5949453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 5949726 5950229 gene locus_tag LOCUS_47510 5949726 5950229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 5950510 5951265 gene locus_tag LOCUS_47520 5950510 5951265 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839293.1 protein_id gnl|my_center|LOCUS_47520 5951265 5953748 gene locus_tag LOCUS_47530 gene bamA 5951265 5953748 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100221.1 protein_id gnl|my_center|LOCUS_47530 5953872 5954573 gene locus_tag LOCUS_47540 5953872 5954573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 5954600 5955238 gene locus_tag LOCUS_47550 5954600 5955238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 5955438 5956475 gene locus_tag LOCUS_47560 5955438 5956475 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_47560 5958236 5956605 gene locus_tag LOCUS_47570 5958236 5956605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 5959238 5958282 gene locus_tag LOCUS_47580 5959238 5958282 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_47580 5959633 5959388 gene locus_tag LOCUS_47590 5959633 5959388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 5960587 5959775 gene locus_tag LOCUS_47600 5960587 5959775 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_47600 5961121 5960594 gene locus_tag LOCUS_47610 5961121 5960594 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_47610 5961739 5961134 gene locus_tag LOCUS_47620 5961739 5961134 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964299.1 protein_id gnl|my_center|LOCUS_47620 5962681 5961764 gene locus_tag LOCUS_47630 5962681 5961764 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_47630 5963671 5963273 gene locus_tag LOCUS_47640 5963671 5963273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47640 5964075 5963698 gene locus_tag LOCUS_47650 5964075 5963698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47650 5964383 5965774 gene locus_tag LOCUS_47660 gene glmM 5964383 5965774 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_47660 5965932 5967083 gene locus_tag LOCUS_47670 5965932 5967083 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_47670 5967235 5968191 gene locus_tag LOCUS_47680 5967235 5968191 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_47680 5968205 5968768 gene locus_tag LOCUS_47690 5968205 5968768 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366891.1 protein_id gnl|my_center|LOCUS_47690 5968848 5969315 gene locus_tag LOCUS_47700 5968848 5969315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 5970402 5969374 gene locus_tag LOCUS_47710 gene hemH 5970402 5969374 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444837.1 protein_id gnl|my_center|LOCUS_47710 5970791 5971681 gene locus_tag LOCUS_47720 gene era 5970791 5971681 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_47720 5971872 5973182 gene locus_tag LOCUS_47730 gene der 5971872 5973182 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_47730 5974560 5974027 gene locus_tag LOCUS_47740 5974560 5974027 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197262.1 protein_id gnl|my_center|LOCUS_47740 5974852 5975592 gene locus_tag LOCUS_47750 5974852 5975592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329945.1 protein_id gnl|my_center|LOCUS_47750 5975595 5976383 gene locus_tag LOCUS_47760 5975595 5976383 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531519.1 protein_id gnl|my_center|LOCUS_47760 5976570 5977754 gene locus_tag LOCUS_47770 5976570 5977754 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_47770 5977765 5978394 gene locus_tag LOCUS_47780 5977765 5978394 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_47780 5978901 5978599 gene locus_tag LOCUS_47790 5978901 5978599 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_47790 5979055 5979885 gene locus_tag LOCUS_47800 5979055 5979885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 5980870 5980115 gene locus_tag LOCUS_47810 5980870 5980115 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080909.1 protein_id gnl|my_center|LOCUS_47810 5981922 5980984 gene locus_tag LOCUS_47820 5981922 5980984 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764892.1 protein_id gnl|my_center|LOCUS_47820 5982418 5981927 gene locus_tag LOCUS_47830 5982418 5981927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 5982556 5983176 gene locus_tag LOCUS_47840 5982556 5983176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 5983709 5983344 gene locus_tag LOCUS_47850 5983709 5983344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 5984234 5984494 gene locus_tag LOCUS_47860 5984234 5984494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 5984675 5985229 gene locus_tag LOCUS_47870 5984675 5985229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 5986227 5987573 gene locus_tag LOCUS_47880 5986227 5987573 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226269.1 protein_id gnl|my_center|LOCUS_47880 5987790 5988419 gene locus_tag LOCUS_47890 5987790 5988419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 5988600 5990021 gene locus_tag LOCUS_47900 5988600 5990021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 5990153 5990680 gene locus_tag LOCUS_47910 5990153 5990680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 5990685 5990882 gene locus_tag LOCUS_47920 5990685 5990882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 5990920 5991726 gene locus_tag LOCUS_47930 5990920 5991726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 5991864 5992712 gene locus_tag LOCUS_47940 5991864 5992712 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_47940 5994110 5993322 gene locus_tag LOCUS_47950 5994110 5993322 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_47950 5994422 5994850 gene locus_tag LOCUS_47960 5994422 5994850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 5995083 5996285 gene locus_tag LOCUS_47970 5995083 5996285 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_47970 5996496 5996696 gene locus_tag LOCUS_47980 5996496 5996696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 5997376 5996765 gene locus_tag LOCUS_47990 5997376 5996765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 5998274 5997912 gene locus_tag LOCUS_48000 5998274 5997912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 5999169 5998366 gene locus_tag LOCUS_48010 gene murQ 5999169 5998366 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_48010 5999548 5999300 gene locus_tag LOCUS_48020 5999548 5999300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 6000754 5999603 gene locus_tag LOCUS_48030 6000754 5999603 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_48030 6000963 6002723 gene locus_tag LOCUS_48040 6000963 6002723 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_48040 6003024 6003461 gene locus_tag LOCUS_48050 6003024 