COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..411421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..2997) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene topA CDS complement(3081..4160) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dprA CDS 4454..6619 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 6726..7655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 7850..8719 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(8767..9108) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336963.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(9114..10586) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 10799..11623 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene panB CDS 11620..12459 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene panC CDS complement(12587..13864) product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104490930.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 13985..14707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 14732..15040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 15058..15336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722578.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 15344..15997 product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(16043..18235) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385063.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(18243..19196) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339574.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene deoC CDS complement(19324..19683) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene grxD CDS complement(19813..20052) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(20225..22387) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene purL CDS complement(22521..23075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(23478..24395) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337872.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 24690..25502 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(25533..26258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 26361..27389 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene argC CDS 27454..27903 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene ccmE CDS 27971..28588 product holin-associated N-acetylmuramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337867.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 28579..29076 product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337866.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(29080..30003) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene rocF CDS complement(30202..31911) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene metG CDS 32058..33146 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 33146..34225 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 34222..34785 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 34858..35847 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626531.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 35840..37573 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 38051..38881 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401376.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 38947..39708 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401373.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 39716..40384 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 40397..41065 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 41136..42056 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(42057..42995) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(43006..44268) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(44279..44896) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(45015..46247) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090709.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(46249..48618) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090710.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(48612..49322) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 49499..50716 product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(50717..51460) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(51472..52326) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970321.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(52337..53263) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(53275..54264) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970323.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(54261..55253) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(55346..56983) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(57132..58028) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(58078..58407) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(58400..59929) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969972.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 60093..61025 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 61196..62263 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 62260..63576 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(63579..64379) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 64465..65850 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(65855..66826) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(66839..67243) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530842.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(67266..68765) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(68768..69814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(69811..71934) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530839.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(72026..73060) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(73122..74093) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(74226..75173) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 75423..76661 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 76666..77757 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331302.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(77845..80568) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339229.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene metH CDS complement(80578..81618) product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167354622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(81725..82408) product adenosylcobinamide amidohydrolase CbiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene cbiZ CDS complement(82405..83142) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(83142..84137) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(84140..84997) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(84972..86783) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(87257..88897) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(88949..91141) product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 91482..93461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 93461..94171 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(94178..95305) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932765.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(95400..96614) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene rpoN CDS complement(96611..97336) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089944.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(97381..98877) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339389.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(98892..99710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(99712..100578) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(100575..101672) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532860.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(101786..102832) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(102864..104246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(104265..105455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(105481..106962) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(106989..108305) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(108313..109530) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(109535..109720) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(109761..110960) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 111326..112267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 112411..113481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 113763..114383 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene rpsD CDS 114540..115631 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337377.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene hisC CDS 115628..116557 product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 116554..117474 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337378.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(117462..118451) product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 118515..119048 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 119109..120302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 120304..121611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 121863..122798 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 122810..123574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(123581..124150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(124450..126756) product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 127152..127973 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene ygiD CDS 127984..128949 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 129067..130782 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 130769..131632 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(131652..132653) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338461.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 132717..132929 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 132929..133690 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 133809..133982 product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(134017..134913) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383375.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(134945..135667) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(135773..136948) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(137103..137948) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 138113..139345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(139354..139896) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 139923..141323 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338440.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene argH CDS 141334..141486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 141483..141686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 141775..143040 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720913.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene lysA CDS 143070..145589 product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(145609..146673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 146811..147482 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 147482..148375 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 148375..149163 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383401.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(149183..149497) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(149494..150456) product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722606.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 150597..151061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(151193..152149) product L-malyl-CoA/beta-methylmalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 152426..153433 product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 153500..154462 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 154476..155336 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(155392..155841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(155918..157885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(158011..158751) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 158884..160329 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene pyk CDS 160361..160588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 160731..160931 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722593.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene rpmI CDS 160947..161312 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene rplT CDS 161444..162526 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722590.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene pheS CDS 162523..163227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 163224..165644 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene pheT CDS 165725..167338 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(167310..167696) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(167696..168427) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(168473..168883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 168776..169048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(168958..169788) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 169899..171185 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 171190..171654 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 171712..172968 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 173069..175030 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 175033..175485 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337622.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 175574..176350 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene paaG tRNA 176394..176478 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 176707..178017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 tRNA 178168..178242 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 178410..180197 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 180354..182246 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(182300..183283) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175783.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(183288..185609) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene clpA CDS 185910..187364 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(187381..188151) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038147181.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene gloB CDS 188214..188972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 189302..189868 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 189868..191397 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719460.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene atpA CDS 191419..192294 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337386.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 192313..193731 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene atpD CDS 193744..194142 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337387.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 194241..194591 product H-type lectin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137194167.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(194797..196434) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene groL CDS complement(196491..196778) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 197057..197977 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 198152..199030 product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 199193..199630 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 199665..200588 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337390.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 200636..201082 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 201082..202131 product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(202196..203005) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090534.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(203005..203604) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 203718..204737 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 204841..205677 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(205790..206854) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(206847..207332) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722311.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene purE CDS complement(207415..207645) product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 207876..208289 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 208311..208538 product DUF1150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(208652..210358) product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(210572..211513) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722320.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene trxB CDS 211686..212186 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(212421..213320) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene rpoH CDS complement(213461..215446) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327523.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(215645..216685) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337469.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 216675..217001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 216998..217423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(217537..217794) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 217907..218788 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene lgt CDS 218785..219885 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 219869..220630 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336849.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene pgeF CDS 220869..221042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 221309..222100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(222104..223273) product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(223355..225178) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 225526..226938 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 226946..227899 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719571.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 227896..228708 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 228739..229464 product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(229482..230417) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(230417..230704) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 230770..231330 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 231353..234139 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003581.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 234140..234454 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537516.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 234563..234901 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719579.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 235236..235745 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(235798..237693) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(237826..241317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(241595..242878) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(242973..243341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(243429..244424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 tRNA complement(244551..244634) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 244752..245534 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene rlmB CDS 245746..246165 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(246331..247530) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(247627..248934) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(248931..250286) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338190.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(250304..250984) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338189.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(251117..252448) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(252453..253286) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720538.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(253283..254164) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(254220..254945) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720536.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(254995..255771) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(255902..256354) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(256388..256702) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(256695..256997) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(257054..257365) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(257362..258123) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562844.