COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2597242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 64..165 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 261..337 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 456..998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1096..2037 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene metA CDS complement(2110..3408) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3593..7261 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene metH CDS complement(7337..8689) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene lysC CDS 8965..10074 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(10103..11872) product oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(11891..14716) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene uvrA CDS complement(14843..15721) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene galU CDS complement(15829..16464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 16750..17301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 assembly_gap 18210..19659 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19902..21053 product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene garK CDS 21448..23457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 23709..24869 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 tRNA complement(25003..25078) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(25232..27076) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene rpoD CDS complement(27174..28940) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene dnaG CDS complement(29029..29472) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(29498..29713) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene rpsU CDS 29935..30951 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105657.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene tsaD CDS complement(31063..31656) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene plsY CDS 31829..32188 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene folB CDS 32185..32691 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene folK CDS 32691..33494 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(33559..34218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 assembly_gap 34251..34525 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34991..36673 product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 36673..37554 product general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(37651..38262) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(38419..39684) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404204.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(39730..40317) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 40598..42115 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 42234..45110 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455447.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene glnE CDS 45204..46634 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455449.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene hldE CDS complement(46766..47155) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(47199..47660) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene pyrI CDS complement(47677..48633) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene pyrB CDS complement(48808..49812) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 50252..50671 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene rraB CDS complement(50775..51233) product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(51418..54279) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261201.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(54383..54844) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106076.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(54912..56423) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene pepA CDS 56643..57743 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene lptF CDS 57744..58814 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene lptG CDS complement(58890..59363) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461101.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 tRNA 59555..59639 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 59905..60480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 60605..61510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 61678..62556 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262913.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(62928..63047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(63160..64653) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183449.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(64865..65764) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(66042..66962) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(67092..68276) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(68541..69503) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075549536.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(69579..70538) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133519.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(70548..71363) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(71420..71776) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(71779..72441) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(72447..73097) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 73791..74261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(74383..78252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204821.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(78314..78901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(78952..79116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(79507..81339) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453795.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene glmS CDS complement(81394..82161) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 82507..83307 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene nagB CDS complement(83361..83897) product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene mtlR CDS complement(83964..85112) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(85210..87090) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 tRNA complement(87961..88036) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(88057..88132) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(88167..88242) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(88263..88338) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(88391..88466) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(88941..89016) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(89056..89131) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(89139..89214) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(89268..89343) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(89448..90638) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene mltC CDS complement(90648..90920) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(90930..91874) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene mutY CDS 92195..92914 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene trmB CDS 93017..94048 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 94203..95123 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene glsB CDS complement(95185..96369) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene hemW CDS complement(96366..96968) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(96974..97417) product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(97444..98013) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(98031..98855) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene proC CDS complement(98885..99595) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261215.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 99620..100666 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350195.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 100694..101797 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(101816..102241) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene ruvX CDS complement(102238..102798) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(102861..103808) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene gshB CDS complement(103818..104549) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461719.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene rsmE CDS complement(104645..105340) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461720.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene endA CDS complement(105456..105950) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(106403..106540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 106602..106868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(107533..108327) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(108615..109766) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene metK CDS 110106..112100 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263520.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene tkt CDS complement(112169..113086) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(113089..113937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 114895..115068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 115028..116071 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene epd CDS 116216..117379 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 117510..118586 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417587.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene fbaA CDS 118852..119724 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene mscS CDS 119836..120540 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(120758..121987) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene serA CDS complement(122196..122852) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene rpiA CDS complement(122928..123527) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482482.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(123744..124034) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070442.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 124324..124890 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 124915..126072 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481244.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene ubiH CDS 126081..127283 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(127339..127545) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(128170..129111) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481243.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene ygfZ CDS 129376..129639 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458651.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(129753..131384) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918879.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene nadB CDS 131764..132342 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene rpoE CDS 132355..132984 product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 132981..133928 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene rseB CDS 133944..134438 product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 134548..136341 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene lepA CDS 136439..137335 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene lepB CDS 137345..138022 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene rnc CDS 138015..139013 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene era CDS 139067..139786 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene recO CDS 139783..140514 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene pdxJ CDS 140514..140912 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene acpS CDS complement(141058..143748) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene barA CDS 143987..145300 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene rlmD CDS 145401..147623 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene relA CDS 147696..148517 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene mazG CDS 148669..150309 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 150393..151691 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene eno CDS 152006..152281 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455577.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene ftsB CDS 152350..153000 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene ispD CDS 153003..153485 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene ispF CDS 153502..154533 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478539.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene truD CDS 154542..155282 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene surE CDS 155284..155910 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002982.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 155915..156742 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 156789..157697 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393877.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene rpoS CDS complement(157623..160187) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene mutS CDS 160270..160764 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene pncC CDS 160870..161898 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417772.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene recA CDS 162013..162480 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene recX CDS 162643..165234 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene alaS CDS 165396..166568 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 166646..166843 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415691.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene csrA tRNA 167026..167118 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 167151..167227 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 167257..167349 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 167476..167552 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 assembly_gap 167588..167751 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 167814..167890 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 168162..168425 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 168455..170242 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene oadA CDS 170252..171382 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(171705..171926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(171934..172584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388355.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(172732..173067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 173660..174115 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 174125..177010 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626017.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 177035..178678 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462538.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene gshA CDS 178694..179209 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462534.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene luxS assembly_gap 179254..180907 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(181105..182367) product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(182448..182996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 182902..183258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 183393..184784 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene ffh CDS 185030..185278 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene rpsP CDS 185312..185842 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462552.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene rimM CDS 185864..186622 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene trmD CDS 186664..187017 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene rplS CDS complement(187116..187310) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene yacG CDS complement(187396..188136) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene zapD CDS complement(188179..188778) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene coaE CDS complement(188804..189682) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 189584..189781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(189762..190970) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(190963..192507) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957200.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene pilB CDS complement(192504..192908) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(193148..194035) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017019488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene nadC CDS 194133..194675 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479703.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene ampD CDS 194914..195684 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009602124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene pdhR CDS 195749..198412 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene aceE CDS 198441..200324 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene aceF CDS 200572..201996 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420880.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene lpdA CDS 202197..202724 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420875.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene hpt CDS complement(202828..203478) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene can CDS 203574..204497 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262613.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 204497..205267 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479696.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(205376..206026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263510.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 206367..207980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(208435..209388) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811393.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 209661..210929 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262600.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 210939..213200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 213536..214993 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(215089..216645) product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(216645..217769) product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(217759..219054) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893249.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 219165..220088 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(220189..221040) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195750.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene panC CDS complement(221050..221844) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262611.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene panB CDS complement(221873..222355) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene folK CDS complement(222355..223704) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015297242.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene pcnB CDS complement(223810..224697) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene gluQRS CDS complement(224839..225285) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene dksA CDS complement(225427..226209) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene sfsA CDS 226201..228675 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480202.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene hrpB CDS 228691..231063 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene mrcB CDS 231134..233440 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 233731..236328 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene acnB CDS 236702..237070 product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 237290..237628 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene glnK CDS 237653..238882 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 239181..240194 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 240271..241896 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 241896..242921 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(242926..244809) product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060994152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(244806..246536) product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(246788..247783) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420816.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(247813..248799) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(248796..249830) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(249832..250818) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(250969..252642) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(253217..256519) product two-component system sensor histidine kinase ChiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene chiS CDS complement(256714..257733) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene rsmC CDS complement(257746..258735) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(258948..260234) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene hemL CDS 260434..260775 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene erpA CDS 260884..262002 product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene vmeJ CDS 262013..265108 product multidrug efflux RND transporter permease subunit VmeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene vmeK CDS complement(265187..266485) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490383.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 266599..267786 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479092.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene tyrS CDS 268241..269086 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(269192..270565) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261249.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene dacB CDS complement(270788..271861) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461922.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 272366..272839 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene greA CDS complement(272910..273206) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene yhbY CDS 273338..273967 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene rlmE CDS 274066..276000 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021447645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene ftsH CDS 276093..276923 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene folP CDS 276940..278277 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene glmM assembly_gap 278405..278512 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(278561..279364) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460178.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene suhB CDS 279521..280252 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene trmJ CDS 280365..280868 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496331.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene iscR CDS 280896..282110 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 282144..282527 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene iscU CDS 282573..282896 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene iscA CDS 282965..283480 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene hscB CDS 283503..285353 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460220.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene hscA CDS 285366..285704 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene fdx CDS 285733..285927 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460231.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene iscX CDS 286152..287441 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460223.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene pepB CDS 287526..287954 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162850.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene ndk CDS 288111..289226 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417927.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 289290..289964 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018640.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene pilW CDS 290014..290940 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene rodZ CDS 290943..292064 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261366.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene ispG CDS 292065..293375 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene hisS CDS 293387..294001 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424767.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 294013..295173 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene bamB CDS 295646..297133 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249403.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene der CDS 297546..297815 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(297819..299168) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460216.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene xseA CDS 299377..300840 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene guaB CDS 300983..302560 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460250.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene guaA CDS 302719..303240 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479918.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 303500..304645 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462369.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 304652..306346 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478911.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 306343..306993 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 306983..307594 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 307828..309303 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489212.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene focA CDS complement(309367..310296) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 310529..310864 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 311002..312063 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263675.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene arsB CDS 312407..312880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 312920..313846 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 313925..314371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 314381..315874 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463023.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 316071..317129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(317343..319343) product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815455.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(319362..320777) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene uxaC CDS complement(320841..322493) product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(322942..323265) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(323278..324039) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene kduD CDS complement(324397..325440) product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 325521..325709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(325969..326454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 326768..326980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 326983..327207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 327207..327599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(327640..328554) product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(328563..329210) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(329214..330035) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(330073..330795) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286765.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(330805..331290) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(331353..333146) product PTS ascorbate-specific subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 333506..334261 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006793.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene ulaR CDS 334399..335466 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene ulaG CDS complement(335558..338680) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(338684..339880) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(340079..340606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(340743..341678) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(342630..342818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(342764..343075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 note possible pseudo, frameshifted CDS complement(343100..344431) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(345131..345634) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032472658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(345631..346980) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 tmRNA complement(347366..347732) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(347799..348284) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455975.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene smpB CDS 348387..348830 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 348837..349127 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(349226..349585) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455981.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene bamE CDS complement(349757..351430) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456006.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene recN CDS complement(351522..352406) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455932.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene nadK CDS 352556..353182 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455958.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene grpE CDS 353412..355322 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene dnaK CDS 355592..356740 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene dnaJ CDS 356962..357417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 357398..357997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 358002..358898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 358888..359295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 359582..361141 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(361223..362059) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene fghA CDS complement(362145..363287) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 363406..364317 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261379.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 364365..364895 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001934843.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene tadA CDS complement(365272..366762) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene mltF CDS 367087..370980 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455948.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene purL CDS 371167..371703 product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(371786..373258) product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482957.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(373717..373896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 374210..375502 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 375528..375992 product oxytetracycline resistance phosphoribosyltransferase domain-containing protein Tet(34) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene tet(34) CDS 376110..377348 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455935.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene frsA CDS 377462..377851 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene crl CDS 377963..379072 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483011.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene proB CDS 379112..380362 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 380608..381057 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene nrdR CDS 381064..382182 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene ribD CDS 382196..382852 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493874.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 382897..384006 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene ribBA CDS 384145..384615 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene ribE CDS 384615..385088 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene nusB CDS 385169..386137 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456036.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene thiL CDS 386172..386675 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482983.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene pgpA CDS complement(386736..388604) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483016.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene dxs CDS complement(388632..389537) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene ispA CDS complement(389512..389766) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene xseB CDS 390027..391475 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene thiI CDS 391974..392885 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 392948..394036 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155650284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene rlmM CDS complement(394089..394859) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene xni CDS complement(394942..396303) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586703.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene ppnN CDS complement(396534..398840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459154.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(398844..399698) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261348.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene queF CDS 399722..400333 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene syd CDS 400335..401111 product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 401170..401907 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(401975..402298) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 402600..404213 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(404291..404740) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708225.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(404740..405021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(405189..405485) product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106044.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(405486..406529) product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 406610..406927 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160170.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 406927..407658 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene truC CDS complement(407752..408135) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(408369..411002) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene glnD CDS 411195..414344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(414407..415282) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene map CDS 415626..416357 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene rpsB CDS 416487..417329 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene tsf CDS 417500..418231 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484104.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene pyrH CDS 418293..418850 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456723.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene frr CDS 418953..419708 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 419719..420564 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 420589..421785 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456710.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene ispC CDS 421797..423152 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456697.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rseP CDS 423199..425637 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262428.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene bamA CDS 425656..426168 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 426175..427194 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210023.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene lpxD CDS 427281..427733 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene fabZ CDS 427735..428526 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene lpxA CDS 428626..429768 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene lpxB CDS 429769..430389 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rnhB CDS 430408..433887 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene dnaE CDS 433934..434893 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene accA CDS 434993..436330 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene tilS CDS 436347..436658 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488964.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 436773..437111 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717795.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene glnB CDS 437255..438142 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(438126..439715) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(439863..440621) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939287.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene gloB CDS 440750..441385 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(441404..441868) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene rnhA CDS 441927..442649 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene dnaQ CDS complement(442755..445205) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene fadE CDS 445510..446088 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene lpcA CDS 446124..446966 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(446950..448068) product GlyGly-anchored extracellular serine protease VesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene vesA CDS complement(448235..448819) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene purN CDS complement(448822..449862) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457724.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene purM CDS 450154..450780 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457783.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene upp CDS 450886..452109 product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(452222..452659) product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(452659..453009) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene arsC CDS complement(453022..454491) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 454695..454916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 454925..456019 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(456114..456581) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene bcp CDS complement(456598..457125) product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 457358..458236 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481116.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene dapA CDS 458291..459343 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene bamC CDS 459495..459926 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 460351..460878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707748.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 460993..462279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(462435..462674) product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(462686..463381) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457656.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(463383..464519) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262397.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene dapE CDS complement(464541..464891) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457702.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 465099..465377 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420468.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(465383..465682) product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 465784..466266 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 466283..467188 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457759.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(467289..467798) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene crr CDS complement(467838..469562) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene ptsI CDS complement(469688..469945) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(470195..471163) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene cysK CDS complement(471295..472050) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene cysZ CDS 472233..473282 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157059.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene zipA CDS 473361..475388 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene ligA CDS complement(475458..475910) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(475907..476830) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(476968..477822) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454528.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(478373..479281) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 479618..480343 product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 480340..481137 product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 481127..481477 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 481474..481884 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 481967..482512 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene yfcE CDS complement(482585..483112) product transmembrane regulator ToxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene toxS CDS complement(483112..483954) product transcriptional regulator ToxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene toxR CDS 484208..486109 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478520.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene htpG CDS 486287..486931 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene adk CDS 487014..487985 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene hemH CDS 488103..488594 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene rfaH CDS complement(488694..490358) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene asnB CDS complement(490530..491702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(491950..493551) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(493553..494821) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(494824..495960) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene nagA CDS 496425..497918 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418270.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene nagE CDS 498069..499733 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene glnS CDS 499820..500881 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(500909..501493) product type IVa pilus pseudopilin TppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707416.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene tppF CDS complement(501515..501955) product ferric iron uptake transcriptional regulator FcrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282826.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene fcrX CDS complement(502171..502698) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261496.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene fldA CDS complement(502753..502971) product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(503042..503812) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 503905..504459 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489857.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene seqA CDS 504539..506185 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene pgm CDS complement(506638..507414) product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 507503..508261 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(508374..509663) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 510064..510444 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478785.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene sdhC CDS 510438..510785 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene sdhD CDS 510786..512552 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene sdhA CDS 512564..513274 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 513399..516224 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene sucA CDS 516238..517449 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455502.