6003461 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_48050 6003606 6006008 gene locus_tag LOCUS_48060 6003606 6006008 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_48060 6006137 6006433 gene locus_tag LOCUS_48070 6006137 6006433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 6006711 6007889 gene locus_tag LOCUS_48080 6006711 6007889 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_48080 6007922 6008119 gene locus_tag LOCUS_48090 6007922 6008119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48090 6008316 6010100 gene locus_tag LOCUS_48100 6008316 6010100 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_48100 6010751 6010939 gene locus_tag LOCUS_48110 6010751 6010939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 6013035 6010942 gene locus_tag LOCUS_48120 gene recG 6013035 6010942 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_48120 6013722 6013165 gene locus_tag LOCUS_48130 gene gldD 6013722 6013165 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_48130 6015112 6013736 gene locus_tag LOCUS_48140 6015112 6013736 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_48140 6015583 6015140 gene locus_tag LOCUS_48150 6015583 6015140 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_48150 6016718 6015633 gene locus_tag LOCUS_48160 gene mutY 6016718 6015633 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_48160 6016921 6017226 gene locus_tag LOCUS_48170 6016921 6017226 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_48170 6017273 6018169 gene locus_tag LOCUS_48180 6017273 6018169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 6018424 6020037 gene locus_tag LOCUS_48190 6018424 6020037 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_48190 6020817 6020146 gene locus_tag LOCUS_48200 6020817 6020146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 6020890 6021888 gene locus_tag LOCUS_48210 gene gldB 6020890 6021888 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_48210 6022207 6022629 gene locus_tag LOCUS_48220 6022207 6022629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 6022785 6025646 gene locus_tag LOCUS_48230 6022785 6025646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 6026726 6025746 gene locus_tag LOCUS_48240 gene hemB 6026726 6025746 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_48240 6027671 6026823 gene locus_tag LOCUS_48250 6027671 6026823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 6028468 6027830 gene locus_tag LOCUS_48260 6028468 6027830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 6029818 6029042 gene locus_tag LOCUS_48270 6029818 6029042 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_48270 6030798 6029815 gene locus_tag LOCUS_48280 6030798 6029815 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 protein_id gnl|my_center|LOCUS_48280 6031519 6031193 gene locus_tag LOCUS_48290 6031519 6031193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 6032043 6031621 gene locus_tag LOCUS_48300 6032043 6031621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 6032851 6032057 gene locus_tag LOCUS_48310 6032851 6032057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 6034802 6033564 gene locus_tag LOCUS_48320 gene rocD 6034802 6033564 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_48320 6035336 6035575 gene locus_tag LOCUS_48330 gene rpmB 6035336 6035575 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_48330 6035586 6037019 gene locus_tag LOCUS_48340 gene pepP 6035586 6037019 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444958.1 protein_id gnl|my_center|LOCUS_48340 6037765 6037073 gene locus_tag LOCUS_48350 6037765 6037073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 6038235 6038417 gene locus_tag LOCUS_48360 gene rpmG 6038235 6038417 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_48360 6038420 6038575 gene locus_tag LOCUS_48370 6038420 6038575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 6038693 6039649 gene locus_tag LOCUS_48380 gene ftsY 6038693 6039649 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_48380 6040260 6039817 gene locus_tag LOCUS_48390 6040260 6039817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 6040626 6041975 gene locus_tag LOCUS_48400 gene rimO 6040626 6041975 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_48400 6042307 6043869 gene locus_tag LOCUS_48410 gene bshC 6042307 6043869 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_48410 6043873 6044451 gene locus_tag LOCUS_48420 6043873 6044451 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_48420 6044515 6045159 gene locus_tag LOCUS_48430 6044515 6045159 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448622.1 protein_id gnl|my_center|LOCUS_48430 6045254 6045703 gene locus_tag LOCUS_48440 6045254 6045703 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_48440 6045775 6046881 gene locus_tag LOCUS_48450 6045775 6046881 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_48450 6047045 6048082 gene locus_tag LOCUS_48460 6047045 6048082 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 protein_id gnl|my_center|LOCUS_48460 6048968 6048249 gene locus_tag LOCUS_48470 6048968 6048249 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 protein_id gnl|my_center|LOCUS_48470 6049232 6049510 gene locus_tag LOCUS_48480 6049232 6049510 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173256.1 protein_id gnl|my_center|LOCUS_48480 6050050 6049577 gene locus_tag LOCUS_48490 6050050 6049577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 6050269 6050745 gene locus_tag LOCUS_48500 6050269 6050745 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902391.1 protein_id gnl|my_center|LOCUS_48500 6051202 6053685 gene locus_tag LOCUS_48510 6051202 6053685 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598584.1 protein_id gnl|my_center|LOCUS_48510 6053893 6054297 gene locus_tag LOCUS_48520 6053893 6054297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 6054529 6054888 gene locus_tag LOCUS_48530 6054529 6054888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 6056415 6054973 gene locus_tag LOCUS_48540 6056415 6054973 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_48540 6056814 6057491 gene locus_tag LOCUS_48550 6056814 6057491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 6057596 6058780 gene locus_tag LOCUS_48560 6057596 6058780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 6058780 6060612 gene locus_tag LOCUS_48570 6058780 6060612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 6060929 6061828 gene locus_tag LOCUS_48580 6060929 6061828 CDS product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_48580 6063671 6061953 gene locus_tag LOCUS_48590 6063671 6061953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 6067672 6063707 gene locus_tag LOCUS_48600 6067672 6063707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 