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene hisF CDS complement(258306..259025) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene hisA CDS 259175..259558 product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(259605..260246) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene hisH CDS complement(260260..260847) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene hisB CDS 260971..261480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 tRNA complement(261567..261641) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(261664..261738) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 261937..262134 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(262184..262552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(262625..266062) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 266227..267675 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(267705..269513) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 269675..270613 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 270640..271086 product DUF6446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 271088..273148 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene glyS CDS complement(273267..274268) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 274441..275781 product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 275781..276596 product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 276589..278118 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085223.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene glpD CDS 278205..279650 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene xylB CDS 279731..280741 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 280806..282320 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 282317..283321 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene rbsC CDS 283318..284334 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 284324..285880 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 285982..287760 product acetolactate synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930005.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 287866..288471 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene gstA CDS 288616..291159 product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(291471..291818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 291750..292076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 292172..293101 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 293140..294159 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene folP CDS 294156..295499 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene glmM CDS complement(295501..296121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(296134..296514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(296599..297621) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene ilvC CDS 297747..298205 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 298202..298660 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337040.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 298802..299614 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 299624..299926 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 299936..300241 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720474.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 300241..301947 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene ureC CDS complement(301952..302308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 302385..302891 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene ureE CDS 302878..303522 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338136.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 303519..304145 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338135.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene ureG CDS 304402..305709 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene urtA CDS 305774..307765 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene urtB CDS 307875..309101 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene urtC CDS 309098..309838 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene urtD CDS 309841..310536 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338131.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene urtE CDS complement(310557..311765) product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(311930..312112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(312212..312871) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 312984..313631 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(313628..315652) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337044.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(315804..316970) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene carA CDS 317139..317597 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 318017..319120 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 319210..320283 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 320391..321644 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 321658..322617 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(322604..323968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(323965..325464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(325575..326225) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 326505..327917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 328069..328617 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 328639..331296 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336841.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(331293..332501) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 332724..333983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 334003..334923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 334952..335929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 335961..337010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(337015..337959) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338408.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(337956..338756) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(338753..339571) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338406.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(339599..340714) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338405.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(340711..341331) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene tmk CDS complement(341338..342510) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(342526..343452) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841512.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 tRNA 343651..343740 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 343872..344099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(343989..347093) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105372141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(347098..348414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(348411..349394) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106663661.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(349394..351439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 351900..353732 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 353729..355105 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 355107..358217 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554541.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(358679..359005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(359070..360350) product DUF3631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091506663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(360350..361297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(361402..361587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(361805..362443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(362440..363732) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(363974..364843) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113743.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(364915..365313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(365341..366354) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387849.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 366527..367483 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene pip CDS complement(367480..368331) product transcriptional regulator MdrR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene mdrR1 CDS 368435..369295 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(369312..369653) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561276.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(369730..371244) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 371492..372298 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 372376..373041 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975155.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 373055..373708 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 373701..374423 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312398.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(374517..375557) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(375631..376269) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 376434..378122 product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 378184..379143 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 379134..380066 product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 380141..381391 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975157.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(381441..382472) product trans-3-hydroxy-L-proline dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975160.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(382570..383253) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 383482..384459 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 384486..385751 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 385823..386677 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 386679..387515 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 387543..388208 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 tRNA complement(388470..388544) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 388660..388845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 388846..390114 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene murA CDS 390114..391028 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 391025..391504 product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 391501..391977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 392173..393504 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338373.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene hisD CDS 393504..393983 product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 393980..394441 product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 394551..394958 product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 394958..395542 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 395539..396441 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 396523..396741 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene infA CDS 396738..397301 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 397298..398338 product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 398335..398520 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene yacG tRNA 398709..398784 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(399414..399836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(399779..400858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(400931..401485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(401713..401943) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 402022..402261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(402258..405461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(405458..405745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 406091..411130 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 sequence02 source 1..66041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 344..1999 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene ettA CDS complement(2199..4292) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(4289..7027) product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(7024..7935) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(7932..8939) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 9010..9615 product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338669.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(9648..10589) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(10660..13518) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537863.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene polA CDS complement(13642..13836) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(13931..14311) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(14322..15896) product DUF5928 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 16046..16864 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(16877..17431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(17551..18537) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(18534..19178) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene nth CDS 19328..20260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 20349..21287 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 21394..22062 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721366.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 22172..22945 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721367.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(23018..23575) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139978.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(23580..24131) product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(24208..24444) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(24500..25231) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(25273..25617) product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 25832..26203 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(26285..27157) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(27256..27435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(27617..28399) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(28403..28708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(28708..30516) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene sdhA CDS complement(30533..30931) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721269.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(30942..31337) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene sdhC CDS complement(31758..32792) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(32792..32998) product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(32995..33552) product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721261.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(33563..34438) product (3S)-malyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 34735..35697 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene mdh CDS complement(35758..36804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 37027..38220 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene sucC CDS 38225..39112 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene sucD CDS 39240..39566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 39595..39963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 40017..42986 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 42990..44522 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003725.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene odhB CDS 44643..46031 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338629.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene lpdA CDS complement(46238..46738) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(46809..47456) product GntR family transcriptional regulator AgkR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene agkR CDS complement(47502..48200) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 48341..48670 product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(48813..49820) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(49817..51343) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(51399..52466) product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612420.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene torT CDS complement(52574..53542) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533155.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(53532..54407) product carboxyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(54418..55791) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(55796..56029) product acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(56047..56823) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 57047..57943 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196222.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(57946..58866) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(58847..61054) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(61071..61451) product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(61561..61998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(62195..62512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 62644..63303 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 63300..64637 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 64678..65388 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 tRNA 65525..65600 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 sequence03 source 1..146408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 244..1128 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene purU CDS 1459..2184 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(2141..3460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 3633..4976 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 5043..7415 product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532911.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 7527..9335 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968356.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 9409..10545 product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532897.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 10605..11207 product dimethylamine monooxygenase subunit DmmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 11204..12151 product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067516.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 12161..13201 product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 13363..14127 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene fabI CDS 14374..14883 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562659.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 14910..15722 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene proC CDS 15719..16054 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 16054..17001 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 17057..18178 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(18284..18883) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383642.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 19142..19603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(19639..20961) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338516.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(21199..21648) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337353.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene dtd CDS complement(21645..22568) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(22584..23708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(23716..24870) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(24885..25880) product DUF2927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337360.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(25882..27048) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384880.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(27076..27777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(27902..28822) product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145399393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(28824..28988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(29057..30856) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384878.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 note possible pseudo, frameshifted CDS 30977..31426 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 31439..31807 product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(31908..33116) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene purD CDS 33238..34779 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene xseA CDS complement(34939..35349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(35425..36567) product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 36677..37306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 37361..38410 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene ftsY CDS complement(38429..39013) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 39038..39943 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 39958..40590 product inner membrane-spanning protein YciB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722725.