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene odhB CDS 517647..518813 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene sucC CDS 518813..519685 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene sucD CDS complement(519946..520731) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene znuB CDS complement(520724..521509) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455461.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene znuC CDS 521671..522561 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene znuA CDS 522689..522916 product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777870.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 522916..525192 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455466.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene feoB CDS 525268..525489 product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(525583..526521) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(527264..528694) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462328.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(528884..529066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(529045..529992) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261930.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 530093..531439 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 531553..531813 product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376453.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(531943..533328) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882878.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(533303..534109) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766243.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(534109..535047) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(535047..536633) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 537002..538210 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(538320..539924) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151653465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(540303..543140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 543774..544064 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921421.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 544269..545048 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263858.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(546295..548028) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene argS CDS 548235..548810 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478779.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(548894..549727) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene purU CDS 549905..551842 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 551870..552586 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene tsaB CDS 552624..553175 product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 553175..554023 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478778.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 554155..555837 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene fadD CDS 556057..557100 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496047.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene rnd CDS complement(557191..557451) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458079.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene minE CDS complement(557459..558271) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene minD CDS complement(558289..558951) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene minC CDS 559130..559417 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 559481..560443 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(560525..561376) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126770.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene folD tRNA 561576..561652 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 561868..562065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 562129..562602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(562701..564341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 564711..567980 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 567993..568757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 568818..570674 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 570686..573871 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(573999..574559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 575020..576195 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 576291..577277 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 577277..578023 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 578304..578990 product cationic peptide response regulator transcription factor CprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene cprR CDS 578994..580262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 580666..582060 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 582226..582981 product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 583131..607259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 607477..607764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 607848..608168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 608513..610339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 610346..612487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 612480..614477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 614480..615265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(615280..616242) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene rlmF CDS 616434..617306 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196597804.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(617379..618275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(618336..619388) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263655.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 619430..620446 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(620476..621297) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 621728..622420 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 622438..623421 product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263919.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 623811..624410 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 624506..625978 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262039.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 626199..627293 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 627360..629765 product trimethylamine-N-oxide reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(629858..631417) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(631582..634683) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene rne CDS 635287..636231 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene rluC CDS complement(636280..636900) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181921.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 636985..637521 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461584.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene yceD CDS 637527..637697 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene rpmF CDS 637707..638732 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180565.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene plsX CDS 638738..639688 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 639755..640678 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene fabD CDS 640703..641437 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene fabG CDS 641599..641832 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004737381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene acpP CDS 641934..643184 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044695.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene fabF CDS 643293..644099 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene pabC CDS 644092..645108 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene mltG CDS 645108..645737 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene tmk CDS 645743..646705 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 646773..647543 product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 647982..649415 product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453963.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene ptsG CDS 649622..650047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(650295..650465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(650396..651865) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(652341..652925) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262280.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 653263..654417 product DUF6363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137357956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 654515..655729 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(655839..657890) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene metG CDS 658131..659204 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene apbC CDS 659348..659989 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293736.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene udk CDS 660152..662518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 662530..663219 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(663287..663883) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene cobO CDS 664327..665694 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454288.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene dcuC CDS 665755..666879 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(666965..668062) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(668206..668793) product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 tRNA 669051..669126 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(669431..670423) product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266450.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 671474..671827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 671818..672519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 672583..673464 product viperin family antiviral radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 673461..673745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 673948..674700 product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 674835..675017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 675335..675523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 675640..675969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 675966..676829 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263117.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene cpaB CDS 676829..678157 product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 678154..678612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 678612..679880 product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 679877..681160 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261282.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 681157..682068 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 682068..682913 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012535186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 682915..683979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 683993..684466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 684459..684986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 685003..686505 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052678357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 686513..687154 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 688981..689883 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 690154..690771 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene ccmA CDS 690771..691439 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene ccmB CDS 691467..692216 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457654.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 692220..692426 product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene ccmD CDS 692423..692908 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene ccmE CDS 692905..694863 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 694863..695417 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 695414..695890 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 695890..697110 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene ccmI CDS 697185..697970 product MlaA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 698090..698776 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263026.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(698887..700143) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457664.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(700425..701147) product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(701140..701721) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 701933..703240 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517921.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene fadI CDS 703240..705351 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene fadJ CDS complement(705434..706471) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 706699..706896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 706896..707486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(707595..710372) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457669.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 710591..711055 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene sixA CDS complement(711176..711574) product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(711756..712286) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene smrB CDS 712349..713281 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene prmB CDS 713445..714533 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene aroC CDS 714632..715159 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 715163..715429 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 715609..716136 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(716203..718284) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162806064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene mnmC CDS 718395..719606 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene fabB CDS 719728..720858 product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 720858..721871 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 722116..723885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 723954..724739 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene truA CDS 724914..725837 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene accD CDS 725879..727153 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192375.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene folC CDS 727143..727757 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 727821..728318 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 728340..729857 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene purF CDS complement(730044..730931) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 731105..732208 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 733115..733627 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene apt CDS 733687..735843 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene dnaX CDS 735916..736245 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 736262..736861 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460088.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene recR CDS complement(736933..737616) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene aqpZ CDS complement(737701..737952) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 738124..738564 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(738617..739585) product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(739603..740364) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene rlmA CDS complement(740735..741619) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(741767..742762) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene gap CDS 743088..743501 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106032.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene msrB CDS 743548..743853 product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(744079..745104) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479567.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene ansA CDS complement(745238..747097) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene sppA CDS 747399..749402 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 749450..750007 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 750195..752147 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(752243..752929) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(753015..753755) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 753844..754902 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene sohB CDS complement(755238..755405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 755752..756429 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene cmk CDS 756551..758221 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494602.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene rpsA CDS 758302..758586 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene ihfB CDS 758788..759093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 759102..760271 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene lapB CDS 760362..761054 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene pyrF CDS complement(761148..761918) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 762077..763051 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene cysB CDS 763102..764292 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477972.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(764299..765423) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene ald CDS 765580..766071 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene lrp CDS 766155..769418 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 769451..770053 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460060.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene lolA CDS 770063..771409 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 771495..772802 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene serS CDS complement(772875..773189) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(773642..774535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(774973..776253) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene bioA CDS 776375..777427 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene bioB CDS 777414..778583 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene bioF CDS 778580..779377 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene bioC CDS 779374..780051 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene bioD CDS complement(780113..780271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 780592..781467 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene htpX CDS 781665..782087 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 782084..782854 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 782851..784146 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 784143..784919 product DUF1365 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 784945..786183 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 786207..786746 product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 786727..787326 product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881186.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 787329..787865 product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460054.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 788032..788841 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(788866..789192) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(789221..789907) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(790065..791081) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457245.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene purR CDS complement(791246..791896) product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457256.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene torD CDS complement(792002..792769) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462426.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene elyC CDS 792948..793742 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene cmoM CDS 793743..795095 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483103.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene mukF CDS 795103..795813 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene mukE CDS 795810..800264 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105766.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene mukB CDS complement(800360..801193) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832742.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(801195..801428) product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 801918..802103 product trimethylamine N-oxide reductase system protein TorE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450728.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene torE CDS 802145..803329 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene torC CDS 803349..805814 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene torA CDS complement(805913..806860) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 807075..807947 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(808467..809192) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene cmoA CDS 809493..811268 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene aspS CDS 811339..811860 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene ruvC CDS 812031..812645 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene ruvA CDS 812649..813659 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene ruvB CDS 814202..815791 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene cydA CDS 815807..816943 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene cydB CDS 817405..817815 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene ybgC CDS 817817..818500 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene tolQ CDS 818504..818947 product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 818961..819995 product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene tolA CDS 820006..821355 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476637.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene tolB CDS 821402..821956 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene pal CDS 821975..822754 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene ybgF CDS 822869..823930 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483627.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene nadA CDS complement(824026..824625) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 tRNA 824813..824900 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 825432..827399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(827553..827936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(828145..832245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(832793..833863) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(833936..837826) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070764.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(837846..838808) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(838808..839797) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(839807..841678) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(841683..842726) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(842726..843730) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(843759..844640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(845237..845926) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene rsuA CDS complement(846023..846613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(846717..847067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 847270..847524 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 847947..848723 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 848735..849196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(849668..850969) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144045444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(850988..851680) product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene bfmR CDS complement(851677..852063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(852072..852869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(853220..854884) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene fadD CDS complement(855068..855739) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene artM CDS complement(855736..856425) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene artQ CDS complement(856427..857179) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(857219..857947) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene artP CDS 858329..858622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 858643..858987 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249605.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 859151..861370 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene recQ CDS complement(861401..863098) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(863303..865111) product bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479452.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(865115..865684) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene mobA CDS complement(865681..866409) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(866422..867120) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(867120..867956) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261996.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(867960..868811) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453887.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 868942..869367 product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419342.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 869404..870171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 870371..872041 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 872050..872649 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 872665..872865 product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396171.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 872878..875733 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 875747..876355 product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113430.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene fdh3B CDS 876372..877406 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 877399..877818 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479430.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(878047..879279) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477404.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(879307..879783) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 880141..881067 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 881454..883058 product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 883198..883500 product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(883632..884675) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 884815..886806 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(887491..888069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(889742..891010) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(891175..892008) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480150.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 892486..893310 product ParB/Srx family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(893404..893859) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(893974..894360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 894720..895136 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene zntR CDS 895133..897919 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 898128..899468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 899492..899926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(899910..901193) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(901440..902825) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(903155..904564) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene ptsG CDS complement(904888..905388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 905625..906563 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene phnD CDS 906685..907512 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene phnC CDS 907509..908309 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene phnE CDS 908309..909121 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene phnE CDS complement(909197..909823) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 910452..911105 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 911168..911866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 911871..912425 product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483385.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 912519..912968 product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(913017..913427) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene arfB CDS complement(913421..913765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(913771..914694) product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(914712..918053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(918056..919021) product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 919300..921633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 921642..923795 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 923795..924025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 924006..926066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 926059..926511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 926504..927553 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(927550..929574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(929722..929991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(930394..931623) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene pepT CDS complement(931753..932691) product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450949.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 932815..933195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(933279..934661) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(934993..936156) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene sstT CDS complement(936490..939561) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(939565..940659) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 940776..941375 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 941514..943139 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464821.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(943379..944167) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480237.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 944339..946801 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(947040..949388) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 949514..950695 product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 950751..951446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 951529..951729 product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457961.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(951812..952420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(952545..953042) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(953066..954907) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 955122..956387 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835928.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 956570..957655 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene serC CDS complement(957722..958630) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 958737..959732 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(959830..961566) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205201.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene cydC CDS complement(961559..963337) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261563.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene cydD CDS complement(963447..964403) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene trxB CDS complement(964574..965254) product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(965365..967053) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462599.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(967297..967665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(967860..968105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 968025..968201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 968221..968373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 968505..968756 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(968933..969211) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378066.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene rplY CDS complement(969388..971124) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 971315..972022 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene rsuA CDS 972025..973221 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462380.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 973218..973907 product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(973965..975392) product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 975561..976232 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 976213..978666 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462410.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 978675..979790 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462391.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 980257..981426 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene nhaA CDS 981917..982570 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 982631..984919 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096995.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(985235..986125) product DUF3943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 986299..987582 product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457838.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 987800..988135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 assembly_gap 988168..988187 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(988265..988546) product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483309.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene yfaE CDS complement(988573..989706) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene nrdB CDS complement(989776..992058) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457837.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene nrdA CDS complement(992581..993288) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261822.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 993574..996210 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261823.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene gyrA CDS 996500..997096 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490705.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene ribA CDS 997336..998838 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 998934..999485 product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457820.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 999552..1000202 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(1000302..1000973) product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057643027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 1001270..1002358 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 1002457..1002981 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 1002978..1004267 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 1004377..1005948 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458059.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 1006233..1006547 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419066.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene yqfB CDS complement(1006585..1007319) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(1007324..1009195) product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 1009506..1009940 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 1010004..1010543 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131618.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(1010615..1011805) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(1011993..1013393) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458036.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene asnS CDS complement(1013510..1014121) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(1014152..1015510) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene pabB CDS 1015673..1017187 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 1017316..1017501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458825.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 1017574..1018974 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 1018979..1020127 product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 1020220..1021764 product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001888682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene tyrR CDS 1021813..1022406 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene rimJ CDS 1022394..1022984 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 1022986..1023459 product DUF2947 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458833.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(1023575..1024726) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479994.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene msrB CDS 1025006..1025290 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(1025405..1028236) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(1028306..1030150) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(1030150..1030782) product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 1030934..1031464 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108807.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(1031516..1031965) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 1032062..1032793 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 1032892..1034271 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 1034453..1038289 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene hrpA CDS 1038364..1038852 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 1039153..1039998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(1040140..1041621) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 1041703..1042332 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236662.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(1042361..1042888) product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 1043124..1044035 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 1044032..1045081 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 1045078..1045860 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 1046015..1046299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(1046500..1047885) product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 1048363..1048521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251901.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1048533..1049243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477843.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 1049332..1049958 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 1049942..1050421 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(1050457..1051260) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1051318..1051668) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(1051801..1052397) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(1052399..1053703) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 assembly_gap 1055223..1057502 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1058271..1058290 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1059373..1060471 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1060493..1062988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(1063045..1064232) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 1064384..1064656 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486991.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene yccX CDS complement(1064704..1065033) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(1065131..1065793) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(1066001..1066750) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482000.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(1066767..1067864) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(1067866..1069068) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(1069140..1070168) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1070612..1071574 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 1071622..1072056 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480229.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene trxC CDS complement(1072167..1072649) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457116.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(1072660..1073712) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1073992..1074852 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261855.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 1075015..1075851 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(1076031..1077461) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene rsmF CDS complement(1077585..1080230) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261883.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(1080227..1081459) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 1081704..1082177 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1082278..1082907 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458274.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene proQ CDS 1082926..1084929 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene prc CDS 1085099..1085758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450937.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1086166..1086453) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1086443..1086691) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 1086931..1087311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 1088220..1090823 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene pepN CDS 1091181..1096025 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458266.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 1096071..1097081 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene pyrD CDS 1097244..1097786 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458262.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1098352..1100493 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene rlmKL CDS 1100490..1100729 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 1100707..1102632 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490212.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1102639..1104636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1104860..1105033 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494976.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene rmf CDS complement(1105215..1105745) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005390081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene fabA CDS complement(1105813..1107450) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001965088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1107530..1107682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 1107647..1108120 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene matP CDS 1108148..1108447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 assembly_gap 1108630..1110337 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1111226..1112182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 1112389..1113585 product 2-nitroimidazole transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene nimT CDS complement(1113605..1113967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1114222..1115652 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene ccoN CDS 1115664..1116284 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457377.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene ccoO CDS 1116294..1116470 product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 1116467..1117447 product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477628.