6068326 6069237 gene locus_tag LOCUS_48610 6068326 6069237 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039181.1 protein_id gnl|my_center|LOCUS_48610 6069388 6070878 gene locus_tag LOCUS_48620 gene glpK 6069388 6070878 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_48620 6070903 6071484 gene locus_tag LOCUS_48630 6070903 6071484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 6071521 6072249 gene locus_tag LOCUS_48640 6071521 6072249 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_48640 6074220 6073399 gene locus_tag LOCUS_48650 6074220 6073399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 6075902 6075636 gene locus_tag LOCUS_48660 6075902 6075636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 6077067 6076213 gene locus_tag LOCUS_48670 6077067 6076213 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_48670 6078287 6077250 gene locus_tag LOCUS_48680 6078287 6077250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 6078663 6079337 gene locus_tag LOCUS_48690 6078663 6079337 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_48690 6080825 6079452 gene locus_tag LOCUS_48700 6080825 6079452 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_48700 6081594 6080944 gene locus_tag LOCUS_48710 gene plsY 6081594 6080944 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296995.1 protein_id gnl|my_center|LOCUS_48710 6087263 6081855 gene locus_tag LOCUS_48720 6087263 6081855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 6088116 6087283 gene locus_tag LOCUS_48730 gene prmA 6088116 6087283 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_48730 6088616 6088227 gene locus_tag LOCUS_48740 6088616 6088227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 6089094 6088720 gene locus_tag LOCUS_48750 6089094 6088720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48750 6089447 6089079 gene locus_tag LOCUS_48760 6089447 6089079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48760 6089818 6089570 gene locus_tag LOCUS_48770 6089818 6089570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48770 6090240 6089947 gene locus_tag LOCUS_48780 6090240 6089947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 6093174 6090361 gene locus_tag LOCUS_48790 gene uvrA 6093174 6090361 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_48790 6093091 6093282 gene locus_tag LOCUS_48800 6093091 6093282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 6093446 6093598 gene locus_tag LOCUS_48810 6093446 6093598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 6095038 6093788 gene locus_tag LOCUS_48820 6095038 6093788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195122.1 protein_id gnl|my_center|LOCUS_48820 6095337 6095744 gene locus_tag LOCUS_48830 6095337 6095744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 6096114 6096893 gene locus_tag LOCUS_48840 6096114 6096893 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963721.1 protein_id gnl|my_center|LOCUS_48840 6096951 6097409 gene locus_tag LOCUS_48850 6096951 6097409 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_48850 6097487 6097966 gene locus_tag LOCUS_48860 6097487 6097966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 6098382 6097978 gene locus_tag LOCUS_48870 6098382 6097978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 6101224 6098729 gene locus_tag LOCUS_48880 6101224 6098729 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_48880 6101486 6102421 gene locus_tag LOCUS_48890 6101486 6102421 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_48890 6102725 6103213 gene locus_tag LOCUS_48900 6102725 6103213 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_48900 6103332 6104108 gene locus_tag LOCUS_48910 gene xth 6103332 6104108 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974311.1 protein_id gnl|my_center|LOCUS_48910 6104738 6104208 gene locus_tag LOCUS_48920 6104738 6104208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 6105935 6105009 gene locus_tag LOCUS_48930 6105935 6105009 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_48930 6108451 6106052 gene locus_tag LOCUS_48940 6108451 6106052 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_48940 6108931 6108647 gene locus_tag LOCUS_48950 6108931 6108647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 6109680 6108928 gene locus_tag LOCUS_48960 6109680 6108928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 6112806 6109993 gene locus_tag LOCUS_48970 gene carB 6112806 6109993 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_48970 6113508 6113053 gene locus_tag LOCUS_48980 6113508 6113053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 6114041 6115057 gene locus_tag LOCUS_48990 6114041 6115057 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_48990 6116718 6115240 gene locus_tag LOCUS_49000 6116718 6115240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 6118059 6117649 gene locus_tag LOCUS_49010 6118059 6117649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 6118319 6118089 gene locus_tag LOCUS_49020 6118319 6118089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 6119239 6121911 gene locus_tag LOCUS_49030 6119239 6121911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479899.1 protein_id gnl|my_center|LOCUS_49030 6122136 6122498 gene locus_tag LOCUS_49040 6122136 6122498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49040 6122582 6123247 gene locus_tag LOCUS_49050 6122582 6123247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49050 6123719 6125563 gene locus_tag LOCUS_49060 6123719 6125563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 6125563 6125958 gene locus_tag LOCUS_49070 6125563 6125958 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_49070 6127478 6126471 gene locus_tag LOCUS_49080 6127478 6126471 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969626.1 protein_id gnl|my_center|LOCUS_49080 6127708 6127490 gene locus_tag LOCUS_49090 6127708 6127490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 6128115 6128726 gene locus_tag LOCUS_49100 gene wrbA 6128115 6128726 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889473.1 protein_id gnl|my_center|LOCUS_49100 6129162 6132119 gene locus_tag LOCUS_49110 6129162 6132119 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_49110 6132602 6133231 gene locus_tag LOCUS_49120 6132602 6133231 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 protein_id gnl|my_center|LOCUS_49120 6133238 6133933 gene locus_tag LOCUS_49130 6133238 6133933 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_49130 6133979 6134380 gene locus_tag LOCUS_49140 6133979 6134380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 6134656 6135042 gene locus_tag LOCUS_49150 6134656 6135042 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_49150 6135391 6135095 gene locus_tag LOCUS_49160 6135391 