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 40717..41895 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene metZ CDS 41962..43071 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene folE2 CDS complement(43220..43594) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(43619..44176) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003499036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(44255..44770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 44889..47342 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 47609..48916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 48935..51292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 51474..52556 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 52553..53548 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene galE CDS 53578..55392 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 55389..56285 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338031.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 56517..56798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(56874..57671) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383564.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene rlmJ CDS complement(58208..58411) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 58720..59784 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(60267..60485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 60469..60966 product MraZ family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383216.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 60970..61986 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337235.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene rsmH CDS 61983..62366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 62363..64162 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 64287..65774 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 65776..67227 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene murF CDS 67227..68309 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene mraY CDS 68579..69979 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene murD CDS complement(69984..71084) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337376.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene chrA CDS complement(71078..72019) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228449.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 tRNA 71374..71464 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 72300..73361 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719261.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene ftsW CDS 73373..74476 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337241.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 74473..75894 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719263.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene murC CDS 75896..77080 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 77077..77331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 77394..78224 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 78277..79203 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337243.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene murB CDS 79380..80189 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337244.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 80177..81124 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 81121..82455 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene ftsA CDS 82669..84279 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene ftsZ CDS 84496..85416 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene lpxC CDS 85575..86423 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 86447..88096 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337248.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene recN tRNA complement(86839..86932) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(88093..89274) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(89271..89750) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene moaC CDS complement(89747..90541) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene trpC CDS complement(90551..91447) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene trpD CDS complement(91555..92142) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 92308..93951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(93994..95502) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene trpE CDS complement(95513..97363) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(97430..98611) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(98638..99132) product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890701.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(99137..99640) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene gpt CDS complement(99651..100268) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719508.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(100278..101102) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene fabI CDS 101231..101854 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene pdxH CDS 102004..102534 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 102558..102986 product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 tRNA 103028..103104 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(103419..103595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(103831..104595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(104592..105041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(105719..106069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(106088..108445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(108462..110069) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(110073..110462) product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337420.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(110459..110770) product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(110773..111195) product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(111188..111667) product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(111667..111951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(112122..112691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(112786..113139) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(113139..113861) product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(113862..114488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337426.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(114491..115993) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(115990..116340) product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337428.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(116333..117484) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337429.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(117615..119420) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337430.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 120123..123815 product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 123917..124165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 tRNA 124431..124507 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 124536..124612 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 124745..126010 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(126064..126669) product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 126695..126874 product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723397.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 127022..127807 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338955.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 127804..128622 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(128611..128841) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(128838..129026) product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(129075..130256) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 130401..130844 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(131064..132458) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene fumC CDS complement(132548..133006) product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(133082..133507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(133958..134329) product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384085.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(134434..135483) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 135687..137117 product DNA photolyase PhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene phrA CDS 137194..137670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 137713..138882 product tellurite resistance ADP-ribose pyrophosphatase TrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161601245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene trgB CDS 138942..139973 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719301.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 139970..142492 product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(142514..143611) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004202.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 tRNA 143786..143875 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 144225..145061 product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(145133..146137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 sequence04 source 1..124667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(872..948) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(1226..1864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(2591..3379) product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(3376..3780) product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene flbT CDS complement(3777..4178) product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene flaF CDS complement(4233..5462) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537972.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(5688..6506) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene kdsB CDS complement(6503..7336) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene kdsA CDS 7564..9498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(9503..10243) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene mtgA CDS complement(10292..10864) product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(10948..15486) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721575.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene gltB CDS complement(15499..16218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(16287..17720) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385170.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(17941..18735) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035441.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(18775..19761) product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338750.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 tRNA 19922..20006 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(20123..21100) product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(21055..21642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(21849..22946) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(22946..23959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(23961..25406) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene flgK CDS complement(25431..26768) product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(26864..27715) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 27840..28460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 note possible pseudo, frameshifted CDS 28457..29080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 note possible pseudo, frameshifted CDS 29084..31105 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 31118..31675 product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 31687..32268 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(32284..32829) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719756.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 32977..33435 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 33432..34196 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 34246..35412 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 35477..35866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(35895..36404) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 36503..37654 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 37651..38214 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338578.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene rsmD CDS 38211..38858 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(38928..39740) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene map CDS 39856..40584 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 40581..41291 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 41288..42223 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(42258..43163) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139967.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(43342..45792) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721924.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene gyrB CDS complement(45865..46311) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(46308..47363) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene recF CDS complement(47417..48535) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene dnaN CDS complement(48635..50002) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene dnaA CDS complement(50480..50746) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721915.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene rpsT CDS complement(50920..51696) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(51783..52628) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338891.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene mutM CDS 52704..53456 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene ubiE CDS 53458..54987 product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene ubiB CDS complement(54975..55646) product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338889.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(55656..59102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 59210..59497 product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338887.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 59490..59834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 60244..60729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 60726..61148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 61145..62248 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 62248..62901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 62898..64274 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 64271..65992 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 66009..66407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 66488..67735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(67772..69967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(69964..70833) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene motA CDS complement(70893..71477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(71474..71833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(71844..72329) product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 72452..74080 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140005.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene fliF CDS 74080..74676 product flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 74669..74947 product FliM/FliN family flagellar motor C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 74951..75676 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene fliP CDS complement(75680..78343) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(78343..79572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(79572..81239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(81245..82336) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(82393..83757) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(84055..85233) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(85230..85814) product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(85971..86477) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene msrA CDS complement(86474..86917) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene msrB CDS complement(86990..90448) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene smc CDS 90634..90990 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 90983..91699 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(91696..92370) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(92409..92867) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003711.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene rnhA CDS complement(92943..93887) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene ispH CDS 94099..95742 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 95839..96342 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(96333..97055) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene recO CDS complement(97158..97493) product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722422.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(97494..98423) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene era CDS complement(98420..99106) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene rnc CDS complement(99116..99898) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene lepB CDS complement(99954..100361) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561568.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene acpS CDS complement(100358..101104) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(101196..101861) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(101923..104040) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561565.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(104072..104428) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene rpoZ CDS complement(104499..105083) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene folK CDS 105224..105787 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722410.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(105896..107005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(107002..108573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 108869..110008 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338737.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene dapE CDS 110005..110418 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721534.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 110536..112800 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338736.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene rnr CDS complement(112797..114380) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214443067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(114463..116061) product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722428.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 116452..117099 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722430.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 117096..118841 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722432.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 118845..119276 product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 119291..120190 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rapZ CDS 120187..120588 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722435.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 120585..120857 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 120897..121766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(121826..122701) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 122868..123689 product DUF6473 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 misc_feature complement(123905..>124667) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336943.1:FAD-binding protein locus_tag LOCUS_07060 sequence05 source 1..119027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 1148..1342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 note possible pseudo, frameshifted CDS complement(1345..2250) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266817.