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene ccoP CDS 1117529..1118008 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 1118008..1120455 product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1120546..1121202 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 1121316..1122068 product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 1122251..1123198 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene uspE CDS 1123353..1124279 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene ttcA CDS complement(1124544..1125194) product DUF2987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1125209..1126060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625981.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1126289..1127008) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene cobB CDS 1127199..1127942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 note possible pseudo, frameshifted CDS 1127926..1129551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 note possible pseudo, frameshifted CDS 1129553..1130437 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1130473..1130733 product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1130910..1131302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490722.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1131662..1132570) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene nagK CDS complement(1132722..1133456) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001900033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(1133765..1133929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 1133951..1134319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1134319..1134828 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1135022..1135894 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1135909..1136112 product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1136170..1136778) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1136933..1138303 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1138362..1138769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1138748..1139164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1139310..1140164) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908473.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1140489..1141478) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479619.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1141576..1142523) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260920.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1142625..1143797 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024946189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1143832..1145094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1145184..1145849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1145951..1147324) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(1147563..1148582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 tRNA 1148830..1148906 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 1148945..1149021 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 1149058..1149134 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(1149644..1149973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1149970..1151187) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120816036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(1151180..1151416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1151507..1151728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1151902..1153032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1153102..1153395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1153437..1157378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1157382..1160348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1160348..1162492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1162489..1165926) product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104752311.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(1165923..1167419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1167416..1168144) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1168137..1168724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1168725..1170458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1170455..1173640) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120945058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1173633..1173854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1173847..1174224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1174214..1175545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1175554..1175823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1175845..1176552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(1177963..1181133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1181145..1182962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1183637..1184203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 assembly_gap 1184435..1184454 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1184754..1185341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1185430..1185918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1186403..1186969) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1187202..1187360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1187467..1188255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1188473..1189360) product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1189466..1193206) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1193203..1194465) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene sbcD CDS complement(1194690..1195265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1195766..1196452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1196569..1198212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1198307..1199380 product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1199455..1199916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1200032..1201633) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rmuC CDS 1201713..1202783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1202826..1203740) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1203887..1204405 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 assembly_gap 1204448..1205937 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1205992..1207005) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1207025..1207450) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247362.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1207680..1208141 product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1208584..1209909 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195076.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1209942..1211201) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene glgC CDS 1211805..1212899 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463327.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1212896..1213963) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1214060..1214722 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1214865..1216280 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene sbcB CDS 1216284..1216646 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1216648..1217325 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1217553..1218446 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene cdd CDS 1218596..1219771 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene purT CDS complement(1219871..1220173) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene ihfA CDS 1220589..1223810 product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene pulA CDS complement(1223846..1224457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(1224519..1224983) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1225097..1225558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(1225711..1226142) product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1226300..1226950) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010448917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1227086..1228261) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1228378..1228986 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1229142..1229609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1229572..1230585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1230615..1231667) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1231917..1232180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1232337..1232525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1232721..1233323) product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091021504.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1233433..1233831) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1233800..1233979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1234050..1234211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1234382..1234783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(1234835..1235026) product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1235115..1236410) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1236543..1238930) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene pheT CDS complement(1238948..1239931) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene pheS CDS 1240361..1241470 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1241601..1241915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1242250..1242855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1242944..1243723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1244002..1244805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1245374..1246213) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 1246436..1246918 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261948.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1246953..1247876 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1247943..1248296) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rplT CDS complement(1248338..1248532) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462620.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene rpmI CDS complement(1248637..1249026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1249195..1251123) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490070.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene thrS CDS 1251461..1252168 product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1252248..1255298) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462645.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1255468..1256151 product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1256320..1256511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1256642..1257016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903293.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1257155..1258258 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1258442..1259068) product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1259390..1260295 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1260408..1260923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1261030..1262679 product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483514.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene panP CDS 1262912..1263763 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1263907..1265106) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483569.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1265369..1265632 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1265857..1267059) product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1267331..1267846 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1267954..1269084) product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene nspC CDS complement(1269165..1270412) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1270425..1273316) product pyridoxal phosphate-dependent class III aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 tRNA complement(1273863..1273938) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(1274005..1274091) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(1274168..1274243) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(1274283..1274356) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(1274425..1274511) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(1274589..1274664) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(1274683..1274756) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(1275063..1275617) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene pgsA CDS complement(1275695..1277461) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105992.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene uvrC CDS complement(1277528..1278172) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386783.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene uvrY CDS 1278554..1280917 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1280977..1281297 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1281863..1282609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1282652..1283812) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957532.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1283985..1285154 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1285196..1285624) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1285747..1287516) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1287660..1287803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1287754..1288245 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1288314..1289204) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291245.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene rluB CDS complement(1289375..1289995) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1290141..1291004) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465084.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1291403..1292980 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1292973..1293575 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1293588..1294586 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465092.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene trpD CDS 1294589..1295980 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488526.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene trpCF CDS 1296037..1297227 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene trpB CDS 1297227..1298033 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481690.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene trpA CDS complement(1298132..1298569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1298580..1298921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1299139..1299762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1300188..1301930 product basic endochitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1302582..1303829 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1303963..1304589) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 1304866..1305411 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811598.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 1305404..1305796 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene yciA CDS 1305808..1306104 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1306107..1306514 product GspS/AspS pilotin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459209.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1306610..1307560) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1307560..1308246) product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459686.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1308502..1309956 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene cls CDS 1310039..1311247 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478937.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 1311431..1311967 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1312023..1313162 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534254.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1313539..1315050) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1315608..1315898 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921421.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1316033..1316452 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(1316466..1316894) product ribosome recycling factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(1316922..1317140) product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1317266..1317763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1317824..1318063 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 assembly_gap 1318090..1318355 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1318409..1319023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1319277..1320419) product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene norW CDS complement(1320430..1321902) product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene norV CDS complement(1322219..1322992) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1323192..1324748 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene norR CDS complement(1324771..1325322) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1325413..1328517) product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene vmeI CDS complement(1328514..1329608) product efflux RND transporter periplasmic adaptor subunit VmeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478901.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene vmeH CDS complement(1329605..1330639) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044382.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1330910..1331611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1332150..1332821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1332931..1333314) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462375.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene pspC CDS complement(1333311..1333541) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene pspB CDS complement(1333557..1334216) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462360.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene pspA CDS 1334559..1335548 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene pspF CDS 1335623..1337260 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462340.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene sapA CDS 1337260..1338222 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1338209..1339096 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1339096..1340091 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1340088..1340876 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1341138..1342043) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462364.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1342377..1343351 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene cmoB CDS 1343585..1344280 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1344313..1345818 product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1345822..1346787 product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1346900..1347478) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1347590..1349038) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene cysS CDS 1349125..1349619 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478939.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1349681..1350397 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene lpxH CDS 1350506..1351246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1351431..1351814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1351898..1352533) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460001.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene hisIE CDS complement(1352530..1353276) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene hisF CDS 1353880..1355241 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1355307..1355990) product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1356117..1356827) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1357071..1358234 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1358263..1359093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1359202..1360035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1360249..1360989) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460044.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene hisA CDS complement(1361022..1361642) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene hisH CDS complement(1361652..1362725) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460048.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene hisB CDS complement(1362756..1363808) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene hisC CDS complement(1363822..1365117) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene hisD CDS complement(1365121..1366017) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene hisG CDS complement(1366540..1368129) product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene tet(35) CDS complement(1368624..1368773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1368865..1369287 product DNA-binding protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460020.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1369505..1370809) product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1370993..1373629) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene topA CDS 1373851..1374120 product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478953.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1374289..1375086 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1375164..1376444) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445261.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene aroA CDS complement(1376562..1377017) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1377024..1377731 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene aat CDS 1377781..1378479 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1378549..1378767 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene infA assembly_gap 1378794..1378813 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1378876..1381140) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene clpA CDS complement(1381198..1381548) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene clpS CDS 1381959..1382180 product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene cspD CDS complement(1382255..1382482) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423709.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1382794..1383450 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1383690..1384508) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1384857..1386281 product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene arcD CDS complement(1386547..1388775) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 1389268..1389945 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262308.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1390054..1390317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1390481..1391611 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262316.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene mnmA CDS 1391629..1392246 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene hflD CDS 1392387..1393757 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene purB CDS complement(1393843..1395291) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434699.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene glgA CDS complement(1395609..1396655) product porin OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751972.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene ompT CDS 1397199..1399268 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489085.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene dinG CDS 1399286..1400065 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492537.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1400076..1400624 product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881612.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1400624..1400785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1400815..1401621 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481860.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene xthA assembly_gap 1401656..1401731 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1401767..1402450) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456275.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1402456..1403196) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456256.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1403446..1404222) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481817.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(1404288..1405058) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456207.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1405667..1407208 product DUF3360 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456280.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1407541..1409817 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene pflB CDS 1410426..1411430 product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1411558..1412292 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene pflA CDS 1412382..1412882 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1412937..1413680) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1413882..1415816 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1415972..1417246 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1417270..1418796 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1418873..1419628) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422541.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene kdsB CDS complement(1419630..1419809) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1419799..1420797) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053055813.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene lpxK CDS complement(1420801..1422549) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene msbA CDS complement(1422582..1424480) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1424759..1425406 product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1425530..1426774) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene lolE CDS complement(1426771..1427484) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene lolD CDS complement(1427477..1428601) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene lolC CDS 1428914..1432369 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene mfd CDS 1432534..1433316 product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021454880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1433393..1434274) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1434653..1435942) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1436270..1436812) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene ycfP CDS complement(1437053..1437643) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene lpoB CDS complement(1437653..1438042) product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1438042..1439403) product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1439445..1439795) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene hinT CDS 1440016..1441176 product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461150.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1441278..1442045) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419708.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene udp CDS complement(1442319..1442735) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 1443136..1444320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1444365..1445555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 1445545..1446576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1446670..1448106) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1448328..1449230 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1449382..1449963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 1449977..1450663 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422561.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1450660..1452048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1452240..1453436 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1453480..1454079) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1454161..1455051) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054775568.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1455210..1456106) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1456907..1457392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1457406..1457972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1457982..1459415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1459641..1460468 product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 1460588..1460992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 1461230..1462213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1462320..1463285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1463480..1464169) product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1464429..1465226 product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460804.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene kdgR CDS complement(1465314..1469513) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482725.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene fdhF CDS complement(1469816..1472023) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213942.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene metE CDS complement(1472307..1472804) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982260.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1472801..1473073) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1473380..1474513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1474594..1475811) product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1475993..1477003 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963715.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1477142..1477393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1477439..1478680 product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene yjeH CDS complement(1478796..1479479) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1479479..1479874) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181837.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1479977..1480873 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1481029..1481514 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1481666..1482139) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1483045..1486683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1486798..1486944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1487167..1487448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1487908..1488528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1488525..1489364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1489644..1490288 product type B-5 chloramphenicol O-acetyltransferase CatB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene catB CDS 1490922..1491620 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1491683..1493233) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261612.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1493259..1495091) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1495084..1496868) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1497111..1497317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1497570..1497803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1498105..1498647 product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene sigZ CDS complement(1498698..1499495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1499501..1500478) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462806.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene ftsZ CDS 1500774..1501511 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1501624..1502169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1502267..1502779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1502879..1504498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1504782..1505021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1505138..1505569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1505629..1506345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1506454..1507302) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1507433..1507969) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118351.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1507966..1508364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1508630..1510195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1510756..1512975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1513295..1513696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1513680..1514522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1514693..1516162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 1516641..1516979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 1517277..1518215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1518720..1519220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1519927..1520358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1520973..1521707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461144.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1521768..1522070 product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1522336..1523193 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042747.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene tesB CDS complement(1523190..1524212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1524479..1525912 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene putP CDS complement(1525965..1526432) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1526563..1527627 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1527789..1527992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1528368..1528511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1528480..1531170 product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1531292..1531609) product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 1531791..1532348 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461140.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1532378..1533205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 assembly_gap 1533244..1535615 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1535684..1538794) product vibriobactin export RND transporter permease subunit VexH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene vexH CDS complement(1538794..1539909) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262152.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 tRNA 1540205..1540289 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 assembly_gap 1540323..1540616 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 1540682..1540766 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(1540838..1541782) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1541961..1542947) product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene oppF CDS complement(1542959..1543933) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482402.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1543954..1544856) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262163.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene oppC CDS complement(1544871..1545713) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262164.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene oppB CDS 1545733..1545891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1545892..1547523) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1548053..1548499) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene moaE CDS complement(1548501..1548746) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene moaD CDS complement(1548743..1549222) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene moaC CDS complement(1549229..1549741) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene moaB CDS complement(1549798..1550787) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene moaA CDS 1551118..1552005 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1552044..1552403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1552396..1553799) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106018.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1553835..1555880) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482400.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene uvrB tRNA 1556382..1556457 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 1556835..1557416 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380762.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene rsxA CDS 1557416..1557997 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418571.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene rsxB CDS 1558003..1560633 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480818.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene rsxC CDS 1560633..1561682 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480820.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene rsxD CDS 1561687..1562316 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene rsxG CDS 1562316..1563008 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 1563030..1563665 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene nth CDS 1563704..1564120 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480812.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene gloA CDS 1564399..1565043 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene rnt CDS 1565089..1566414 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(1566540..1566869) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1567358..1567942 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene sodB CDS 1568325..1569002 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1569155..1571827) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene adhE CDS 1572418..1573059 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461786.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1573211..1574098 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1574236..1575357) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene asd CDS complement(1575532..1576533) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene yejK CDS 1576618..1576833 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123168.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1576949..1578658 product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461736.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 tRNA 1578923..1579013 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 1579094..1579834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(1579870..1580823) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1580825..1581229) product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1582382..1583077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 1583219..1583488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 note possible pseudo, frameshifted CDS 1583485..1583745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1584610..1585107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 1585232..1586203 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1586318..1586632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1586795..1588273 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1588648..1588956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 1588941..1589258 product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005672747.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 1589245..1590294 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694624.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1590407..1590934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1591175..1591582) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887982.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(1591649..1592413) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 note possible pseudo, internal stop codon CDS 1592809..1593354 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 1593514..1594098 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1594341..1595762 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1596026..1597186) product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1597675..1598412 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1598529..1599386) product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459311.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1599389..1602364) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1602591..1604126 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1604193..1604342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 1604436..1605914 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183449.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1606306..1607064) product efflux transporter transcriptional repressor VdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene vdeR CDS 1607217..1608272 product multidrug efflux RND transporter periplasmic adaptor subunit VmeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106358.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene vmeT CDS 1608272..1609324 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946587.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 1609324..1612377 product multidrug efflux RND transporter permease subunit VmeV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene vmeV CDS complement(1612504..1615167) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263805.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1615684..1619757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1619770..1621995 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480219.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 1621997..1622386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1622710..1623555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(1623713..1624747) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene manA CDS complement(1625484..1626365) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 1626535..1627698 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1627934..1628605 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1628862..1630718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1631196..1631693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1632033..1633160) product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1633150..1634199) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457822.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1634233..1635651) product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1635738..1636994) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1637323..1638117) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1638110..1638883) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139219.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1639118..1640425 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene ugpB CDS 1640482..1641363 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene ugpA CDS 1641363..1642211 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385387.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene ugpE CDS 1642215..1643321 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene ugpC CDS 1643314..1644144 product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1644249..1645316) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 1645628..1646359 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460584.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 1646335..1647120 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460571.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1647138..1647398 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 1647418..1647675 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460583.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 1647675..1648244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1648241..1649635 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460589.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 1649718..1650077 product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460551.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 1650079..1651791 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460598.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 1651772..1653325 product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 1653325..1653777 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479006.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 1653876..1654469 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1654435..1656786 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1656786..1657403 product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1657418..1658623 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1658616..1659080 product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1659077..1659802 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460603.