6135095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 6135534 6135373 gene locus_tag LOCUS_49170 6135534 6135373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49170 6137393 6135969 gene locus_tag LOCUS_49180 6137393 6135969 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_49180 6138352 6141513 gene locus_tag LOCUS_49190 6138352 6141513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 6144824 6141828 gene locus_tag LOCUS_49200 6144824 6141828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 6145348 6145914 gene locus_tag LOCUS_49210 6145348 6145914 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_49210 6145907 6147286 gene locus_tag LOCUS_49220 6145907 6147286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 6146318 6146240 gene locus_tag LOCUS_t00430 6146318 6146240 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6147409 6147801 gene locus_tag LOCUS_49230 6147409 6147801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 6147994 6148557 gene locus_tag LOCUS_49240 6147994 6148557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 6148576 6149505 gene locus_tag LOCUS_49250 6148576 6149505 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_49250 6149953 6152919 gene locus_tag LOCUS_49260 6149953 6152919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 6153075 6154259 gene locus_tag LOCUS_49270 6153075 6154259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 6155415 6154477 gene locus_tag LOCUS_49280 6155415 6154477 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_49280 6155856 6155665 gene locus_tag LOCUS_49290 6155856 6155665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 6156545 6157306 gene locus_tag LOCUS_49300 6156545 6157306 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_49300 6157478 6157777 gene locus_tag LOCUS_49310 6157478 6157777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49310 6157823 6158092 gene locus_tag LOCUS_49320 6157823 6158092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49320 6158315 6158701 gene locus_tag LOCUS_49330 6158315 6158701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 6158870 6160723 gene locus_tag LOCUS_49340 6158870 6160723 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027553.1 protein_id gnl|my_center|LOCUS_49340 6161451 6161158 gene locus_tag LOCUS_49350 6161451 6161158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 6161763 6161990 gene locus_tag LOCUS_49360 6161763 6161990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 6163458 6162154 gene locus_tag LOCUS_49370 6163458 6162154 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189169.1 protein_id gnl|my_center|LOCUS_49370 6167197 6164378 gene locus_tag LOCUS_49380 6167197 6164378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 6168174 6167824 gene locus_tag LOCUS_49390 6168174 6167824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 6168499 6169023 gene locus_tag LOCUS_49400 6168499 6169023 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963890.1 protein_id gnl|my_center|LOCUS_49400 6169981 6169160 gene locus_tag LOCUS_49410 6169981 6169160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 6170761 6170414 gene locus_tag LOCUS_49420 6170761 6170414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 6171111 6171542 gene locus_tag LOCUS_49430 gene arfB 6171111 6171542 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_49430 6173412 6171673 gene locus_tag LOCUS_49440 6173412 6171673 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963842.1 protein_id gnl|my_center|LOCUS_49440 6173525 6173923 gene locus_tag LOCUS_49450 6173525 6173923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 6175167 6173986 gene locus_tag LOCUS_49460 6175167 6173986 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_49460 6175423 6176700 gene locus_tag LOCUS_49470 gene hemA 6175423 6176700 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_49470 6177342 6177968 gene locus_tag LOCUS_49480 6177342 6177968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 6177980 6178258 gene locus_tag LOCUS_49490 6177980 6178258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 6178634 6178320 gene locus_tag LOCUS_49500 6178634 6178320 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817201.1 protein_id gnl|my_center|LOCUS_49500 6178762 6179850 gene locus_tag LOCUS_49510 6178762 6179850 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_49510 6179865 6180194 gene locus_tag LOCUS_49520 6179865 6180194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 6180204 6180545 gene locus_tag LOCUS_49530 6180204 6180545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 6181944 6180676 gene locus_tag LOCUS_49540 6181944 6180676 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_49540 6184522 6182036 gene locus_tag LOCUS_49550 6184522 6182036 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964026.1 protein_id gnl|my_center|LOCUS_49550 6184753 6185388 gene locus_tag LOCUS_49560 6184753 6185388 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_49560 6187889 6185505 gene locus_tag LOCUS_49570 6187889 6185505 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_49570 6190744 6188939 gene locus_tag LOCUS_49580 gene typA 6190744 6188939 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_49580 6191007 6191555 gene locus_tag LOCUS_49590 6191007 6191555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 6191811 6192080 gene locus_tag LOCUS_49600 6191811 6192080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 6192086 6192472 gene locus_tag LOCUS_49610 6192086 6192472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 6193786 6192503 gene locus_tag LOCUS_49620 6193786 6192503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 6194899 6194150 gene locus_tag LOCUS_49630 6194899 6194150 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_49630 6194935 6195294 gene locus_tag LOCUS_49640 6194935 6195294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49640 6195342 6196217 gene locus_tag LOCUS_49650 6195342 6196217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49650 6196374 6197774 gene locus_tag LOCUS_49660 6196374 6197774 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_49660 6198292 6197897 gene locus_tag LOCUS_49670 6198292 6197897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 6198986 6200233 gene locus_tag LOCUS_49680 6198986 6200233 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939710.1 protein_id gnl|my_center|LOCUS_49680 6200254 6201711 gene locus_tag LOCUS_49690 6200254 6201711 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_49690 6201708 6202436 gene locus_tag LOCUS_49700 6201708 6202436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_49700 6202621 6202983 gene locus_tag LOCUS_49710 6202621 6202983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 6203070 6204326 gene locus_tag LOCUS_49720 