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene rlmF CDS 2881..4389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 4386..5549 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 5638..6228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 6444..7454 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 7535..8401 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 8398..9183 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389798.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 9180..10265 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 10354..10989 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 11040..12335 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 12448..13872 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(13910..14707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(14704..15144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(15148..15528) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(15528..16205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(16230..16997) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(16994..17944) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339140.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(17934..18887) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(18890..19789) product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 19910..20203 product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(20230..21102) product ferri-bacillibactin esterase BesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene besA CDS complement(21102..23180) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167395505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 23320..24249 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820327.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(24307..25518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 25670..26599 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene fabD CDS complement(26645..26872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 27043..27780 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene fabG CDS 27954..28187 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719616.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 28256..28834 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337456.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene thpR CDS 28929..30158 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene fabF CDS 30158..31324 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene mltG CDS 31524..31850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 note possible pseudo, internal stop codon CDS 31843..33144 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 33314..34492 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 34494..34727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383946.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 34738..35295 product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 35325..36521 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 36700..37293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 37290..37595 product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 37624..38031 product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 38077..38490 product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 38490..38810 product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 38807..39037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 39024..39677 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 39688..40320 product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 40320..41210 product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337518.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 41207..41662 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564474.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 41662..45579 product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337519.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 45667..46485 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene cysE CDS complement(46528..46863) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(46990..48276) product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(48287..49654) product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(49667..50671) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene pdhA CDS complement(50804..51100) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(51228..51863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(51948..52838) product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(52975..54165) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 54328..54840 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383969.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 54827..55414 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337525.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(55555..56805) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene tyrS CDS 56867..57976 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 58142..58396 product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(58497..59513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(59527..60801) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene eno CDS complement(60889..61785) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(61891..62592) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(62631..64052) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(64165..65100) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 65257..66036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(66088..67092) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337841.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(67264..69120) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337826.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 69335..69757 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene ndk CDS complement(69780..70136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(70259..70393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(70527..71030) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 71304..71780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 71957..72925 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene speB CDS 72922..73347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 73466..74503 product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 74661..76274 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(76352..78670) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(78663..79136) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(79151..80449) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 80701..81666 product molybdenum cofactor insertion chaperone PaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene paoD CDS complement(81670..83670) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene malQ CDS complement(83778..83948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(83950..85569) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 85659..86357 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 86439..87197 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene hpaI CDS 87445..88863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 88886..90397 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067364.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 90406..91644 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067365.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(91683..92435) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 92544..93485 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 93635..94840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 94988..95527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 95527..97047 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 97156..97848 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 97974..98813 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 98897..99676 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(99719..101242) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529855.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(101253..101954) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 102215..103399 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(103488..104519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929892.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(104536..105054) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090025.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(105051..106157) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(106154..107449) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(107446..108885) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(108890..109291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(109348..110841) product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(111347..111832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 111937..112971 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 113020..113805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 note possible pseudo, internal stop codon CDS 113802..114887 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 114889..115821 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 tRNA complement(116027..116110) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(116211..117233) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533656.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(117230..117433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(117433..117585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(117582..118271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(118366..118557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(118557..118961) product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 sequence06 source 1..117407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(928..1302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(1244..2170) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(2164..2325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 note possible pseudo, frameshifted CDS complement(2608..6432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(6425..6922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 7537..8481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 8478..9338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 9454..11262 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 11401..13554 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650637.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 13578..15893 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285084.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 15957..16457 product acetone carboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001877024.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(16536..17345) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(17389..18297) product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(18357..19631) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(19672..20514) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(20514..21434) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(21424..22557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(22679..23245) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 23348..24508 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 24509..25996 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 26040..27125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 27126..27641 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 27725..29035 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 29039..29815 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218136709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(29805..31547) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 31895..33130 product substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083028.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 33152..34018 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene urtB CDS 34032..35060 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 35053..35790 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889582.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene urtD CDS 35774..36487 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene urtE CDS 36632..38146 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 38200..38655 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene ureE CDS 38670..39320 product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 39333..40007 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene ureB CDS 40004..41707 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene ureC CDS 41704..42309 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727404.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene ureG CDS 42321..43085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(43082..44533) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 44658..45776 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966651.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 45895..46314 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(46324..47349) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077984631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 47516..48523 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene iolG CDS 48639..49565 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 49627..50730 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 50732..51550 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 51681..53597 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene iolC CDS 53600..55432 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene iolD CDS 55456..56358 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene iolE CDS 56387..57193 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339183.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene iolB CDS 57218..57997 product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(57987..58640) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 58762..59730 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene hlyD CDS 59736..61496 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 61493..62638 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168097.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 62641..63741 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 63823..65835 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(65913..66263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(66274..67047) product DUF6478 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(67193..67843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 68035..68853 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528576.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 68841..69989 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene nagA CDS complement(69965..70837) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene serB CDS 71007..72152 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 72264..73859 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721933.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene serA CDS 73941..74672 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 74768..75943 product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 75943..76191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(76193..78235) product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene pbpC CDS complement(78232..83679) product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338903.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 83818..86049 product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338904.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(86050..88113) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338906.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene recQ CDS complement(88115..88408) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 88545..89072 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 89167..90522 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338909.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 90519..91415 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene mepA CDS 91436..92302 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 92396..93016 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 93346..93594 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 93654..94460 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 94474..96384 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338740.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene dxs CDS complement(96465..97082) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(97075..97530) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383293.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(97527..98357) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721045.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene fghA CDS complement(98367..99281) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(99386..100363) product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 100520..100672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(100657..101574) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 101668..102276 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338913.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene pncA CDS 102291..103598 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene pncB CDS complement(103595..105091) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(105170..105613) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(105618..106040) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene arfB CDS complement(106130..107389) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene mtaB CDS complement(107386..108225) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene dapF tRNA 108334..108409 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 108585..109142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 109821..110126 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389943.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(110475..111626) product SAVED domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082906.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(111640..112149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331496.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(112146..113402) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 114428..114889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(115088..115762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(115737..116672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 sequence07 source 1..101849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..1066) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 1300..2727 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729156.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 2820..3959 product tyramine oxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 3971..4390 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 4469..5761 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(5829..9083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(9201..9818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 10002..11051 product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(11056..11520) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384952.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 11637..15056 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643744.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene putA CDS complement(15069..15839) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 15995..17332 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 17458..18597 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 18673..19965 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338480.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 19958..20635 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 20639..20962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720551.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(21173..21379) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(21601..23553) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383594.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene thrS CDS complement(23673..24503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(24507..24926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(24930..25310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(25310..26005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 26131..26874 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140274.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 26983..27693 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265848.