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene fabG CDS 1659799..1661028 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1661159..1661770) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1661851..1662948) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 1663370..1663690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480298.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1663696..1664697) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1665123..1666073 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene tal CDS 1666237..1667055 product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 1667167..1668102 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070762.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1668401..1669282 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392198.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1669472..1669909) product DUF3859 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1670161..1672911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1673418..1673666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 1674319..1675749 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1675818..1676750 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462861.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 1676747..1679044 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 1679263..1679937 product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene imuA CDS 1679934..1681436 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1681485..1684592 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453944.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1684689..1685033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1685399..1686238) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene fadR CDS 1686872..1688467 product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene nhaB CDS 1688610..1689134 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene dsbB CDS complement(1689220..1691007) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581733.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene edd CDS complement(1691009..1691512) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1691710..1692717) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 1693424..1694188 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 1694241..1694657 product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 1695279..1695725 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1695787..1696023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1696007..1697080 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1697108..1698079 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784004.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1698180..1698782) product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482415.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 1698927..1699883 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene dusC CDS complement(1700000..1701841) product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482420.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene malZ CDS complement(1701996..1702790) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620368.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(1702787..1703704) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1703796..1704761) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201234.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1705083..1705490) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene yfbV CDS 1705863..1707059 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461478.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1707155..1709287 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene pta CDS complement(1709559..1709867) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155655847.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(1709975..1710217) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(1710426..1711316) product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1711559..1712485 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1712509..1712709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1712868..1714157) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene menE CDS complement(1714365..1715360) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215211.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene menC CDS complement(1715440..1716312) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene menH CDS complement(1716313..1718043) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene menD CDS complement(1718040..1719344) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902260.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 1719570..1720784 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179458.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1720839..1721426 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene yfbR CDS 1721467..1722780 product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1722777..1723439) product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1723445..1723990 product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055412.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene rrtA CDS complement(1723985..1724293) product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021449594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1724452..1726308) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene ppiD CDS complement(1726465..1726740) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1726925..1729276) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene lon CDS complement(1729522..1730799) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene clpX CDS complement(1730871..1731494) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418252.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene clpP CDS complement(1731606..1732907) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene tig CDS complement(1733371..1734798) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene gltX CDS 1735423..1736247 product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1736348..1737040) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453980.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1737273..1737449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1738209..1739261 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1739526..1740338 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262381.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1740408..1740569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1740941..1742608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 1742605..1743468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1743791..1744789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 1744897..1746219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(1746374..1749025) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489828.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1749716..1750276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(1750483..1751127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1751663..1752403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 1752427..1752750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1752759..1753442 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 1753451..1753993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1754315..1755310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 tRNA complement(1755559..1755635) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 1756093..1756635 product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481355.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene smrA CDS 1756653..1757675 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481361.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene rluF CDS complement(1757803..1758276) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186559.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene ybaK CDS complement(1758290..1759936) product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene ushA CDS complement(1760052..1760909) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400335.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene kdsA CDS complement(1760928..1761737) product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1761741..1762124) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1762115..1762981) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene prmC CDS complement(1762985..1764073) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418202.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene prfA CDS complement(1764091..1765341) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490531.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene hemA CDS 1765528..1766082 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene lolB CDS 1766130..1766972 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105711.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene ispE CDS 1766999..1767946 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113134.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1768178..1768768 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105710.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene pth CDS 1768779..1769870 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene ychF tRNA 1770255..1770331 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 1770371..1770455 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 1770464..1770538 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 1770620..1770696 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 assembly_gap 1770768..1772717 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 1772779..1772863 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(1772989..1774137) product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1774663..1776048 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483497.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene miaB CDS 1776199..1777305 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 1777306..1777770 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene ybeY CDS 1777830..1778726 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483493.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene corC CDS 1778870..1780303 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene lnt assembly_gap 1780364..1781310 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1781375..1781845) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483489.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 1782293..1784866 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene leuS CDS 1784989..1785747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 1785757..1786767 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene holA CDS 1786819..1787136 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456130.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene rsfS CDS 1787140..1787610 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene rlmH CDS 1787617..1789515 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493014.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene mrdA CDS 1789512..1790633 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene rodA CDS 1790633..1791424 product septal ring lytic transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene rlpA CDS 1791654..1792835 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 1793009..1793278 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene ybeD CDS 1793435..1794148 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261452.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene lipB CDS 1794141..1795106 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene lipA CDS 1795367..1795696 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261423.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 1796238..1797014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 1797256..1798239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1798577..1799068 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061696.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1799141..1800391) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418084.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1800960..1801514) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene gmhB CDS 1801697..1802731 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene metN CDS 1802721..1803398 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1803426..1804235 product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1804601..1806190) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1806166..1806327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 1806605..1807312 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene tsaA CDS 1807385..1809100 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 1809190..1809393 product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 assembly_gap 1809449..1810925 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1810943..1811131) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1811372..1812337 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 1812432..1812923 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 1812929..1814236 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1815177..1816640) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene nagE CDS 1816770..1817660 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477420.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(1817728..1817937) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1818225..1818998) product YggN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(1819047..1820144) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene dinB CDS 1820291..1821541 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105062851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1821622..1822152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 assembly_gap 1822429..1823298 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1823378..1823611) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene nqrM CDS complement(1823621..1824655) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456539.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1824759..1825985) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418137.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene nqrF CDS complement(1826009..1826605) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene nqrE CDS complement(1826613..1827245) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(1827245..1828012) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418134.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1828002..1829243) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456580.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1829247..1830587) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1830944..1831246) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene bolA CDS 1831455..1832591 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1832681..1833256 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 1833253..1833798 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1833873..1835255 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1835328..1835999) product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482349.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1835996..1836583) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1836631..1838016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1838038..1838610) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1838901..1839710 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482307.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 1839880..1840764 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028571.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene panE CDS 1840761..1841366 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 1841359..1842570 product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482293.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene csdA CDS complement(1842622..1843047) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene csdE CDS complement(1843064..1843873) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417869.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene tcdA CDS complement(1843976..1845076) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456533.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene mltA CDS 1845276..1846595 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene argA CDS complement(1846611..1848770) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene recD CDS complement(1848767..1852354) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene recB CDS complement(1852623..1856096) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene recC CDS complement(1856124..1857089) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 1857209..1858114 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146407.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 1858199..1858498 product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 1858589..1859233 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 1859617..1860648 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene dapD CDS 1860802..1861425 product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1861558..1862856) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(1863787..1864827) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(1864843..1865787) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1865790..1866755) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(1866767..1868224) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1868241..1869455) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1869486..1870031) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1870028..1870483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(1870486..1871742) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451008.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(1871781..1872020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1872037..1873500) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1873509..1874240) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene cpaB CDS complement(1874237..1875586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456587.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 1875632..1875979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(1876179..1876352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1876498..1876674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 1876836..1877525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 1877704..1879410 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456535.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1879479..1881563) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene fusA CDS complement(1881753..1883132) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene radA CDS complement(1883136..1884047) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481549.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene serB CDS 1884122..1884718 product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1884803..1885522) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene deoD CDS complement(1885590..1886813) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1886829..1888163) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059246.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene deoA CDS complement(1888232..1889008) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene deoC CDS complement(1889284..1889460) product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417708.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1889641..1890885) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051831.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1891096..1891872) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 1892274..1893566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1893659..1894354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1894351..1895187) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262942.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1895287..1896876) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene prfC CDS complement(1897007..1897990) product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071572.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1898063..1899724) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071571.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene hcp CDS complement(1900055..1900498) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214241.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene rimI CDS complement(1900491..1900895) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1900900..1901403) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1901393..1901926) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456068.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 1902121..1903134 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 1903148..1904020 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1904147..1905055) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene nlpI CDS complement(1905175..1907298) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene pnp CDS complement(1907816..1908085) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene rpsO CDS complement(1908231..1909181) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene truB CDS complement(1909181..1909612) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene rbfA CDS complement(1909687..1912374) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene infB CDS complement(1912395..1913882) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456069.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene nusA CDS complement(1913906..1914361) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene rimP tRNA complement(1914614..1914690) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(1914741..1914824) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(1914841..1915179) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene secG CDS complement(1915366..1915887) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene lspA CDS complement(1915880..1918711) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene ileS CDS complement(1918808..1919695) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene ribF CDS complement(1919872..1921431) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477919.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene murJ CDS 1921744..1922004 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene rpsT CDS complement(1922111..1922428) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1922489..1923385) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene nhaR CDS 1923730..1924878 product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1924976..1925965) product Solitary outer membrane autotransporter beta-barrel domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1926083..1926934) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1926934..1927770) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene lgt CDS complement(1927793..1928590) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481395.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1928590..1930845) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481393.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene ptsP CDS complement(1930858..1931376) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481384.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene rppH CDS 1931991..1932668 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene mutH CDS complement(1932679..1933026) product DUF6482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481791.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1933105..1934016) product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1934209..1934817 product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1935045..1937138 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene ppk1 CDS 1937125..1938663 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460163.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene ppx CDS 1938736..1939482 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460200.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1939479..1940186) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene phoU CDS complement(1940214..1941032) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene pstB CDS complement(1941022..1942653) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene pstA CDS complement(1942716..1944905) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1945100..1946056) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952782.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1946053..1947366) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene phoR CDS complement(1947403..1948092) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091117.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene phoB CDS 1948277..1949185 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483046.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene rdgC CDS 1949325..1950698 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene yegQ CDS 1950702..1950956 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460170.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1951117..1951572 product DUF6314 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704085.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1951575..1952426 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704084.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1952685..1953161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 note possible pseudo, frameshifted CDS 1953112..1953723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 note possible pseudo, frameshifted tRNA complement(1953813..1953889) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 rRNA complement(1953977..1954087) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 assembly_gap 1954164..1958622 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(1958844..1958919) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(1958957..1959032) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(1959066..1959141) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(1959144..1959219) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 assembly_gap 1959285..1961254 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1961521..1964097) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene clpB CDS complement(1964219..1964941) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene pgeF CDS complement(1964944..1965918) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460300.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene rluD CDS 1966034..1966783 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460312.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1966873..1968324 product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 1968628..1968975 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene raiA CDS 1969108..1970286 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene pheA CDS 1970287..1970832 product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene yjjX CDS complement(1970848..1971144) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene trpR CDS complement(1971177..1973099) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105682.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene sltY CDS 1973314..1974981 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene ettA CDS complement(1975074..1976204) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene tyrA CDS complement(1976220..1977290) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477886.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 1977555..1979240 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364257.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1979233..1979958 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene btsR CDS complement(1979932..1980921) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477936.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene nagZ CDS 1981015..1982133 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 1982142..1983041 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene murQ CDS 1983347..1984861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1985117..1985461) product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1985678..1987162 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1987244..1988209) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene ispH CDS complement(1988359..1988790) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene fkpB CDS complement(1988879..1989826) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene secF CDS complement(1989841..1991694) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880549.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene secD CDS complement(1991717..1992052) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460204.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene yajC CDS complement(1992195..1993331) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene tgt CDS complement(1993560..1994612) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482995.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene queA CDS complement(1994757..1995929) product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483019.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 1996260..1996703 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420573.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1996769..1998274) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene lysS CDS complement(1998287..1999147) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene prfB note possible pseudo, frameshifted CDS complement(1999503..2001242) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene recJ CDS complement(2001308..2002048) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene dsbC CDS complement(2002100..2002948) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479728.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene xerD CDS 2003128..2003646 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479739.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene fldB CDS 2003776..2004501 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488675.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 2004576..2005793 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479730.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene srmB CDS complement(2005877..2006308) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081002.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(2006357..2006911) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399930.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(2007018..2007791) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene yaaA CDS complement(2007897..2009393) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262565.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 2009895..2010083 product DUF3545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459060.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(2010185..2010736) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(2010807..2011487) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene ung CDS complement(2011735..2012586) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene nfo CDS 2012905..2013282 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene grcA CDS complement(2013568..2014848) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene thrC CDS complement(2014845..2015807) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene thrB CDS complement(2015810..2018269) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479590.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene thrA assembly_gap 2018312..2018331 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2018719..2019231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 2019636..2020352 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105671.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene arcA CDS complement(2020427..2020891) product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(2020942..2023314) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene arcB CDS complement(2023433..2024389) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 2024916..2029454 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480840.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene gltB CDS 2029457..2030926 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(2030934..2031101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 2031241..2031597 product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 2031674..2032375 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461186.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene mtnN CDS 2032375..2032992 product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 2033178..2034032 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105668.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(2033959..2034753) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461211.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(2034897..2036426) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104442.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(2036486..2036839) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene tnpB CDS complement(2036836..2037147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(2037360..2040590) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene carB CDS complement(2040608..2041747) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene carA CDS complement(2042205..2043014) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene dapB CDS complement(2043097..2043492) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821181.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene mutT CDS complement(2043571..2046297) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene secA CDS 2046581..2047036 product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480837.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(2047295..2048212) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene lpxC CDS complement(2048305..2049504) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene ftsZ CDS complement(2049534..2050802) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene ftsA CDS complement(2050805..2051581) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(2051708..2053168) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene murC CDS complement(2053260..2054324) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene murG CDS complement(2054321..2055619) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458190.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene ftsW CDS complement(2055609..2056952) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458170.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene murD CDS complement(2056956..2058038) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene mraY CDS complement(2058035..2059396) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(2059393..2060880) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene murE CDS complement(2060889..2062646) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(2062646..2062981) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene ftsL CDS complement(2062978..2063928) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene rsmH CDS complement(2064619..2065413) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene rsmI CDS 2065546..2067372 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458195.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 2067356..2067724 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420941.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 2067727..2068317 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 2068346..2069131 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105663.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(2069220..2069714) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene sspB CDS complement(2069714..2070349) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene sspA CDS complement(2070434..2071171) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(2071171..2072433) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(2072433..2073038) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene petA CDS complement(2073366..2073764) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420956.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene rpsI CDS complement(2073774..2074202) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396465.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene rplM CDS complement(2074468..2075580) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105660.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene zapE CDS 2075700..2076134 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457173.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene zapG CDS 2076250..2077620 product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457169.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 2077724..2078812 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490480.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene degS CDS complement(2078912..2081164) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene parC CDS complement(2081167..2083047) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457157.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene parE CDS complement(2083311..2083904) product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262650.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene yqiA CDS complement(2083905..2084723) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868845.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene cpdA CDS complement(2084758..2085198) product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054775669.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(2085177..2085815) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene nudF CDS 2086083..2087399 product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene vpoC CDS complement(2087604..2088347) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455109.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(2088598..2089869) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455110.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene murA CDS complement(2089879..2090133) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene ibaG CDS complement(2090126..2090461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(2090458..2091099) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478835.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(2091102..2091581) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455116.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene mlaD CDS complement(2091584..2092375) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene mlaE CDS complement(2092372..2093175) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455119.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene mlaF CDS 2093365..2094330 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 2094341..2095315 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455124.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene kdsD CDS 2095319..2095876 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene kdsC CDS 2095873..2096436 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467805.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene lptC CDS 2096417..2096914 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene lptA CDS 2096922..2097647 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene lptB CDS 2097675..2099126 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478844.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 2099148..2099435 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261180.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene hpf CDS 2099438..2099905 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467453.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene ptsN CDS 2099910..2100779 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237199.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene rapZ CDS 2100776..2101048 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 2101224..2102582 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840452.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene mgtE assembly_gap 2102628..2102647 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2102680..2104077) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382645.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene pmbA CDS 2104154..2104678 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene yjgA CDS complement(2104741..2106186) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene tldD CDS complement(2106190..2107032) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(2107044..2110850) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478842.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(2110935..2112404) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene rng CDS complement(2112421..2112996) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(2113000..2113488) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461823.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene mreD CDS complement(2113478..2114398) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461822.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene mreC CDS complement(2114447..2115490) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381144.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(2115635..2119003) product MSHA biogenesis protein MshQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261170.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(2118996..2119493) product MSHA biogenesis protein MshP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(2119483..2120277) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481003.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(2120277..2120876) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2120866..2121363) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(2121495..2121959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(2122260..2122724) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139685680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(2123052..2123552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(2123849..2124433) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738707.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(2124528..2124983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(2124986..2126206) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(2126213..2127940) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122154.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(2127930..2129186) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796892.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(2129183..2130028) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(2130028..2131647) product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene mshL CDS complement(2131663..2131986) product MSHA biogenesis protein MshK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252812.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2131979..2132620) product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene gspM CDS complement(2132620..2134059) product MSHA biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2134105..2136117) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene csrD CDS 2136737..2137726 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395398.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 2137796..2138695 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384671.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 2138688..2139923 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(2139996..2140925) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479860.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 2141049..2142248 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228549.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(2142330..2143181) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400843.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene focA CDS 2143493..2144875 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263736.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(2144955..2145872) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(2145956..2146933) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477354.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 2147439..2148851 product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene pykF CDS complement(2149333..2149827) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene ilvN CDS complement(2149829..2151550) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480580.