6203070 6204326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_49720 6204323 6205522 gene locus_tag LOCUS_49730 6204323 6205522 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073485.1 protein_id gnl|my_center|LOCUS_49730 6206080 6207465 gene locus_tag LOCUS_49740 6206080 6207465 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_49740 6207473 6208750 gene locus_tag LOCUS_49750 6207473 6208750 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_49750 6209162 6209662 gene locus_tag LOCUS_49760 6209162 6209662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 6212396 6209748 gene locus_tag LOCUS_49770 6212396 6209748 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_49770 6212658 6213341 gene locus_tag LOCUS_49780 6212658 6213341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 6213526 6214101 gene locus_tag LOCUS_49790 6213526 6214101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 6214730 6214116 gene locus_tag LOCUS_49800 6214730 6214116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 6216174 6214900 gene locus_tag LOCUS_49810 gene serS 6216174 6214900 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_49810 6216450 6218528 gene locus_tag LOCUS_49820 gene rho 6216450 6218528 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798804.1 protein_id gnl|my_center|LOCUS_49820 6219467 6218586 gene locus_tag LOCUS_49830 6219467 6218586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 6220435 6219656 gene locus_tag LOCUS_49840 6220435 6219656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 6221413 6220451 gene locus_tag LOCUS_49850 6221413 6220451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 6221871 6222182 gene locus_tag LOCUS_49860 6221871 6222182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 6222979 6222248 gene locus_tag LOCUS_49870 6222979 6222248 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_49870 6223615 6223064 gene locus_tag LOCUS_49880 6223615 6223064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 6223873 6224154 gene locus_tag LOCUS_49890 6223873 6224154 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_49890 6224169 6224777 gene locus_tag LOCUS_49900 gene recR 6224169 6224777 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_49900 6225149 6225640 gene locus_tag LOCUS_49910 6225149 6225640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 6225854 6226315 gene locus_tag LOCUS_49920 6225854 6226315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 6226528 6227055 gene locus_tag LOCUS_49930 6226528 6227055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 6227287 6229242 gene locus_tag LOCUS_49940 6227287 6229242 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_49940 6229826 6229353 gene locus_tag LOCUS_49950 6229826 6229353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 6230226 6231440 gene locus_tag LOCUS_49960 6230226 6231440 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_49960 6231441 6232469 gene locus_tag LOCUS_49970 gene rfaE1 6231441 6232469 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_49970 6233076 6232498 gene locus_tag LOCUS_49980 6233076 6232498 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054459.1 protein_id gnl|my_center|LOCUS_49980 6233846 6233202 gene locus_tag LOCUS_49990 6233846 6233202 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303165.1 protein_id gnl|my_center|LOCUS_49990 6234014 6234970 gene locus_tag LOCUS_50000 6234014 6234970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 6234945 6235985 gene locus_tag LOCUS_50010 6234945 6235985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 6236001 6236360 gene locus_tag LOCUS_50020 gene folB 6236001 6236360 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_50020 6236435 6236617 gene locus_tag LOCUS_50030 6236435 6236617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 6237430 6236645 gene locus_tag LOCUS_50040 6237430 6236645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 6238580 6237579 gene locus_tag LOCUS_50050 gene meaB 6238580 6237579 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_50050 6239800 6238649 gene locus_tag LOCUS_50060 6239800 6238649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 6241155 6240523 gene locus_tag LOCUS_50070 6241155 6240523 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_50070 6241900 6241301 gene locus_tag LOCUS_50080 6241900 6241301 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726626.1 protein_id gnl|my_center|LOCUS_50080 6242572 6242018 gene locus_tag LOCUS_50090 6242572 6242018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 6242991 6242614 gene locus_tag LOCUS_50100 6242991 6242614 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944311.1 protein_id gnl|my_center|LOCUS_50100 6243429 6243229 gene locus_tag LOCUS_50110 6243429 6243229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 6243467 6244150 gene locus_tag LOCUS_50120 6243467 6244150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 6244799 6244308 gene locus_tag LOCUS_50130 6244799 6244308 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 protein_id gnl|my_center|LOCUS_50130 6245227 6244811 gene locus_tag LOCUS_50140 6245227 6244811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 6245721 6245365 gene locus_tag LOCUS_50150 6245721 6245365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 6247044 6245731 gene locus_tag LOCUS_50160 6247044 6245731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 6247165 6247037 gene locus_tag LOCUS_50170 6247165 6247037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 6249201 6247162 gene locus_tag LOCUS_50180 gene scpA 6249201 6247162 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_50180 6249619 6249831 gene locus_tag LOCUS_50190 6249619 6249831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 6251702 6249858 gene locus_tag LOCUS_50200 gene mutA 6251702 6249858 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_50200 6252273 6251902 gene locus_tag LOCUS_50210 6252273 6251902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 6252908 6253645 gene locus_tag LOCUS_50220 6252908 6253645 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546323.1 protein_id gnl|my_center|LOCUS_50220 6253768 6254556 gene locus_tag LOCUS_50230 6253768 6254556 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_50230 6254866 6255495 gene locus_tag LOCUS_50240 6254866 6255495 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763633.1 protein_id gnl|my_center|LOCUS_50240 6255744 6256676 gene locus_tag LOCUS_50250 6255744 6256676 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_50250 >Feature sequence2 1267 1581 gene locus_tag LOCUS_50260 1267 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50260 1578 1958 gene locus_tag LOCUS_50270 1578 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50270 2181 2363 gene locus_tag