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 27804..28064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(28083..28643) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene ilvN CDS complement(28724..30469) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 tRNA 30861..30955 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 31205..31774 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 31774..33657 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337993.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 note possible pseudo, internal stop codon CDS 33842..35440 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 35451..35837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 35834..36220 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 36233..37372 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(37444..38718) product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565567.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene phaZ CDS 38865..40616 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene phaC CDS 40766..41221 product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 41337..41927 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene phaR CDS complement(42120..43478) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 43644..44582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(44829..46472) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(46646..47002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 note possible pseudo, frameshifted CDS 47202..48500 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 48502..48738 product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(48792..51245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 51387..52046 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(51949..52926) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338180.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(52993..53553) product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 53666..54478 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(54775..55659) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721207.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene purU CDS 56006..56263 product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389993.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 56272..56769 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(56823..57146) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720517.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 57299..57841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(57867..58499) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385417.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(58544..60046) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565602.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(60196..60390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(60390..61310) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338173.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(61310..62440) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene hflK CDS complement(62495..63850) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene gor CDS complement(64031..64816) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338176.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene rpiA CDS 64989..66368 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(66527..67219) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337365.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 67335..67622 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene gatC CDS 67619..69097 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337367.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene gatA CDS 69110..69793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 69798..70475 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 71210..71920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 72049..72216 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011750518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene rpmG CDS complement(72273..72917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 73081..74349 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 74375..75811 product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 75811..76821 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 76835..77902 product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336820.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(77906..78841) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(78841..79980) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene rodA CDS complement(79990..81936) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene mrdA CDS complement(81959..82498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719490.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(82491..83387) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene mreC CDS complement(83431..84468) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(84791..86362) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 86421..86735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 86732..87127 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(87161..88633) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 88816..90474 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(90554..91924) product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 92084..92632 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(92733..93680) product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(93721..93918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(93943..94350) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338497.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 94436..95764 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene gltX CDS 96205..97314 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene gcvT CDS 97327..97689 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene gcvH CDS 97694..100519 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene gcvP CDS complement(100665..100847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 100917..101360 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216643.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene trxC tRNA 101482..101557 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 sequence08 source 1..101136 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..2399) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(2741..4165) product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(4183..4992) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(4982..5923) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210183137.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(5920..6903) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528023.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(6971..8125) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(8248..9150) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397070.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(9220..10119) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 10214..10606 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014843191.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 10599..11324 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945974.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(11385..12314) product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017263128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(12391..13152) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970211.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 13454..15136 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 15192..16205 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 16205..17176 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 17197..19035 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385048.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 19090..20547 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 20868..21968 product transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339160.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 21968..22576 product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 22554..23441 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723883.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 23441..24361 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 24433..26073 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 26080..27039 product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339158.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 27069..28841 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339157.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(29346..29681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(29756..30853) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene argE CDS complement(30847..32499) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(32555..33574) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(33611..34411) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(34408..35271) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(35268..36341) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(36403..38466) product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(38625..39578) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(39645..41126) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(41126..41803) product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(41874..42287) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(42304..43572) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530448.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(43633..45144) product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene hpaB CDS complement(45241..46833) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 47183..48169 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 48279..49472 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 49546..50430 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(50477..52081) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089722.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 52430..53038 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 53113..55080 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 55085..55420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 55417..56232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 56260..58392 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 58450..60498 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 60524..62089 product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 62086..62529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 62526..63659 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 63694..64467 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 64591..65463 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338971.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(65516..67459) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399723.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(67463..68164) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810743.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(68151..68936) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(68933..69889) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(69894..70766) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(70894..72030) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(72065..73714) product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene paaN CDS 73834..74628 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene paaG CDS 74625..75080 product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene paaI CDS 75112..76422 product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene paaF CDS 76586..77185 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(77169..77816) product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene paaY CDS complement(77816..79876) product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399720.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene paaZ CDS complement(79939..80691) product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(80700..81776) product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969778.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene paaK CDS complement(81805..82326) product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153451216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene paaJ CDS complement(82331..83098) product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene paaC CDS complement(83098..83382) product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069460051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene paaB CDS complement(83442..84440) product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene paaA CDS complement(84458..85663) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522007.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene pcaF CDS complement(85834..86676) product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene paaX CDS complement(86747..87406) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 87622..88911 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 88908..90233 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084879.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(90604..91368) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 91628..92422 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 92497..94071 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 94135..95115 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722098.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 95115..96023 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 96025..97881 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336752.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 97874..99160 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336753.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 99157..100107 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336754.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 100104..101045 product choline/ethanolamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 sequence09 source 1..92036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 375..1103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1188..1673 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1670..2092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 2244..3611 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970302.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene hmgA CDS 3878..5098 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene fahA CDS 5101..5790 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene maiA CDS 5787..6791 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 6788..7303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 7304..8614 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(8665..10566) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene ftsH CDS 10632..11120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 11120..11689 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 11873..13327 product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267884.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene arcD CDS 13342..14559 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene arcA CDS 14575..15576 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 15580..16491 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene arcC CDS 16681..17700 product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene acoA CDS 17711..18739 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 18806..19039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 19036..19725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 19722..20441 product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110110.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 20644..21240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 21253..22833 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 22953..24728 product sigma-54-dependent transcriptional regulator EatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene eatR CDS complement(24737..25759) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene adhP CDS complement(25752..26552) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(26549..27406) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(27403..28440) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(28498..29565) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 29462..29686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(29596..30549) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene speB CDS complement(30617..31585) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(31623..32351) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(32348..33382) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(33379..34149) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(34149..35003) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531382.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(35005..36054) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 36163..36792 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(36858..38195) product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(38275..40401) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(40490..42238) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729441.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 42558..43502 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533169.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(43499..44590) product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene pqqE CDS complement(44587..44847) product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene pqqD CDS complement(44862..45497) product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975104.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene pqqC CDS complement(45620..46513) product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene pqqB CDS complement(46519..46743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 46784..47035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 47035..47439 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 47586..47735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 47945..49138 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene repA CDS 49135..50097 product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331264.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene repB CDS 50272..51453 product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003418.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene repC CDS 51584..51835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(51839..52519) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969985.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 52642..53991 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 53991..55313 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 55350..56435 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene potF CDS 56496..57635 product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388772.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene potA CDS 57632..58540 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 58540..59343 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 59636..60193 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528153.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene msuE CDS 60208..61662 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 61659..62786 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055981.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene ssuD CDS 62797..63660 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 63673..64314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 64311..65726 product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528161.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 65821..67041 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115478.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(67208..68602) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(68958..70226) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528154.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 70338..70727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 70817..72436 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 72433..73431 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 73467..74846 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877503.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 74941..76281 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 76307..77647 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(78284..78721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 78822..79430 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 79503..80165 product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 80240..81121 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 81212..82033 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930607.