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(2151908..2153737) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(2153960..2154928) product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140416966.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene leuO CDS complement(2155259..2156332) product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(2156334..2156891) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033837886.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(2157027..2160134) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(2160131..2161447) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 2162090..2163640 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261104.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene leuA CDS 2163712..2164803 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417339.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene leuB CDS 2164857..2166263 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene leuC CDS 2166275..2166877 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261102.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene leuD CDS 2166974..2167774 product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(2167778..2168323) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(2168332..2169177) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459635.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene djlA CDS 2169326..2171767 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277601.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene lptD CDS 2171816..2173126 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459625.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene surA CDS 2173116..2174102 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene pdxA CDS 2174099..2174902 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459622.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene rsmA CDS 2174933..2175313 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459620.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene apaG CDS 2175328..2176131 product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035032.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(2176190..2176678) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459612.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene folA CDS complement(2176689..2177165) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(2177162..2177929) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(2178049..2179107) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706870.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(2179220..2180386) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene cgtA CDS complement(2180607..2180864) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383095.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene rpmA CDS complement(2180884..2181195) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene rplU CDS 2181465..2182436 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene ispB CDS complement(2182563..2183498) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene mdh CDS 2183793..2184263 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246635.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene argR CDS 2184695..2185663 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454688.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 2185930..2188503 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261091.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 2188577..2189014 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261090.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(2189072..2190040) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(2190050..2190787) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261089.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene rluA CDS complement(2190801..2193707) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rapA CDS 2194007..2195383 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461836.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2195461..2196102) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2196093..2197457) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261084.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene mpl CDS 2197678..2198694 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene fbp CDS complement(2198691..2199212) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(2199260..2199604) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(2199697..2203542) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479640.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2203545..2205212) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 2205406..2206038 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884809.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene msrA CDS 2206137..2206700 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792388.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 2206870..2207595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 2207671..2208390 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 2208387..2209646 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 2209657..2210148 product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2210226..2211074) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479657.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene cobA CDS 2211315..2211770 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2211774..2212358) product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081780.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 2212607..2213266 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 2213424..2214692 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 2214836..2215327 product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2215427..2215807) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene rplQ CDS complement(2215834..2216826) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383143.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene rpoA CDS complement(2216851..2217471) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383146.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene rpsD CDS complement(2217503..2217892) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene rpsK CDS complement(2217911..2218267) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450559.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene rpsM CDS complement(2218568..2219902) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene secY CDS complement(2219923..2220357) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene rplO CDS complement(2220363..2220539) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene rpmD CDS complement(2220545..2221045) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene rpsE CDS complement(2221060..2221413) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358092.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene rplR CDS complement(2221423..2221956) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455654.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene rplF CDS complement(2221967..2222359) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455656.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene rpsH CDS complement(2222389..2222694) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene rpsN CDS complement(2222712..2223251) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455660.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene rplE CDS complement(2223276..2223593) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455662.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene rplX CDS complement(2223605..2223976) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene rplN CDS complement(2224141..2224395) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene rpsQ CDS complement(2224395..2224586) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379576.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene rpmC CDS complement(2224586..2224996) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417237.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene rplP CDS complement(2225008..2225706) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383161.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene rpsC CDS complement(2225723..2226055) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417234.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene rplV CDS complement(2226066..2226344) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138114.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene rpsS CDS complement(2226364..2227188) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489461.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene rplB CDS complement(2227204..2227506) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398471.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene rplW CDS complement(2227503..2228105) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene rplD CDS complement(2228122..2228751) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene rplC CDS complement(2228766..2229077) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181007.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene rpsJ CDS complement(2229540..2230724) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417220.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene tuf CDS complement(2230875..2232968) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488930.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene fusA CDS complement(2233108..2233578) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene rpsG CDS complement(2233693..2234067) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene rpsL CDS complement(2234262..2234537) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene tusB CDS complement(2234541..2234897) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261074.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene tusC CDS complement(2234894..2235286) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene tusD CDS complement(2235288..2236001) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438378.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(2236162..2236962) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene fkpA CDS 2237328..2237570 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261071.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2237684..2238232) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene slyD CDS complement(2238319..2238519) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464767.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2238506..2240317) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene kefB CDS complement(2240304..2240900) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene kefG CDS 2241019..2242938 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480039.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 2243038..2243409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 note possible pseudo, frameshifted CDS 2243402..2244382 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2244401..2244622 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480073.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2244688..2245557 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2245781..2246413 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene crp CDS complement(2246501..2247298) product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(2247361..2248824) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene astD CDS complement(2248848..2249867) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000962042.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene astA CDS complement(2249892..2251100) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458126.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2251397..2251987) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(2252095..2253120) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene trpS CDS complement(2253254..2253940) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480027.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2253957..2254628) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421083.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene rpe CDS complement(2254733..2255554) product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(2255622..2257058) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(2257081..2258184) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480443.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene aroB CDS complement(2258220..2258738) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421091.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene aroK CDS complement(2258890..2260041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(2260046..2260603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(2260600..2261145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(2261145..2262005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 2262138..2264798 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668733.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(2264855..2265745) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465160.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene oxyR CDS complement(2265928..2266275) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2266531..2268405) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene argH CDS complement(2268462..2269676) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2269754..2270536) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281558.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene argB CDS complement(2270559..2271578) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921321.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene argC CDS 2271710..2272867 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465145.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene argE CDS 2273054..2275684 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262715.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene ppc CDS 2276150..2276680 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395734.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2276844..2277728) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene metF CDS complement(2277899..2280307) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465137.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2280310..2281473) product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 2281664..2281981 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005432736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene metJ CDS complement(2282092..2283354) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2283568..2283786) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene rpmE CDS 2284087..2286288 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481427.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene priA CDS 2286479..2287483 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene cytR CDS 2287550..2288110 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene ftsN CDS 2288263..2288787 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene hslV CDS 2288797..2290131 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457198.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene hslU CDS complement(2290296..2291120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2291177..2292322) product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384656.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(2292374..2293675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2293844..2295466) product glycerone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2295520..2296608) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005392234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 2297008..2297985 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453793.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene dhaK CDS 2298001..2298636 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379705.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene dhaL CDS complement(2298698..2300626) product dihydroxyacetone kinase operon transcriptional regulator DhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene dhaR CDS complement(2301379..2301582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 2301686..2302960 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114437.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2303020..2304186) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2304202..2305287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2305509..2306450 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene rfaD CDS 2306463..2307419 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene lpxM CDS 2307409..2308608 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261011.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 2308605..2309699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(2309681..2310727) product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene pseI CDS complement(2310734..2311435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(2311437..2313620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2313613..2314737) product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene pseG CDS complement(2314737..2315426) product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene pseF CDS complement(2315423..2316589) product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene pseC CDS complement(2316594..2317607) product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene pseB CDS complement(2317627..2318730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(2318737..2319693) product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 2320422..2321183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2321148..2321861) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260996.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 2321953..2322996 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260995.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 2323000..2323476 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260992.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene coaD CDS complement(2323546..2324550) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(2324547..2325368) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114647.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene mutM CDS complement(2325480..2325647) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051801.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene rpmG CDS complement(2325661..2325897) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467944.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene rpmB CDS 2326279..2328357 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459023.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene recG CDS complement(2328436..2330772) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478620.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 2330998..2332896 product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459016.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 2332924..2333424 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene greB CDS 2333643..2334362 product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459027.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene ompR CDS 2334379..2335794 product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459014.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene envZ CDS complement(2335893..2336522) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene nfuA CDS complement(2336638..2337201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2337559..2338323 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene bioH CDS complement(2338329..2339147) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458987.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene cysQ CDS complement(2339153..2339710) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene nudE CDS complement(2339829..2340602) product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(2340602..2341102) product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458943.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2341102..2342352) product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene gspL CDS complement(2342321..2343382) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene gspK CDS complement(2343363..2344037) product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465187.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene gspJ CDS complement(2344021..2344380) product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene gspI CDS complement(2344367..2344969) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478669.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene gspH CDS complement(2344979..2345422) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene gspG CDS complement(2345451..2346668) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262831.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene gspF CDS complement(2346668..2348173) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478662.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene gspE CDS complement(2348173..2350200) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene gspD CDS complement(2350294..2351214) product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262834.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene gspC CDS 2351429..2351815 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465328.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene hslR CDS 2351830..2352699 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene hslO CDS 2353020..2354648 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217613.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene pckA CDS 2354755..2356683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2356661..2357584) product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456791.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2357628..2358062) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene dtd CDS complement(2358034..2358849) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(2359271..2361100) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416970.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene typA CDS 2361764..2363173 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene glnA CDS 2363600..2364655 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478632.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene glnL CDS 2364680..2366089 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456831.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene glnG CDS 2366513..2367475 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124535.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2367444..2369234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2369305..2370678) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene hemN CDS complement(2370808..2371296) product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2371303..2371851) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478647.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene yihI CDS complement(2371838..2372488) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(2373220..2373837) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 2374050..2374703 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456829.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene yihA CDS complement(2375270..2378074) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene polA CDS complement(2378455..2378889) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(2378953..2379966) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene hemB CDS 2380099..2380860 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(2380916..2381662) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459771.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene tatC CDS complement(2381708..2382046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(2382050..2382307) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene tatA CDS complement(2382344..2383978) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478626.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene ubiB CDS complement(2383975..2384583) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(2384596..2385369) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456853.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene ubiE CDS 2385686..2386588 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478651.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2386600..2387862) product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263659.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 2388209..2388550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(2388599..2389786) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478661.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2389945..2390268) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394407.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene uspB CDS complement(2390346..2390873) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467599.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene ftnA CDS 2391091..2391516 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene uspA CDS complement(2391597..2392376) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478714.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 2392492..2392953 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene asnC CDS complement(2393004..2395046) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene prlC CDS 2395161..2396000 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262845.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2396048..2397403 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478739.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene gorA CDS complement(2397505..2397993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 assembly_gap 2398057..2399666 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2399891..2400829) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2400832..2401809) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455219.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2401986..2403539) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(2403662..2405389) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2405986..2406219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2406305..2406670) product DUF4145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289435.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 2407167..2407493 product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459127.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2407582..2408595) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(2408765..2409988) product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene arsJ CDS complement(2410069..2410566) product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(2410622..2411629) product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2411678..2412076) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421229.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(2412187..2412804) product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene rhtB CDS 2412874..2413851 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262839.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 2413972..2414793 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213463.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2414827..2415846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 2415846..2416433 product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065604261.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(2416473..2417189) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene yigB CDS complement(2417189..2418109) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421444.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene xerC CDS complement(2418090..2418791) product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479000.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2418816..2419646) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545404.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene dapF CDS complement(2419656..2420909) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene lysA CDS 2421129..2421440 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005953.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene cyaY CDS complement(2421455..2423980) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149662.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 2424317..2425252 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459122.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene hemC CDS 2425258..2426004 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217491.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 2426004..2427158 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478990.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 2427155..2428333 product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478975.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2428462..2429058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 note possible pseudo, frameshifted CDS complement(2429009..2429485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 note possible pseudo, frameshifted CDS complement(2430065..2431789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215945.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2431841..2432914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 2433797..2433955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 2434137..2434547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2434733..2435191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2435502..2435975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2437069..2437245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2437440..2437739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 2438318..2440075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 2441141..2442157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2442244..2442549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2442657..2443055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(2443201..2444343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2444463..2445734) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479498.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 tRNA complement(2445815..2445905) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 assembly_gap 2445988..2451110 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2451449..2451985) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene hemG CDS complement(2451996..2453453) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2453461..2454078) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465047.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 2454274..2456445 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481023.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene fadB CDS 2456465..2457628 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene fadA CDS 2457807..2458790 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416807.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(2458837..2459778) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260906.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 2460004..2460252 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005426051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene tusA CDS complement(2460279..2460833) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2461290..2462219 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene glyQ CDS 2462222..2464288 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene glyS CDS 2464416..2465672 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(2465726..2466178) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458680.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(2466541..2468958) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene gyrB CDS complement(2469224..2470306) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458661.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene recF CDS complement(2470311..2471411) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486165.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene dnaN CDS complement(2471427..2472800) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099214.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene dnaA CDS 2473161..2473916 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260898.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 2474031..2474702 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481192.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2474699..2475436 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 2475702..2475839 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene rpmH CDS 2475852..2476208 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458485.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene rnpA CDS 2476435..2478063 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458471.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene yidC CDS 2478178..2479539 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205962.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene mnmE CDS 2479542..2479982 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581314.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene mioC CDS 2480459..2482360 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481156.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene mnmG CDS 2482357..2482986 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262904.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene rsmG CDS 2482995..2483774 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 2483798..2484691 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458443.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 2484832..2485221 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 2485230..2486036 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421592.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene atpB CDS 2486081..2486338 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450922.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene atpE CDS 2486399..2486869 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene atpF CDS 2486884..2487417 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene atpH CDS 2487431..2488972 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457301.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene atpA CDS 2489017..2489883 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457304.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene atpG CDS 2489918..2491321 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262899.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene atpD CDS 2491340..2491762 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719050.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 2492139..2493509 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421582.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene glmU CDS complement(2493568..2494233) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456023.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 2494404..2495180 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456015.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2495297..2496490) product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868544.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene punC CDS 2496606..2497511 product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465352.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene punR CDS complement(2497553..2499085) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262898.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene ilvA CDS complement(2499090..2500931) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481171.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene ilvD CDS complement(2500941..2501885) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457316.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene ilvE CDS complement(2501897..2502181) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378958.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene ilvM CDS complement(2502193..2503839) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145255.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene ilvG CDS 2504235..2505761 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521788.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2505817..2506419) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732279.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2506452..2507438) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(2507508..2508926) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481163.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene ccoG CDS complement(2509114..2509380) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421548.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 2509878..2510684 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008130.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2510681..2512126) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(2512138..2513514) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461427.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene trkA CDS complement(2513550..2514830) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481161.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene rsmB CDS complement(2514886..2515833) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene fmt CDS complement(2515851..2516360) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461416.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene def CDS 2516470..2517600 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461424.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene dprA CDS 2517603..2518076 product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979769.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 2518096..2518662 product topoisomerase DNA-binding C4 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461441.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2518740..2519855) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(2519860..2520345) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394016.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene purE CDS 2520528..2521085 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461456.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 2521089..2521994 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443976.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene hemF CDS 2522071..2522904 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461457.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene aroE CDS 2522905..2523168 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461429.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(2523161..2523709) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461433.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 assembly_gap 2524091..2529862 estimated_length known gap_type within scaffold linkage_evidence paired-ends rRNA 2529882..2529983 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 2530079..2530155 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 2530214..2530290 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 2530941..2531324 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene crcB CDS 2531561..2532739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 2532729..2533487 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene thiF CDS 2533487..2533696 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene thiS CDS 2533699..2534481 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 2534478..2535596 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465071.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene thiH CDS complement(2535702..2537483) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 2537873..2538154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060371.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(2538172..2538651) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(2538641..2539432) product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458569.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2539432..2540283) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458570.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(2540359..2540619) product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 2540900..2543071 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480961.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene uvrD CDS complement(2543200..2543853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(2544882..2545541) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2545538..2546437) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480950.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene rarD CDS 2546583..2548415 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458577.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene recQ CDS 2548408..2548710 product DUF3630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458579.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 2548972..2549637 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015358.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(2549739..2550713) product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463759.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(2550817..2552301) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene gppA CDS complement(2552309..2553625) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene rhlB CDS 2553732..2554058 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280783.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene trxA CDS 2554286..2555545 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378757.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene rho CDS 2555698..2556663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 2556786..2558588 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489172.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene ubiD CDS 2558585..2558854 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222789.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 2558870..2559580 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459134.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene fre assembly_gap 2559920..2565194 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 2565256..2565331 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 rRNA 2565382..2565492 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 CDS 2565746..2566408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(2566417..2567304) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene ilvY CDS 2567447..2568931 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene ilvC CDS complement(2569189..2569440) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(2569578..2572649) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262875.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2572660..2573760) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(2573776..2574348) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 2574518..2576533 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene rep CDS complement(2576604..2577017) product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 tRNA 2577305..2577381 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 2577428..2577503 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 2577650..2577726 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 2577771..2577846 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 2577898..2577974 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS complement(2578107..2578376) product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421383.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(2578379..2578987) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189766.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene rsmD CDS 2579126..2580364 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481951.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene ftsY CDS 2580388..2581062 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene ftsE CDS 2581052..2581984 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481956.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene ftsX CDS 2582151..2583011 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490420.