LOCUS_50280 2181 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50280 2347 2535 gene locus_tag LOCUS_50290 2347 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 2749 2949 gene locus_tag LOCUS_50300 2749 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 3006 3773 gene locus_tag LOCUS_50310 3006 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50310 3773 4114 gene locus_tag LOCUS_50320 3773 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 4120 5121 gene locus_tag LOCUS_50330 4120 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 5679 6287 gene locus_tag LOCUS_50340 5679 6287 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_50340 6611 7579 gene locus_tag LOCUS_50350 6611 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 7609 8661 gene locus_tag LOCUS_50360 7609 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 8663 9469 gene locus_tag LOCUS_50370 8663 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 9781 9942 gene locus_tag LOCUS_50380 9781 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 9988 11100 gene locus_tag LOCUS_50390 9988 11100 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_50390 11097 11759 gene locus_tag LOCUS_50400 11097 11759 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_50400 11905 12162 gene locus_tag LOCUS_50410 11905 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 12219 13100 gene locus_tag LOCUS_50420 12219 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50420 13534 13743 gene locus_tag LOCUS_50430 13534 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 14320 13736 gene locus_tag LOCUS_50440 14320 13736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 16358 14367 gene locus_tag LOCUS_50450 16358 14367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 16999 17427 gene locus_tag LOCUS_50460 16999 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 17962 21405 gene locus_tag LOCUS_50470 17962 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 21470 21871 gene locus_tag LOCUS_50480 21470 21871 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_50480 21984 22382 gene locus_tag LOCUS_50490 21984 22382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 22629 22327 gene locus_tag LOCUS_50500 22629 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 22864 23955 gene locus_tag LOCUS_50510 22864 23955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 24406 23978 gene locus_tag LOCUS_50520 24406 23978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 24670 24921 gene locus_tag LOCUS_50530 24670 24921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 25179 24955 gene locus_tag LOCUS_50540 25179 24955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 25980 25411 gene locus_tag LOCUS_50550 25980 25411 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_50550 26206 27381 gene locus_tag LOCUS_50560 26206 27381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 28093 28863 gene locus_tag LOCUS_50570 28093 28863 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202571.1 protein_id gnl|my_center|LOCUS_50570 29541 28834 gene locus_tag LOCUS_50580 29541 28834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 29643 29900 gene locus_tag LOCUS_50590 29643 29900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 33464 32538 gene locus_tag LOCUS_50600 33464 32538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 34435 35079 gene locus_tag LOCUS_50610 34435 35079 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387714.1 protein_id gnl|my_center|LOCUS_50610 35084 35413 gene locus_tag LOCUS_50620 35084 35413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 37632 41915 gene locus_tag LOCUS_50630 37632 41915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50630 42456 42085 gene locus_tag LOCUS_50640 42456 42085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 44008 43091 gene locus_tag LOCUS_50650 44008 43091 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_50650 44901 44509 gene locus_tag LOCUS_50660 44901 44509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063921.1 protein_id gnl|my_center|LOCUS_50660 45233 44940 gene locus_tag LOCUS_50670 45233 44940 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_50670 46027 45350 gene locus_tag LOCUS_50680 46027 45350 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_50680 46451 46029 gene locus_tag LOCUS_50690 46451 46029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 47628 46615 gene locus_tag LOCUS_50700 47628 46615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 48610 47666 gene locus_tag LOCUS_50710 48610 47666 CDS product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295913.1 protein_id gnl|my_center|LOCUS_50710 49478 48612 gene locus_tag LOCUS_50720 49478 48612 CDS product sce7726 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459264.1 protein_id gnl|my_center|LOCUS_50720 49790 50239 gene locus_tag LOCUS_50730 49790 50239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 50439 51149 gene locus_tag LOCUS_50740 50439 51149 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_50740 51323 52462 gene locus_tag LOCUS_50750 51323 52462 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038782.1 protein_id gnl|my_center|LOCUS_50750 52527 53291 gene locus_tag LOCUS_50760 52527 53291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 53321 53752 gene locus_tag LOCUS_50770 53321 53752 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225462.1 protein_id gnl|my_center|LOCUS_50770 54087 53842 gene locus_tag LOCUS_50780 54087 53842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 54617 54399 gene locus_tag LOCUS_50790 54617 54399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 55264 55461 gene locus_tag LOCUS_50800 55264 55461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 55993 55562 gene locus_tag LOCUS_50810 55993 55562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 59332 56369 gene locus_tag LOCUS_50820 59332 56369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 60779 59808 gene locus_tag LOCUS_50830 60779 59808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 64314 60808 gene locus_tag LOCUS_50840 64314 60808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 65417 64791 gene locus_tag LOCUS_50850 65417 64791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50850 66130 65423 gene locus_tag LOCUS_50860 66130 65423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50860 66966 66703 gene locus_tag LOCUS_50870 66966 66703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 67138 67491 gene locus_tag LOCUS_50880 67138 67491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 67494 67763 gene locus_tag LOCUS_50890 67494 67763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 69670 69305 gene locus_tag LOCUS_50900 69670 69305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 69914 70672 