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 82068..83108 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 83125..83670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 83667..84950 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 84970..85638 product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 85640..86899 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 86907..87647 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene pxpB CDS 87644..88669 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 88659..89411 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(89450..89644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(89632..91224) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 misc_feature complement(91246..>92036) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227077.1:MBL fold metallo-hydrolase locus_tag LOCUS_12060 sequence10 source 1..82947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 385..1347 product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1344..1700 product DUF2958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368622.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1864..3978 product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 4075..4380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368624.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 4796..4960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368625.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 5160..5708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 5774..6190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 6183..6827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(6839..8383) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 8618..12934 product strawberry notch family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368629.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 12934..13977 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 14309..15244 product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 15406..15822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 16530..16931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(16999..19710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 20360..20614 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387924.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 20680..20964 product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084140443.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 21078..21377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 21343..21843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 21977..22261 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 22278..23396 product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 23393..23911 product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 23908..24519 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082879.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 24503..24841 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 24845..25588 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 25836..27602 product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626034.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 27694..27831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 27841..28302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 note possible pseudo, internal stop codon CDS 28408..30396 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645922.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 30406..30804 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 30911..36064 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 36069..38855 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 38859..43286 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 43273..45234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 45231..45983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 46146..47144 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene trbB CDS 47141..47473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 47473..47745 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 47760..50240 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene trbE CDS 50237..51028 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene trbJ CDS 51049..51327 product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene trbK-alt CDS 51331..52683 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene trbL CDS 52680..53369 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene trbF CDS 53366..54349 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene trbG CDS 54342..55487 product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 55489..55713 product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(55744..56517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(57754..58167) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene nsrR CDS 58272..58751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 58884..59390 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 59410..60408 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967329.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 60399..61325 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967330.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(61424..61945) product DUF2478 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(61953..63233) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(63230..63847) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene can CDS complement(63852..64409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(64406..65221) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(65227..65937) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene narI CDS complement(65949..66668) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene narJ CDS complement(66668..68191) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene narH CDS complement(68188..71925) product nitrate reductase Z subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040458.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene narZ CDS complement(71989..74712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 74958..75668 product transcriptional activator FtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919286.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene ftrB CDS complement(75870..77069) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(78245..78937) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(78939..80072) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(80069..81214) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(81207..81818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(81928..82311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 sequence11 source 1..77718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 342..1346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1357..1650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1724..2410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 2407..2763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(2767..3147) product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527219.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(3147..3443) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968800.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(4196..4657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(4729..5127) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(5173..5361) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 5567..6388 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(6603..7370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(7467..9512) product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(9499..10788) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(10985..11611) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 12201..12722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(12719..13573) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(13635..14297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 note possible pseudo, internal stop codon, frameshifted CDS 14471..14809 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 14866..16275 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene glnA CDS 16384..16908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 17042..17617 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(17995..18987) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(19176..20246) product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene hpxD CDS complement(20256..21212) product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(21216..22295) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(22313..23110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(23110..23922) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(24041..24985) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(25162..25848) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(25845..28538) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(28547..29125) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338832.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene kdpC CDS complement(29136..31160) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338831.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene kdpB CDS complement(31214..32899) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338830.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene kdpA tRNA complement(33447..33536) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 33727..34566 product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338950.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 34832..35425 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337684.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 35619..36065 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 36068..36679 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337686.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(36760..37932) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(37961..38578) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(38571..39509) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337927.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene ppk2 CDS complement(39597..40517) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337925.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene metA CDS complement(40573..41433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(41553..42662) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920660.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 43183..44148 product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 44218..45666 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene guaB CDS 45934..47106 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 47201..49510 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003693.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(49532..50125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566057.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 50313..51380 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene recA CDS 51496..54153 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene alaS CDS 54153..54443 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 54528..55322 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338233.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(55326..56270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 56160..56369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 56506..57963 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383869.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene cysS CDS 58010..59632 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003601.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene cimA CDS 59629..60402 product squalene/phytoene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 60519..63566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 63616..64629 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918324.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 64775..65158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(65195..66199) product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110064.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene oppF CDS complement(66196..67167) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096273.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(67169..68095) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene oppC CDS complement(68100..69023) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene oppB CDS complement(69076..70686) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 70933..71391 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 tRNA 71444..71520 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 71872..73848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(74126..75145) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069333558.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(75145..75381) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336930.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(75381..75536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(75533..76249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(76246..76962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(77057..77248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(77248..77652) product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 sequence12 source 1..323395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(422..1024) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene msrQ CDS complement(1024..1944) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene msrP CDS complement(2032..2478) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086249.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 2584..3057 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene smpB CDS 3158..4015 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene sseA CDS 4015..5196 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 5323..5781 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 5771..6835 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 6839..8407 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(8501..9832) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(9857..10195) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 10458..12686 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003713.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(12766..13410) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(13382..14128) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 14359..16095 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 16092..17528 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338571.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(17525..18694) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 18867..19211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721068.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(19217..19750) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721677.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(19754..20929) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338556.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 21103..21645 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene def CDS 21645..22145 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338558.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene def CDS 22150..23046 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene fmt CDS complement(23134..23928) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(23925..24551) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(24551..25132) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(25260..26654) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(26651..27919) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(27919..28782) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(28779..29627) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(29624..30607) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 30845..31234 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384818.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 31273..31899 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390920.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 31937..32590 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(32761..33903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(33915..34154) product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(34221..34925) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(34922..36829) product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 37025..38998 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 38995..39813 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 39849..40835 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 40998..41177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 41227..42303 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 42359..43645 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 43696..44517 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 44600..45820 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(46065..46190) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene ykgO tRNA complement(46255..46329) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 46491..47369 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(47373..48653) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(48735..51287) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338937.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene clpB CDS 51631..52338 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382860.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene pyrF CDS complement(52397..52555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(52633..52902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(52902..53783) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722023.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(53828..53983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(53983..54219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 54140..54358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 54407..54754 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 54744..55235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(55242..55568) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene hspQ CDS 55769..56347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722170.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(56348..56947) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(57031..60291) product DNA translocase FtsK 4TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(60304..61497) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336784.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(61601..62917) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140029.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 63028..64254 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336782.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(64285..64485) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(64482..65126) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562559.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(65147..66046) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene trxA CDS complement(66117..66905) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(67069..68505) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336795.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 68736..69389 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(69450..70238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(70285..71016) product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385338.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(71067..73208) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene pnp CDS complement(73396..74154) product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703222.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(74281..74550) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene rpsO CDS complement(74704..75006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(75153..75674) product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(75671..76585) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338723.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene truB CDS complement(76634..77389) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338722.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(77364..77804) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921462.