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene rpoH CDS 2583378..2583701 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460380.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene glpE CDS 2583698..2584534 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460378.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene glpG CDS 2584632..2585183 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460374.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 2585173..2586024 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127681.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene ubiA CDS complement(2586257..2588680) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460370.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene plsB CDS 2588847..2589203 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459671.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 2589294..2589911 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene lexA CDS 2590007..2591374 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480864.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene dinF CDS complement(2591412..2592812) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460367.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene sthA CDS 2592990..2593619 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480868.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene fabR CDS 2593616..2593975 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2594033..2595142) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene trmA CDS 2595360..2596157 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098149.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene murI CDS complement(2596129..2596296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 2596403..2596666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 sequence2 source 1..1079265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 309..449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(442..615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(730..885) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(907..1788) product DUF2861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240572.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(1788..2450) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815044.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(2425..3879) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960565.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(4184..5563) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272521.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene pntB CDS complement(5574..7112) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165536.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(7273..7554) product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(7791..8750) product Solitary outer membrane autotransporter beta-barrel domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 9089..9523 product DUF3069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461031.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(9621..10715) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479305.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene modC CDS complement(10712..11404) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524683.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene modB CDS complement(11462..12232) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479390.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene modA CDS complement(12280..12933) product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(12988..14169) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494051.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(14703..15548) product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071369.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(15545..16231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(16674..17144) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene nrdG CDS complement(17196..18446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 18600..20132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 20125..23937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 23930..24598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 24591..25100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 25354..27423 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869255.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(27460..27780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(27872..28219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 28207..28734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(28849..31899) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(32018..33316) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(33306..34853) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 35243..36937 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974287.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 36942..38564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 38598..40607 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964267.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 40604..42889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 43561..44181 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(44603..45100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(45103..47325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(47331..48362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(48387..48857) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422225.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene nrdG CDS complement(48867..51008) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene nrdD CDS complement(51031..52092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 52428..53288 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479310.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(53381..54223) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(54406..54822) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(54826..55248) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155658156.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(55259..55585) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114934.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 55753..57411 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 57629..58699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(58814..60448) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946483.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(60692..61783) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460895.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 62007..62219 product DUF2986 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480281.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(62339..62830) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480252.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(62920..63576) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479135.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(63703..64275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 64428..64994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 65101..66405 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671603.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 66475..67104 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 67113..67586 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034756.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(67705..68322) product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477314.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(68422..69165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 69473..70015 product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 70040..71749 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483312.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 72022..72354 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454817.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 72406..73233 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 73220..75304 product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 75304..76059 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454821.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 76115..76537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 76570..78162 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 78140..79243 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483417.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 79394..80626 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263837.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 80685..81893 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263838.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 81890..83329 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483422.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 83322..84707 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483419.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 84826..85563 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263841.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 85565..86683 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263842.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 86680..88104 product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483455.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(88232..88597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(88607..89749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(90020..91144) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(91154..91621) product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(91621..92367) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(92783..93238) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049417.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 93514..94599 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 94601..95773 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483424.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 95797..96435 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483433.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 96679..98823 product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477345.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 98840..99385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477075.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(99698..100540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(100860..101621) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480270.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene cobA CDS complement(101730..102581) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418214.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(102679..103002) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene nirD CDS complement(103017..105575) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480247.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene nirB CDS 105913..106914 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454392.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene add CDS complement(107195..107542) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418869.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene yajD CDS complement(107741..108361) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423161.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 108722..109495 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(109487..110005) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 110138..110431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(110694..111092) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 111444..111653 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 111748..112287 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700187.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(112355..113026) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(113026..114123) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(114306..114812) product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(115038..115499) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 115717..116019 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(116106..117239) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480805.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 117439..118038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(118138..118617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(118664..119188) product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480803.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 119283..120110 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480808.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene nadE CDS 120804..121349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(121637..122392) product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469307.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(122703..123362) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421904.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(123539..125326) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544192.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 125633..126439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 126722..127822 product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925640.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(127893..129461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(129655..131319) product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(132086..133864) product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(135066..136886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(136983..137744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(139115..140557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(140637..141395) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209559.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 142515..143531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 143866..144531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 144989..145693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(145794..146501) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263231.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(146505..148370) product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482867.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(148552..149271) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 149875..150585 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 150727..152085 product sodium-coupled multidrug efflux MATE transporter PdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284947.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene pdrM CDS complement(152306..154444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(154444..156615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 156931..157266 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170147.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 157299..158222 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482884.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 158269..158892 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379148.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 159488..161239 product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 161847..163049 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 163184..163645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(163745..168451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 168857..170560 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216141.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 170557..171276 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 171403..172599 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348936.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(172697..173350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(173520..174929) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(175205..176200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(176197..176859) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(176867..177742) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816885.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(177773..178615) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816886.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(178620..179300) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277843.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 179854..180600 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479122.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 180600..181397 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479143.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 181410..182234 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479113.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 182334..183269 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479152.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(183436..186009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(186006..190652) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994092.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(190897..191289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(191300..192013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(191958..193355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(193355..194251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 194722..195033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 195030..195218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(195242..195433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 195495..196613 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068712904.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(196786..198204) product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105416.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(198289..198630) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene tnpB CDS complement(198617..198859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(199107..200348) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964247.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(200758..202149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(202467..204260) product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(204251..205228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(205225..207996) product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(207999..209087) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 note possible pseudo, frameshifted CDS complement(209089..209433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 note possible pseudo, frameshifted CDS complement(209439..211406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(211554..212150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(212714..213757) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463577.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(214175..215686) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(215829..216185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454342.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 216734..217966 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486542.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 218274..218510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(218642..219121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 219523..220893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(221199..222500) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454697.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene dbpA CDS 223260..224183 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263347.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 224374..224994 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(225082..225429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187740.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(225444..226700) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(226971..227594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 228082..228324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017447309.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(228386..229276) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene malG CDS complement(229289..230866) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895488.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene malF CDS complement(230934..232112) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463104.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene malE CDS 232821..233945 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463102.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene malK CDS complement(234047..234862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(234859..237201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(237288..237977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(238118..238681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(238773..239462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(239950..240150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422950.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(240431..241180) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462960.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene pstB CDS complement(241222..242085) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478161.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene pstA CDS complement(242091..243002) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462956.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene pstC CDS complement(243105..243926) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(244641..245969) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499754.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 246237..246521 product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038496.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(246614..247564) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478383.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(247554..249008) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478177.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene phrB CDS complement(249022..249999) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478143.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 250154..251599 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(251674..252567) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619521.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 252821..253228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 253228..254358 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263258.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(255051..255902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 255936..256091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(256400..257584) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(257581..259506) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(259506..260204) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263153.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 260482..261921 product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene nhaD CDS 262010..263116 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(263190..264332) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene ugpC CDS complement(264342..265079) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416645.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(265066..266559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(266686..267966) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930288.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene ugpB CDS complement(267973..268911) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(268933..269817) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(269921..270805) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451302.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(270957..271301) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261337.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 271548..272426 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 272426..272863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992651.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 272860..273465 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458304.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 273462..273899 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458360.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 273899..274927 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458373.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene rsgA CDS complement(274965..276350) product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261762.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(276702..276926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 note possible pseudo, internal stop codon CDS complement(276993..277121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 277310..277948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(278047..278712) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263353.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene queE CDS complement(278714..279076) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845978.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene queD CDS complement(279263..280252) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461922.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(280933..281511) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929768.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 281685..282563 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461877.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 282737..283633 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 283885..285069 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263303.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(285323..286174) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468574.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(286310..286684) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258882.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 assembly_gap 287022..288034 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(288237..290417) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778752.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene glgB CDS complement(290822..293008) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene malQ CDS complement(293179..295632) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480123.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 296185..298890 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264940.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene malT CDS 299106..300149 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050971.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene wecA CDS complement(300210..300995) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261032.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(301012..301878) product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112489.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(301878..302666) product DUF616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931906.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(302653..303726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(303772..305004) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(305005..305556) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene rfbC CDS complement(305569..306441) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene rfbD CDS complement(306438..307334) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462486.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene rfbA CDS complement(307411..308484) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481408.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene rfbB CDS 309203..309385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 309445..309582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(310290..311318) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663451.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(311527..311727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(312227..314185) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462474.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(314233..315465) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(315618..316241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 note possible pseudo, frameshifted CDS complement(316234..316833) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462478.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(316841..317047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(317347..318471) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(318486..319370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(319393..320475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(320476..321651) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(321679..322608) product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(322660..323703) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228262.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(323693..324646) product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289068.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(324666..326180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(326306..327331) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(327494..328774) product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene tviB CDS complement(329153..331360) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261021.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(331420..331845) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(331872..333086) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(333863..334849) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(334947..335297) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422463.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(335446..336138) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene queC CDS 336283..336738 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454351.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(336853..337095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(337173..339251) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477569.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene helD CDS 339465..341612 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454352.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene yccS CDS 341644..342348 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462713.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 342513..344060 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994115.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene glpD CDS 344418..345419 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482880.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 345422..346945 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460814.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 347204..347656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(347751..348203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 348648..349475 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167389.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(349492..350457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263040.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(350451..352994) product LuxQ periplasmic sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477121.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(353017..354108) product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823678.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(354093..354389) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(354404..355060) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025631.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 355267..355581 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 355645..356235 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(356232..357182) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263942.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(357260..358159) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 358323..360017 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462890.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 360118..361257 product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478054.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene lldD CDS 361308..364157 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(364253..367405) product multidrug efflux RND transporter permease subunit VmeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene vmeZ CDS complement(367410..368567) product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene vmeY CDS complement(368808..369695) product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072656.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 370046..370669 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706154.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 370714..371541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 371664..372863 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462380.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(372973..373881) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477146.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(374036..374734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 374818..376971 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(377064..377834) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482849.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 378091..378345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 378356..378694 product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(378777..379235) product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(379332..380546) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414469.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 380662..381117 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426186.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene soxR CDS complement(381251..382636) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818937.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 assembly_gap 383678..385130 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 385172..386584 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene tnaA CDS 386703..387959 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043405.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 388505..388750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 388750..389067 product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160966.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(389233..389577) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065119.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(390134..390892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(391011..391490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(392238..394103) product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene nadN CDS 394466..397183 product GlyGly-anchored extracellular endonuclease Xds inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426028.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene xds CDS complement(397386..398387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(398702..399181) product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(399381..400124) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283643.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 400810..403389 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800561.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 403863..406436 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067209.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 406782..409379 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(410302..411660) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463953.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(411665..412105) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 412517..415102 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027470.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(415263..416141) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285667.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(416443..417318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 417556..418851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(418918..421014) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(421014..421865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(422169..422399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(422485..422730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421716.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(422800..423978) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479628.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(423975..424601) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263092.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(424611..425015) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459364.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(425051..425608) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083290.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(425608..426987) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263089.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(426991..427770) product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029797603.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 428252..429604 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469664.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene yegD CDS 429726..429896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(429925..431028) product GlyGly-anchored extracellular serine protease VesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233647.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene vesA CDS complement(431326..431898) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene yeiP CDS complement(432104..433324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(433883..434095) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(434770..435213) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421584.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(435229..436614) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262899.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene atpD CDS complement(436644..437513) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262900.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene atpG CDS complement(437560..439101) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene atpA CDS complement(439111..439662) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281808.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene atpH CDS complement(439674..440144) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene atpF CDS complement(440212..440448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(440494..441261) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene atpB CDS complement(441263..441664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 442299..442781 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352302.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 442927..444018 product DUF3541 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479954.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(444123..444281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(444520..444876) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene raiA CDS 445550..447628 product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 447919..448821 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065641382.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 448953..449381 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459700.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 449681..451297 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 451635..452594 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 452686..453186 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 453188..454492 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(454619..455467) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 455813..456232 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463700.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene rbsD CDS 456263..457768 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463701.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene rbsA CDS 457765..458748 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene rbsC CDS 458817..459695 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene rbsB CDS 459799..460713 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463705.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene rbsK CDS 460728..461729 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(461854..462477) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261400.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene ureG CDS complement(462496..463188) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(463228..463833) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206087.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(463881..464330) product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene ureE CDS complement(464351..466054) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene ureC CDS complement(466177..466515) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206082.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(466596..466898) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene ureA CDS complement(466924..467913) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(467910..468605) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene urtE CDS complement(468607..469458) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene urtD CDS complement(469455..470630) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene urtC CDS complement(470641..472269) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398880.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene urtB CDS complement(472422..473705) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene urtA CDS complement(474008..475375) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479004.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(475372..476034) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 476575..476874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 477323..479773 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 479855..482647 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693992.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 482718..484451 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 484774..485331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457036.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(485407..486570) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171814.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(486567..487706) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679653.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(487711..488691) product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859627.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(488681..490099) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865460.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 490494..492845 product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032475098.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 493098..494069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184231.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(494309..494737) product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(494993..495649) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(495777..496784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 497086..498153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 498279..499304 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(499390..500505) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(501345..501677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 501992..502522 product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455994.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(502572..507308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 507481..508470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(508531..509496) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455166.