gene locus_tag LOCUS_50910 69914 70672 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656688.1 protein_id gnl|my_center|LOCUS_50910 70674 71036 gene locus_tag LOCUS_50920 70674 71036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 71602 72672 gene locus_tag LOCUS_50930 71602 72672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 72889 72638 gene locus_tag LOCUS_50940 72889 72638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 73110 73355 gene locus_tag LOCUS_50950 73110 73355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 73613 73359 gene locus_tag LOCUS_50960 73613 73359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 73948 74613 gene locus_tag LOCUS_50970 73948 74613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 75015 75356 gene locus_tag LOCUS_50980 75015 75356 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_50980 75519 76379 gene locus_tag LOCUS_50990 75519 76379 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_50990 76388 76786 gene locus_tag LOCUS_51000 76388 76786 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883996.1 protein_id gnl|my_center|LOCUS_51000 76770 77183 gene locus_tag LOCUS_51010 76770 77183 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258524.1 protein_id gnl|my_center|LOCUS_51010 77173 78198 gene locus_tag LOCUS_51020 77173 78198 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191189768.1 protein_id gnl|my_center|LOCUS_51020 78198 79547 gene locus_tag LOCUS_51030 78198 79547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 80106 80714 gene locus_tag LOCUS_51040 80106 80714 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_51040 81040 81351 gene locus_tag LOCUS_51050 81040 81351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 81810 83090 gene locus_tag LOCUS_51060 81810 83090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 83092 84372 gene locus_tag LOCUS_51070 83092 84372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 84418 85530 gene locus_tag LOCUS_51080 84418 85530 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_51080 85527 86189 gene locus_tag LOCUS_51090 85527 86189 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_51090 86335 86592 gene locus_tag LOCUS_51100 86335 86592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 86649 87530 gene locus_tag LOCUS_51110 86649 87530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51110 88749 88165 gene locus_tag LOCUS_51120 88749 88165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 90709 88796 gene locus_tag LOCUS_51130 90709 88796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 91425 91823 gene locus_tag LOCUS_51140 91425 91823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 92447 93505 gene locus_tag LOCUS_51150 92447 93505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 93511 93783 gene locus_tag LOCUS_51160 93511 93783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 93903 94139 gene locus_tag LOCUS_51170 93903 94139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 94404 94622 gene locus_tag LOCUS_51180 94404 94622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 94741 94890 gene locus_tag LOCUS_51190 94741 94890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51190 95006 95197 gene locus_tag LOCUS_51200 95006 95197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 95194 95553 gene locus_tag LOCUS_51210 95194 95553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 95598 95813 gene locus_tag LOCUS_51220 95598 95813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51220 95878 96192 gene locus_tag LOCUS_51230 95878 96192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51230 96468 96788 gene locus_tag LOCUS_51240 96468 96788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 97002 96733 gene locus_tag LOCUS_51250 97002 96733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 97248 98249 gene locus_tag LOCUS_51260 97248 98249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51260 98805 98413 gene locus_tag LOCUS_51270 98805 98413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 99982 99809 gene locus_tag LOCUS_51280 99982 99809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51280 100215 99964 gene locus_tag LOCUS_51290 100215 99964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51290 100965 101324 gene locus_tag LOCUS_51300 100965 101324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51300 101361 101618 gene locus_tag LOCUS_51310 101361 101618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51310 101612 101770 gene locus_tag LOCUS_51320 101612 101770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 102287 102442 gene locus_tag LOCUS_51330 102287 102442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 102439 102699 gene locus_tag LOCUS_51340 102439 102699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 >Feature sequence3 231 590 gene locus_tag LOCUS_51350 231 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51350 551 991 gene locus_tag LOCUS_51360 551 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51360 1308 1802 gene locus_tag LOCUS_51370 1308 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 1832 2131 gene locus_tag LOCUS_51380 1832 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 2218 2388 gene locus_tag LOCUS_51390 2218 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 3215 3006 gene locus_tag LOCUS_51400 3215 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51400 3408 3193 gene locus_tag LOCUS_51410 3408 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 4990 3440 gene locus_tag LOCUS_51420 4990 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 6601 6230 gene locus_tag LOCUS_51430 6601 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 7616 6654 gene locus_tag LOCUS_51440 7616 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 8015 7788 gene locus_tag LOCUS_51450 8015 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 8704 8198 gene locus_tag LOCUS_51460 8704 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 9230 9457 gene locus_tag LOCUS_51470 9230 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 10375 9800 gene locus_tag LOCUS_51480 10375 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 10897 10472 gene locus_tag LOCUS_51490 10897 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 11838 11176 gene locus_tag LOCUS_51500 11838 11176 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_51500 12594 12157 gene locus_tag LOCUS_51510 12594 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 12935 13123 gene locus_tag LOCUS_51520 12935 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 13213 13800 gene locus_tag LOCUS_51530 13213 13800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 14674 13787 gene locus_tag LOCUS_51540 14674 13787 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774874.1 protein_id