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene rbfA CDS 77909..78718 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338720.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene dapB CDS complement(78812..78991) product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 79076..80338 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139983.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 80429..82189 product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338717.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 82208..83794 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene purH CDS 83855..84337 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721489.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene lspA CDS 84407..84952 product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 85042..86439 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028287100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 86436..87761 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 87826..89727 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene mutL CDS 89724..90869 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene rmuC CDS 90930..91277 product DUF3775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173751.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(91418..92104) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 92262..93338 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene ribA CDS 93335..93910 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(93914..94579) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338538.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(94672..95589) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338535.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 95919..96467 product DUF3576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721028.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 96575..99142 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene leuS CDS 99129..99620 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338532.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene lptE CDS 99617..100639 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 100639..101811 product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338530.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(101808..102860) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(102872..103471) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 103621..104856 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563407.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(104844..105686) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(105683..106006) product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398761.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 106052..107854 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385557.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 107851..109326 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 109459..109746 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 109848..110714 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(110711..111274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 111347..112033 product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(112043..113308) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(113390..113758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(113810..114637) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene dapD CDS 114729..115553 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 115558..117123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(117178..118359) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721983.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene rlmN CDS complement(118474..118998) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721985.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 119169..120158 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(120162..120920) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385584.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 121055..121813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 121810..122694 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 122766..123674 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721171.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene accD CDS 123750..125036 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 125132..126163 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385339.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(126160..127236) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene zapE CDS 127364..127618 product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 127637..128875 product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336757.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 128875..129864 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336758.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene lpxK CDS complement(130024..130689) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921714.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(130689..131240) product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336761.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 131336..132391 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336762.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene mutY CDS 132444..133586 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(133701..134336) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 134512..136434 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene dnaK CDS 136495..137640 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene dnaJ CDS 137715..138482 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene radC CDS complement(138479..139438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(139636..142344) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338761.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene secA CDS 142530..143399 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 143424..144836 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338759.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene argJ CDS 144833..145279 product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 145407..145544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(145641..148175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(148172..148801) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(148803..150407) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721609.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene nusA CDS complement(150411..151007) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene rimP CDS complement(151141..152115) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971919.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 151999..152274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(152286..153254) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene pip CDS 153307..154065 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(154163..154699) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene mog CDS complement(154696..155925) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 156074..157321 product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene ilvA CDS complement(157273..157653) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 157768..159078 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(159075..159521) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 159622..160635 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721690.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 160628..161224 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 161221..162366 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 162421..164256 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 164309..165532 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 165595..166101 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(166177..166668) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 166863..167471 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563235.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(167590..168645) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161601244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene hemH CDS 168729..169484 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene otsB CDS 169486..170832 product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192381.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene otsA CDS complement(170829..171662) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 171661..172434 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 172470..172730 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721669.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene grxC CDS 172727..173569 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 173566..174006 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(174180..175283) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(175395..176030) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385524.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(176113..176634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 176800..177090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722131.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 177062..177766 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 177833..178927 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 178976..180211 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 180297..181295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 181369..182613 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087074.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(182818..183531) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(183586..183855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(183968..184174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 184691..184873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 184934..185755 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528465.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 185983..186189 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 186246..186464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 186531..186692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(186786..187151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 tRNA complement(187250..187326) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 187603..188634 product LacI family DNA-binding transcriptional regulator CceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336932.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene cceR CDS complement(188635..189456) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 189581..190378 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene cysQ CDS 190614..191507 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene galU CDS 191514..192500 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338390.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene galE CDS 192519..193550 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969657.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 193767..194747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 194758..196455 product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538035.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 196457..197851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538034.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(197853..198317) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721599.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(198353..198928) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene raiA CDS complement(199160..199936) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene lptB CDS complement(199933..200421) product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(200432..201031) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338753.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene lptC CDS complement(201031..201987) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139988.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(201968..202582) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 202827..205757 product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385226.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 205958..207133 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(207212..208318) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139959.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene leuB CDS complement(208392..209279) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(209375..210178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(210470..211075) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721055.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene leuD CDS complement(211077..211598) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(211649..213055) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene leuC CDS 213407..213871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 213879..214346 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene rlmH CDS complement(214350..215027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(215017..216105) product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209066719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(216187..217509) product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 217591..217977 product FlgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 217974..218372 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene flgC CDS 218394..218681 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene fliE CDS 218683..218949 product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 218953..219669 product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 219679..220464 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene flgG CDS 220464..220889 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene flgA CDS 220900..221625 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene flgH CDS 221635..222129 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(222132..222485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(222485..223564) product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338877.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(223561..224325) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338876.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(224322..226406) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene flhA CDS complement(226409..227170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(227247..228044) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(228031..229380) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338589.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(229442..230929) product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 231042..231653 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721140.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(231702..232043) product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385499.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(232247..233638) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene ahcY CDS complement(233716..234216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 234143..234307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 234335..234925 product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(234915..235220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 235107..235985 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(235989..236303) product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(236376..236930) product global response regulator transcription factor PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene prrA CDS complement(237012..237650) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722229.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 237767..239152 product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722232.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 239247..240809 product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336803.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 240850..241347 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene tsaE CDS 241340..242320 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336805.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 242317..243003 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 242996..245926 product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336807.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene addB tRNA 243280..243353 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 245923..249309 product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene addA CDS 249364..249684 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722246.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene trxA CDS complement(249733..250638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336809.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 250730..251287 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722250.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene hslV CDS 251284..252588 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene hslU CDS 252646..253737 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531324.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(253734..254333) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338814.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(254330..255202) product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(255206..255868) product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 255963..256457 product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 256510..257013 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721743.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene secB CDS 257120..257650 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene idi CDS 257765..259561 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 259561..263166 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338773.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(263160..264050) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338856.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 264143..265351 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338855.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(265336..266178) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 266325..267164 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(267227..267718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(267885..268682) product response regulator PhyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene phyR CDS 268781..268927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 268924..269499 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721805.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 269496..271271 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 271344..272558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(272625..272828) product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 273002..273175 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(273227..274060) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836231.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(274057..275562) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836232.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(275559..276275) product H+-transporting two-sector ATPase B/B' subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(276277..276522) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187193.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(276519..277220) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724766.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(277217..277489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(277486..277764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(277761..278207) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836235.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(278204..279610) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836236.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene atpD tRNA complement(279886..279961) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(280009..281463) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(281474..282667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 note possible pseudo, frameshifted CDS complement(282746..283483) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 283556..284650 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene tsaD CDS 284647..285603 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336800.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 285605..285874 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562580.