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(509597..509953) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467110.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(510085..510960) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266186.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(511122..511838) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464874.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(511954..512178) product DUF3283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009502.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(512525..512704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026548.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 512972..513445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451231.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(513494..515470) product DUF3346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093519.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 516844..518064 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817997.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 518068..519042 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985780.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(519110..520378) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894643.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(520619..520810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 520768..522738 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464868.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(523060..525192) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464845.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(525355..526746) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071265.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 527092..527733 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464858.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene pdxH CDS 527940..528335 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263243.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 528752..529087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 529089..529385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(529527..531374) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454756.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 531831..535013 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477456.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene putA CDS 535016..535711 product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233685.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 535814..536947 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711606.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(536987..538120) product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(538145..538864) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261750.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 539310..539981 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263654.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 540192..541175 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204065824.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(541301..542383) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(542383..543318) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261329.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 543422..544606 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene chrA CDS 544748..544939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705509.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(545050..546102) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263273.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene aroG CDS complement(546443..548047) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150912620.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 548189..548632 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(548959..549543) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(549669..550349) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258735.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(550391..551032) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(551214..551768) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(552059..553414) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263665.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene astB CDS complement(553431..554468) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705768.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene astA CDS 554857..555597 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704255.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(555687..557513) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477482.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(557669..559549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(559786..561786) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene glgX CDS 562386..563624 product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757932.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene lamB CDS 563765..564589 product MalM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244228.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 564861..565502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(565799..567892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(567968..568930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(569003..569560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 570080..570874 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 570864..571697 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(571764..573080) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462024.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(574252..575853) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263910.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 576150..577385 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene coxB CDS 577385..579031 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482647.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene ctaD CDS 579039..579665 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 579662..580537 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482671.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(580545..580766) product DUF2909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482739.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 580741..581562 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106290.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 581565..582170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482681.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 582178..583248 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462008.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 583245..584141 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482743.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene cyoE CDS complement(584264..585208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 585329..586228 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705387.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 586307..586687 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491259.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 586884..588344 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(588469..590217) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(590379..590846) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354908.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 591403..591774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 note possible pseudo, internal stop codon, frameshifted CDS complement(592753..593280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(593884..594927) product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(595323..595853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 596395..597156 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene kduD CDS 597211..597846 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482830.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 598010..598366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 note possible pseudo, frameshifted CDS 598384..598740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 note possible pseudo, frameshifted CDS complement(598830..599858) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 599801..599992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 600094..600309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(600331..600654) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039970622.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 600841..601365 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106219.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(601422..601955) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 602364..603176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 603282..604424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 604470..605756 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 605945..607600 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926026.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 608289..608558 product sporulation delaying system autorepressor SdpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243541.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene sdpR CDS 609873..610034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(610522..611973) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262914.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 612535..613437 product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 613418..614959 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462305.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(615060..615695) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477263.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(615919..617511) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477479.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene ahpF CDS complement(617685..618242) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene ahpC CDS complement(618756..619532) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(619547..620623) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102709.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene hisC CDS 620774..621655 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(621915..622619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(623103..624761) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151656485.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(624767..626713) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096405.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(626706..627674) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135747.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(627671..628165) product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462967.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(628172..629176) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263513.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(629187..630143) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462975.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 630961..631590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(631738..633894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(633894..634502) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene ccoO CDS complement(634502..635914) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene ccoN CDS complement(635926..636264) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513613.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(636486..638990) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 639428..640240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 640287..642860 product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene nirB CDS 642924..643268 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261473.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene nirD CDS 643380..644849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 644942..646672 product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(646813..647775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(648130..648618) product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 648800..649222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(649242..649736) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481711.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 650322..650795 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457113.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 650998..652494 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464242.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 652849..653154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 653290..653715 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065598186.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 653807..654739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263254.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 654977..655231 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 655224..655493 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(655788..658655) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478418.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene gcvP CDS complement(658865..659245) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene gcvH CDS 659471..660094 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478414.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 660247..661365 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene gcvT CDS 661374..661658 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455023.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 661682..662299 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461913.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 662635..663873 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477307.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene codB CDS 663883..665160 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477214.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(665679..668489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(669200..670357) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460918.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 670604..671491 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464903.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 tRNA 671699..671773 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(672009..673376) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262654.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene tolC CDS 673864..674556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 note possible pseudo, frameshifted CDS 674519..675307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 note possible pseudo, frameshifted CDS 675309..677393 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073844.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 677386..678714 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073845.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 678995..684580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 assembly_gap 684374..684542 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 687967..689168 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 694810..696507 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 698419..700394 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 703899..705893 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 706499..706735 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 706748..709849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 710000..710989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(711090..712067) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463394.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 712268..713854 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122345.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 713909..715039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 715140..717176 product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063035.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 717192..717950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514321.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 718082..719188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 719185..720684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(720918..721625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 721999..722901 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene yegS CDS complement(722954..724207) product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137027.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene mdtM CDS complement(724588..724947) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(725214..725831) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478451.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 725963..727258 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 727431..727925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(728009..730102) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531239.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 730514..731011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(731151..731540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 731699..732028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 732028..732747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 732752..733057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 733047..733349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 733346..735406 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 735591..736163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 736310..738061 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936297.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(738153..739523) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948685.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 739866..740396 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201885365.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(740511..741386) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263538.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(741580..742662) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070848.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(742780..743088) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263074.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(743153..743485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 743379..744119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 note possible pseudo, frameshifted CDS 744026..744553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 note possible pseudo, frameshifted CDS 744565..745269 product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481525.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene phnR CDS 745382..746785 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481488.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 assembly_gap 749534..750950 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 751002..767027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(767382..768674) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073845.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(768677..770746) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073844.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(770743..772260) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 772729..773334 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263957.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(773443..774327) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069570.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(774603..775583) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456983.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(775576..776172) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene cysC CDS complement(776236..777969) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(777973..779388) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021169.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene cysN CDS complement(779479..780387) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene cysD CDS 780790..781722 product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(781843..784215) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479906.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene ppsA CDS 784394..785227 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464081.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(785391..786170) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560714.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(786170..787234) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261837.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(787237..788085) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479207.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(788082..788504) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261839.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(788501..789172) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445085.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(789191..790054) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700188.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 790236..791591 product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261842.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene hutW CDS 791611..792132 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050752171.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene hutX CDS 792129..792716 product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261844.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene hutZ CDS 792831..794993 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261850.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 795388..797193 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625975.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(797257..797802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 798573..799865 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261772.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(799985..800125) product TIGR02808 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420446.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(800135..800707) product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463498.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(800740..801294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(801364..803853) product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262391.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene napA CDS complement(803850..804179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 804827..806581 product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593383.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene narQ CDS 806574..807200 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477224.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(807315..807521) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613459.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 807812..808174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(808258..809013) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477078.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene moeB CDS complement(809024..810262) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477201.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene moeA CDS 810431..811084 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477356.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene folE CDS complement(811098..812072) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463561.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(812184..813575) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107451.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene clcA CDS 814495..815487 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482750.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(815484..815645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(815758..816702) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454328.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene ylqF CDS complement(817038..817658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453959.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 818220..818999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 819198..820394 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479020.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(820546..821154) product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460258.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(821369..822730) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897651.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(822939..823574) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699233.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(823635..825059) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483164.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene nrfA CDS 825549..826133 product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262127.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene nrfB CDS 826142..826828 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262126.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene nrfC CDS 826830..827777 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262125.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene nrfD CDS 827881..829902 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483255.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 829899..830321 product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483203.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene nrfF CDS complement(830527..831327) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958189.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 831444..832364 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 832361..832570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(832551..834119) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262022.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 834526..835530 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262017.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 835546..836484 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262016.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 836481..837041 product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262015.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 837034..838056 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477545.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 838049..839767 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262013.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 839757..841052 product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477556.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 841113..842021 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454286.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(842092..842421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 842889..843974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(844090..844812) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(845005..845241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(845512..848775) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(849003..850724) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(850776..851561) product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 851700..853058 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477554.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 853058..854104 product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262008.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(854060..854359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459922.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 854874..855440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(855725..856024) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180246.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(856032..856274) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557292.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 856670..856804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261950.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(856913..857263) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084974.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(857422..858141) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477212.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(858243..858644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 858745..859647 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038155721.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 859674..860228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(860425..860661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 861099..862949 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482888.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(863099..864829) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478462.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene fruA CDS complement(864840..865796) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163391.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene pfkB CDS complement(865801..866934) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478424.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene fruB CDS 867309..868298 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454171.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene cra CDS complement(868303..869256) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262445.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(869389..870291) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459241.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(870509..871498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(871911..872759) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836936.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(872816..875833) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485697.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(876172..877326) product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 878255..878638 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810315.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene ridA CDS 878686..879855 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070680.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 879883..880740 product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458347.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene pdxY CDS 881057..881614 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479970.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(881717..882463) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399305.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(882497..882943) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482937.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 883176..884081 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073194.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(884256..885518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 886312..887283 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 887295..888146 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091620756.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 888173..889090 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(889414..889968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(890047..890250) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262957.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(890262..890804) product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021102.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 891728..892228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 892334..893173 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 893313..894113 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 894155..894466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 894589..895233 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 895298..895738 product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387426.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(895970..896878) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320146.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 897215..897835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 898062..898835 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477770.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 898968..900269 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816129.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(900377..900676) product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 901123..902583 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818491.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(902685..902912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250488.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 903446..923179 product retention module-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489282.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 923375..925735 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 926139..926825 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462115.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(926905..927726) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462121.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 927882..928235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(928256..929473) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene glgC CDS 929771..931285 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139398.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene glpK CDS complement(931357..932388) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210005.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene pyrC CDS 932704..933540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(933629..934366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(934595..934774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 934821..935483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(935602..936477) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(936689..937501) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 937668..938558 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(938795..940360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(940589..942469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(942686..943066) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261806.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 943451..944422 product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266450.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 944660..945232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 945236..946267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 946572..947588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962726.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 948013..948465 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093235.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 948833..949861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(950147..950959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(951086..952498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(952513..953130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(953134..953649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 954139..954609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(954842..955969) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817174.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene hypD CDS complement(955956..956204) product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817175.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene hybG CDS complement(956206..957315) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817176.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene hypB CDS complement(957317..957652) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene hypA CDS complement(957657..958688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(958688..961060) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817173.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene hypF CDS complement(961064..961306) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776342.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(961319..963061) product NiFe hydrogenase assembly chaperone HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072159.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(963128..963652) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072160.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(963649..964353) product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072161.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene cybH CDS complement(964367..966070) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072162.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene hyaB CDS complement(966070..967215) product nickel-dependent hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072163.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene hyaA CDS complement(967232..967384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(967415..968431) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098475.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene hypE CDS 968686..969342 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 969563..970384 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene thiD CDS 970392..971195 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263202.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 971188..971982 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482930.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 972014..972967 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482863.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 973002..973973 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482863.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 973983..974648 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263205.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene tenA CDS 974682..975473 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482855.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene thiM CDS 975483..976106 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482839.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene thiE CDS complement(976212..977609) product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 977973..980141 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206605.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 980181..981779 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 982229..982831 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030130.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(983309..983740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 984136..984414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 984614..984829 product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478080.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(984909..985628) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073860.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 985886..987316 product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454152.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 987404..988015 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780723.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 988072..988536 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129045.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(988717..989442) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963439.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(989435..990082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(990259..990996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(991958..993106) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479145.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(993241..994116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(994281..996278) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489296.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene rnb CDS 996743..996880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 997151..999082 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483383.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 999444..1000637 product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072096.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(1000732..1001643) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926300.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 1001801..1002997 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092856.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 1002997..1004028 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692622.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene tdh CDS 1004325..1004792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 1005032..1006624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 1006725..1007177 product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481265.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(1007186..1007977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(1008034..1008276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(1008502..1008681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 1008634..1008945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 1008942..1009295 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene tnpB CDS 1009355..1009720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(1009915..1010862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 1010948..1011175 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375557.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 1011313..1012170 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene yghU CDS 1012571..1014073 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477796.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene zwf CDS 1014073..1014786 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene pgl CDS 1014811..1016259 product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene gnd CDS 1016422..1017186 product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073756.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(1017233..1017700) product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 1018070..1018423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479810.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 1018530..1019252 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene nfsA CDS 1019254..1019802 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423707.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(1019876..1020910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 1021167..1021898 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 1022807..1023334 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477057.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 1023331..1023903 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477055.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(1024142..1025779) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489275.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 1026100..1027875 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132206.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 1028131..1028322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479763.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 1028467..1029948 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262922.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(1030050..1031009) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704799.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(1031545..1032174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 1032419..1032667 product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048897891.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 1032876..1033991 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483378.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(1034300..1035319) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477846.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(1035573..1036142) product PhnA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102406.