gnl|my_center|LOCUS_51540 15706 14810 gene locus_tag LOCUS_51550 15706 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 16200 15961 gene locus_tag LOCUS_51560 16200 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 16322 17659 gene locus_tag LOCUS_51570 16322 17659 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080617.1 protein_id gnl|my_center|LOCUS_51570 18099 17857 gene locus_tag LOCUS_51580 18099 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 18423 19112 gene locus_tag LOCUS_51590 18423 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 20334 19195 gene locus_tag LOCUS_51600 20334 19195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 20553 20753 gene locus_tag LOCUS_51610 20553 20753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 21178 22095 gene locus_tag LOCUS_51620 21178 22095 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_51620 22730 23101 gene locus_tag LOCUS_51630 22730 23101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 24090 23362 gene locus_tag LOCUS_51640 24090 23362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 24908 24552 gene locus_tag LOCUS_51650 24908 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 25200 24952 gene locus_tag LOCUS_51660 25200 24952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 25719 25435 gene locus_tag LOCUS_51670 25719 25435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 26245 27048 gene locus_tag LOCUS_51680 26245 27048 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246321.1 protein_id gnl|my_center|LOCUS_51680 27171 28517 gene locus_tag LOCUS_51690 27171 28517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 28916 28608 gene locus_tag LOCUS_51700 28916 28608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 29019 29261 gene locus_tag LOCUS_51710 29019 29261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 29544 29317 gene locus_tag LOCUS_51720 29544 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 29680 30330 gene locus_tag LOCUS_51730 29680 30330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 31831 31466 gene locus_tag LOCUS_51740 31831 31466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 32575 33225 gene locus_tag LOCUS_51750 32575 33225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 33306 33551 gene locus_tag LOCUS_51760 33306 33551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 33731 34489 gene locus_tag LOCUS_51770 gene soj 33731 34489 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_51770 34550 34813 gene locus_tag LOCUS_51780 34550 34813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 35193 36260 gene locus_tag LOCUS_51790 35193 36260 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267673.1 protein_id gnl|my_center|LOCUS_51790 36579 37661 gene locus_tag LOCUS_51800 36579 37661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 38684 38283 gene locus_tag LOCUS_51810 38684 38283 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_51810 41121 38716 gene locus_tag LOCUS_51820 41121 38716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 41901 41530 gene locus_tag LOCUS_51830 41901 41530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 42916 42050 gene locus_tag LOCUS_51840 42916 42050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 43315 43088 gene locus_tag LOCUS_51850 43315 43088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 44004 43498 gene locus_tag LOCUS_51860 44004 43498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 44366 44109 gene locus_tag LOCUS_51870 44366 44109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 44532 44759 gene locus_tag LOCUS_51880 44532 44759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 45677 45102 gene locus_tag LOCUS_51890 45677 45102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 46412 45774 gene locus_tag LOCUS_51900 46412 45774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 47142 46471 gene locus_tag LOCUS_51910 47142 46471 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_51910 47898 47461 gene locus_tag LOCUS_51920 47898 47461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 48368 49105 gene locus_tag LOCUS_51930 48368 49105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774875.1 protein_id gnl|my_center|LOCUS_51930 49979 49092 gene locus_tag LOCUS_51940 49979 49092 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774874.1 protein_id gnl|my_center|LOCUS_51940 50743 50255 gene locus_tag LOCUS_51950 50743 50255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 51009 50788 gene locus_tag LOCUS_51960 51009 50788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 51503 51264 gene locus_tag LOCUS_51970 51503 51264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 51625 52962 gene locus_tag LOCUS_51980 51625 52962 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080617.1 protein_id gnl|my_center|LOCUS_51980 53402 53160 gene locus_tag LOCUS_51990 53402 53160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 53725 54414 gene locus_tag LOCUS_52000 53725 54414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 55054 54497 gene locus_tag LOCUS_52010 55054 54497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 55635 55240 gene locus_tag LOCUS_52020 55635 55240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 55853 56053 gene locus_tag LOCUS_52030 55853 56053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 56477 57394 gene locus_tag LOCUS_52040 56477 57394 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_52040 58029 58421 gene locus_tag LOCUS_52050 58029 58421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 59067 58660 gene locus_tag LOCUS_52060 59067 58660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 60203 59847 gene locus_tag LOCUS_52070 60203 59847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 60960 60778 gene locus_tag LOCUS_52080 60960 60778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 61669 62013 gene locus_tag LOCUS_52090 61669 62013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 62030 62320 gene locus_tag LOCUS_52100 62030 62320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 62443 63129 gene locus_tag LOCUS_52110 62443 63129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 63126 63788 gene locus_tag LOCUS_52120 63126 63788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 64187 63879 gene locus_tag LOCUS_52130 64187 63879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 64289 64531 gene locus_tag LOCUS_52140 64289 64531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 64784 64587 gene locus_tag LOCUS_52150 64784 64587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 65055 65342 gene locus_tag LOCUS_52160 65055 65342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 65284 65595 gene locus_tag LOCUS_52170 65284 65595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170