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(1036304..1037092) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753571.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 1037232..1037708 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626096.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 1037705..1037926 product DUF3389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455381.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 1037993..1039696 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(1039701..1041203) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118044.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(1041257..1042849) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000856.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 1043105..1043347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(1043444..1044460) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162811019.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(1044461..1045552) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954183.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(1045651..1047459) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001914695.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 1047761..1048150 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(1048182..1049642) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263049.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(1050049..1050768) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459943.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 1051113..1051706 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261899.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 1051804..1052400 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 1052439..1053707 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479127.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(1053833..1054843) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347567.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene ltaE CDS complement(1054855..1055373) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034744.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 1055632..1057299 product DUF3763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106400.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 1057309..1058754 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106399.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene viaA CDS complement(1058981..1060639) product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479764.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(1060761..1062665) product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479772.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(1063021..1064214) product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455363.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(1064229..1064825) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455373.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 1064824..1065528 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194969.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 1065537..1067993 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645916.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(1068337..1069272) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900842.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(1069286..1070023) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065610322.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene pxpB CDS complement(1070023..1070751) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882609.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 1070991..1072004 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455290.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene galE CDS complement(1072300..1074675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 1074877..1075497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 1075528..1076520 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169444.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(1076517..1077482) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263422.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 1077648..1077959 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455336.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene yciH CDS 1078237..1078623 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 sequence3 source 1..223073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..1085) product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278833.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(1085..2320) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048869.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(3518..4588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(4811..4969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(5610..6104) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409153.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(6248..6619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 note possible pseudo, internal stop codon, frameshifted CDS complement(7246..11376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963924.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(11872..12180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 note possible pseudo, internal stop codon CDS 12695..13585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(13793..15304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 15881..16036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 15987..16412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 16963..17223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 17225..17947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 18087..19112 product IS110-like element IS1618 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211760.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(19906..20742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003613.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 21091..21639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 assembly_gap 21924..23714 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23975..24241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548929.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(24358..27240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(27253..27753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 28119..28334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 28340..28543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(28583..31432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(31436..32833) product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175404606.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(32835..33794) product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942772.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(33951..34193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(34193..35338) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113001.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(35325..35621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(36270..38183) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667080.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(38262..38549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(38739..39161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(39500..39799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(39934..40074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 assembly_gap 40180..41556 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41584..41742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(41823..42653) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151652833.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(42640..43251) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261706.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(43261..43899) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261707.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(43915..44667) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261708.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(44664..45068) product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261709.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(45037..45702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261710.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(46235..46984) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(47094..47963) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002372093.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(48137..48397) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(48387..48575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 note possible pseudo, frameshifted CDS complement(48808..49044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(49230..49457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(49485..49850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 49884..50063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(50229..50444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(50514..51476) product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(51590..51712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(51748..51960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(52034..52963) product CbbQ/NirQ/NorQ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939317.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(53076..53324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(53335..54486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(54561..55526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(55612..55884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(55961..56368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 assembly_gap 56711..59404 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(59531..59806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(59803..61530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(61776..61958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 note possible pseudo, internal stop codon, frameshifted CDS complement(62161..62625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 note possible pseudo, frameshifted CDS complement(62885..63532) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114814.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene leuD CDS complement(63548..64975) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244781.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene leuC CDS 65130..66035 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(66097..68610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(68598..69767) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398495.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(69770..70783) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098374.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(70832..73762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(74240..74692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 note possible pseudo, internal stop codon CDS complement(75026..75175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 75316..76005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 note possible pseudo, internal stop codon CDS 76093..76470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 note possible pseudo, internal stop codon CDS 77097..78053 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095491983.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 78308..78463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 78840..79823 product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 assembly_gap 79983..80002 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 80802..83320 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 84206..84910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 85057..85767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 85773..86882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(87250..88503) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015512063.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(88513..89457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(89464..90729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(90833..91936) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene ectB CDS complement(91947..92150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 note possible pseudo, frameshifted CDS complement(92163..93482) product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296487.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(93508..93858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(93893..94288) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(94278..95285) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211248.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(95351..96106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 note possible pseudo, frameshifted CDS complement(96243..97214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(97215..97601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(97592..97858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(97871..99481) product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533314.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(99486..99938) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(99935..100414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(100389..101336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(102379..104010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(104007..104687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(104756..105550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(105552..107201) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016117864.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(107194..109299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(109286..110152) product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097953302.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 110362..110895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 110999..111859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 112325..113776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 113795..115201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 115203..116069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 116168..116887 product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775488.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 117139..117855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(117933..118385) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454164.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(118841..119107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 119063..119413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 note possible pseudo, internal stop codon CDS 119507..120013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 note possible pseudo, internal stop codon CDS complement(120014..120181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 120422..120976 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147567.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 121069..124068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(124567..124872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(124844..125212) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(125315..126526) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090602.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(126528..127664) product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497334.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(127867..129171) product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159463.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(129174..129533) product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719728.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(129546..130436) product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815769.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(130447..130806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528288.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(130823..131725) product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254807.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene yhfZ CDS complement(131955..133085) product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359808.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene chiP CDS complement(133142..134032) product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(134029..134370) product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366185.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene chbA CDS complement(134373..135698) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704317.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(135707..136021) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722179.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 136719..137243 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181848.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 137431..138000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 138301..138498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 138678..140087 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301909.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 140071..142098 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 142760..142948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 142945..143487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(143518..144474) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 assembly_gap 144647..147228 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(147303..147569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 note possible pseudo, frameshifted CDS complement(147831..149984) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(149988..151274) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(151333..151524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(151524..151802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 152234..152911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 note possible pseudo, internal stop codon CDS 152924..153352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 note possible pseudo, internal stop codon, frameshifted CDS complement(154036..154836) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533078.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(154848..155138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(155139..155789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 156308..156571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 156564..157103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(157122..157334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(157391..158122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(158146..159078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(159141..161171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(161204..163849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(163904..164557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(164688..165119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(165139..166176) product IncHI-type conjugal transfer protein TrhU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011070.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene trhU CDS complement(166176..167171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(167297..167830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(167843..170449) product IncHI-type conjugal transfer ATPase TrhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255538.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene trhC CDS complement(170460..171185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(171199..171522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(171585..172196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(172193..173548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(173553..174356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(174356..174952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(174988..175287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(175644..176192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(176197..176760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(176760..176987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(177097..177753) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704213.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene elbB CDS complement(178001..178816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 178976..179953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(180019..180678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(180671..182239) product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173272813.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene traD CDS complement(182211..182537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(182530..184152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 184267..184746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 184787..185488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(185783..185947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(186004..186558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(187024..187368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 188170..188613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(188919..189863) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161118179.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 189982..191196 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 191210..191962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 191962..192873 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802593.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 repeat_region 193316..194686 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgtaagcacggggaacac CDS complement(194768..195043) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378852.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene cas2e CDS complement(195063..195983) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene cas1e CDS complement(195984..197468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(197465..198103) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334996.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene cas5e CDS complement(198096..199133) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942036.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene cas7e CDS complement(199186..199605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(199618..200160) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281401.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene cas6e CDS complement(200170..202587) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942033.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene cas3 CDS 203391..203801 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(203997..204164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(204555..206759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(207927..208931) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964925.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 assembly_gap 209054..211319 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(211536..212906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(212903..214564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(214786..215019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 note possible pseudo, frameshifted CDS complement(215564..216229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(216983..217210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(217194..217550) product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005672747.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 217653..219137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 219271..220785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 220778..222325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 222345..222884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 sequence4 source 1..170492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(663..1436) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(1429..3144) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455813.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene cysI CDS complement(3144..4949) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261116.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(5063..5293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455817.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(5443..6102) product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082171.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(6186..6392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(6585..7565) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261114.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene dusA CDS complement(7780..8583) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453767.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(8761..10413) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene pgi CDS complement(10627..11721) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106087.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene alr CDS complement(11730..13130) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455859.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 13366..14124 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455861.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(14198..14650) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene rplI CDS complement(14684..14911) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090472.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene rpsR CDS complement(14928..15230) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467185.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene priB CDS complement(15239..15628) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381299.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene rpsF CDS complement(15970..16707) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480034.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene rlmB CDS complement(16721..18244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 note possible pseudo, frameshifted CDS complement(18253..19179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 note possible pseudo, frameshifted CDS complement(19281..19706) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460673.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene nsrR CDS 19816..21000 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262719.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene hmpA CDS complement(21069..22382) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460670.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(22521..22706) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480030.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(22773..23753) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460668.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene hflC CDS complement(23756..24952) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460667.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene hflK CDS complement(24998..26287) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480048.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene hflX CDS complement(26337..26597) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438329.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene hfq CDS complement(26761..27693) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192300.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene miaA CDS complement(27686..29710) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155485.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene mutL CDS complement(29707..31392) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480021.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(31389..31964) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene tsaE CDS 32054..33166 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061012950.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene queG tRNA complement(33748..33824) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(33906..33981) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 assembly_gap 34058..35059 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35178..35723) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456987.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene orn CDS 35892..36947 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene rsgA CDS 37003..37875 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482194.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene asd CDS complement(38016..38663) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001920521.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 38848..39663 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457195.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 39751..40263 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456236.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene rraA CDS 40449..41864 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 41877..42596 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 42681..43574 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(43582..44556) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene epmA CDS complement(44553..44747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 44784..46607 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456980.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene frdA CDS 46607..47344 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 47344..47727 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381491.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene frdC CDS 47738..48100 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456924.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene frdD CDS complement(48177..48743) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456976.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene efp CDS 48777..49799 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262738.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene epmB CDS complement(49869..50444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457036.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(50619..52211) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453913.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(52427..53863) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071037.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(54009..57920) product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482097.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene pulA CDS complement(58282..59928) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417158.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene groL CDS complement(59989..60279) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417156.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 60508..61863 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884020.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(61906..62727) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456939.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene cysE CDS complement(62755..63744) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005325.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene gpsA CDS complement(63950..64426) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456911.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene secB CDS complement(64489..64962) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381472.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 65320..66858 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261056.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene gpmM CDS 66924..68084 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127369.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(68144..68386) product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007388.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene zapB CDS 68698..69705 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261061.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene glpX CDS complement(69750..70169) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058339.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(70179..70529) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133286.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 70758..71531 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261058.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene tpiA CDS complement(71684..72646) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460467.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene pfkA CDS complement(72908..73840) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482190.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene fieF CDS 73895..74047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(74113..74625) product CpxP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761521.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 74808..75494 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940152.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 75491..76861 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene cpxA CDS 76955..77431 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478594.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene trmL CDS complement(77453..77941) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene fxsA CDS 78271..79707 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421213.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene aspA CDS 79867..81177 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457503.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 81416..83182 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478597.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 83371..84006 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 84247..84510 product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 84524..86251 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106103.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 86393..86875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458018.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(86845..90312) product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478571.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(90437..91621) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494988.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 91812..92447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 note possible pseudo, frameshifted CDS 92462..93622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 note possible pseudo, frameshifted CDS 93625..94263 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104320.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 94619..96568 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478589.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene acs CDS 96891..97340 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125573.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene aroQ CDS 97395..97859 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene accB CDS 97874..99217 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene accC CDS 99354..100244 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421283.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene prmA CDS 100376..101341 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496441.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene dusB CDS 101387..101683 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462885.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene fis CDS 102042..102764 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071291.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 103208..104257 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071294.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene cobT CDS 104428..105213 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071295.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 105213..105875 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071296.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene cobU CDS 105885..107432 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071297.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(107436..108311) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560672.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene yddG CDS complement(108433..109710) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925813.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(109707..110135) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene zntR CDS 110571..112163 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262778.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene purH CDS 112257..113546 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262779.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene purD CDS complement(113648..114343) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456449.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(114383..114655) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene hupA CDS 114917..116035 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456452.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 assembly_gap 116101..116208 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(116241..116828) product DUF416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456454.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 116908..117834 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262782.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(117909..118550) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993369.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene pyrE CDS complement(118827..119543) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247175.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene rph CDS 119691..120557 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(120643..123783) product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 124219..124572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 124575..125009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 125070..125540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 125591..126010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 126011..126493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 126528..126974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(127051..127188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(127166..127606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(127803..128042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(128077..128490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(128537..128776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(128802..129038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(129268..129504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(129509..135823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(136012..136413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 136813..137655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 137692..138825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 139032..139655 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene gmk CDS 139714..139986 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379346.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene rpoZ CDS 140023..142143 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459012.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene spoT CDS 142146..142832 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478720.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene trmH CDS complement(142873..143547) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482037.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene radC CDS 143718..144926 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478613.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene coaBC CDS 144937..145392 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164750.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene dut CDS 145442..146032 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478760.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene slmA CDS 146048..146992 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458959.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 147171..148115 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458959.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(148257..149321) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421300.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene hemE CDS complement(149436..150230) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456481.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene nudC CDS 150402..150893 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497574.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(151104..155312) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456484.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene rpoC CDS complement(155394..159422) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456486.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene rpoB CDS complement(159654..160022) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421323.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene rplL CDS complement(160080..160574) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481772.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene rplJ CDS complement(160849..161553) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489780.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene rplA CDS complement(161558..161986) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421326.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene rplK CDS complement(162128..162676) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384681.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene nusG CDS complement(162688..163065) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384680.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene secE CDS complement(163322..164506) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417220.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene tuf tRNA complement(164611..164686) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(164699..164773) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(164809..164893) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(164917..164992) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS 165194..166117 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075698.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene coaA CDS complement(166106..167065) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478002.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene birA CDS complement(167052..168113) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593527.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene murB CDS 168322..168636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 168740..170080 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561723.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene pssA sequence5 source 1..19734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 302..1684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 1650..3305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 3306..5882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 5875..6375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(6400..6636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 note possible pseudo, frameshifted CDS 7536..8501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(8461..8661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(8856..9383) product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482705.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(9395..12517) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(12514..14217) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(14217..15566) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482614.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(16154..16384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 17351..18823 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108208.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene ltrA CDS complement(19044..19352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 sequence6 source 1..2704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@