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 285874..286293 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 286554..287237 product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 287358..288410 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337601.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 288475..289935 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337600.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene pstC CDS 289932..291278 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene pstA CDS 291291..292088 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene pstB CDS 292100..292807 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719749.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene phoU CDS 292811..293503 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719748.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene phoB CDS complement(293488..294375) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(294445..296712) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 296818..299463 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene mutS CDS complement(299567..300115) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(300120..301193) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721709.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene hrcA CDS 301306..302019 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921545.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene rph CDS 302016..303005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 303002..304159 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene hemW CDS complement(304163..305062) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721719.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(305066..305818) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(305874..306494) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338804.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene rsmG CDS complement(306491..308353) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene mnmG CDS complement(308366..309649) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene mnmE CDS complement(309663..310940) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene rho CDS complement(311078..311542) product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338807.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene hemJ CDS 311939..312538 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 312535..313374 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338809.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 313371..313967 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene coaE CDS 313960..314649 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene dnaQ CDS 314763..315815 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969039.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene nadA CDS 315812..317362 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 317359..318204 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene nadC CDS complement(318208..318693) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(318742..320163) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565257.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(320182..321318) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(321318..322841) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338604.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene gpmI sequence13 source 1..70742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 note possible pseudo, frameshifted CDS complement(811..1122) product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 1485..3668 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene uvrB CDS complement(3672..4301) product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene parA CDS complement(4409..4726) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719241.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 5000..6103 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328990.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 6177..7049 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310498.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 7046..7828 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310499.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 7825..8871 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338170.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(9124..9330) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 9660..10208 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 10208..11533 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 11591..12631 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 12992..15160 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 15157..15852 product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139990.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(16023..16211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(16464..17249) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(17242..18030) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339418.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(18027..18530) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012641245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 18615..19589 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339420.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 19673..20176 product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(20234..21466) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724529.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene trpB CDS 21695..22045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(22068..22739) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(22741..23097) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140397.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(23099..23386) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383532.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene ihfB CDS complement(23683..24702) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(24913..26592) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene rpsA CDS complement(26750..27244) product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(27307..27894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(27931..28515) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339438.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(28637..29983) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339439.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene aroA CDS complement(30092..30820) product tRNA (guanine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339440.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 30956..31648 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719150.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene lexA CDS complement(31642..33765) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 33887..35287 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene gltX CDS 35363..36658 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene gltA CDS 36733..37152 product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 37228..37887 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337503.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 38195..38983 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene surE CDS 38980..39648 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 39698..40984 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337559.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(41151..42239) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020477356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(42301..43080) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 43246..44250 product Hint domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(44306..45286) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337878.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(45359..45520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 45745..46719 product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene cobS CDS 46767..47144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(47222..47806) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384515.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 48006..49880 product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene cobT CDS 49880..51679 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(51746..52921) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(52918..54306) product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 54516..55922 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 55919..56308 product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(56387..57568) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724558.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene metK CDS complement(57621..59174) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339441.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene lnt CDS complement(59185..60090) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339442.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(60127..60636) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339443.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene ybeY CDS complement(60620..61636) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339444.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(61805..62128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(62140..62709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(62904..64223) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339445.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene miaB CDS 64365..65234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 65225..65959 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene pxpB CDS 65956..66900 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 67095..68792 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651734.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene cydD CDS 68789..70468 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 sequence14 source 1..51421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..1063 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723102.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1211..3247) product N-methyl-L-proline N-demethylase HpbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140423.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene hpbA CDS 3727..4587 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532864.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 4584..5360 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532863.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 5415..6455 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 6524..7141 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 7131..8195 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(8226..8477) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385653.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 8674..9591 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385654.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 9710..11275 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385655.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 11275..12234 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 12236..13066 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538141.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 13063..14658 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 14731..16740 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(17018..18022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 18275..19336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 19336..20253 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 20257..21099 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855566.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 21099..21827 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412971.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 21843..22604 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268748.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 22691..23911 product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 23979..25046 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 25069..25947 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 26017..26346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 26343..27377 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268747.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 27374..28570 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 28582..29565 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(29570..30010) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(30033..30734) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(30727..31497) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086608.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(31499..33370) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810078.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(33434..34636) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(34742..35326) product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(35326..35910) product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(35903..36760) product thiamine biosynthesis protein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528452.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(36757..38316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966263.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 38760..40823 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 40820..42565 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(42626..46090) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086601.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(46087..46560) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086602.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 46946..48124 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 48204..49232 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 49379..50647 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 50644..51195 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 sequence15 source 1..5801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(720..1292) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1308..1508) product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(1582..2412) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(2488..2946) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 3123..5381 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336946.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene parC sequence16 source 1..43042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 5..1180 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene tuf tRNA 1323..1398 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 1504..1686 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722466.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene secE CDS 1870..2415 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene nusG CDS 2503..2955 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385335.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene rplK CDS 2959..3657 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene rplA CDS 3879..4394 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722476.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene rplJ CDS 4458..4832 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722477.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene rplL CDS 5148..9215 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722478.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene rpoB CDS 9265..13500 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene rpoC CDS 13658..14371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 14483..15205 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972150.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 15202..15510 product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 15485..16942 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 16929..17651 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972667.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 17923..18294 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722481.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene rpsL CDS 18307..18777 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene rpsG CDS 18792..20906 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336951.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene fusA CDS 20973..22148 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene tuf CDS 22347..22655 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722490.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene rpsJ CDS 22667..23395 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563652.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene rplC CDS 23392..24012 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722493.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene rplD CDS 24009..24305 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 25190..26026 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene rplB CDS 26030..26308 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722496.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene rpsS CDS 26314..26694 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538011.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene rplV CDS 26694..27404 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722498.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene rpsC CDS 27417..27830 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722499.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene rplP tRNA complement(28032..28105) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 28348..28548 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene rpmC CDS 28560..28793 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722502.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene rpsQ CDS 28871..29239 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene rplN CDS 29239..29544 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722510.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene rplX CDS 29544..30104 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene rplE CDS 30121..30426 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene rpsN CDS 30440..30838 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene rpsH CDS 30849..31382 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene rplF CDS 31385..31753 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene rplR CDS 31879..32439 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722522.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene rpsE CDS 32452..32643 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722524.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene rpmD CDS 32728..33060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 33187..33954 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(33939..34526) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 34688..35605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(35616..36596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 37037..37951 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 38007..38477 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 38474..39154 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 39197..40369 product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 40449..40970 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723432.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 41004..41873 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338971.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 41925..42710 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 sequence17 source 1..48264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 555..1040 product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1140..2306) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2303..3082) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(3079..4362) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338710.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 4590..5141 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384382.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 5138..5770 product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384381.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(5659..5976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 5869..6507 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384380.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(6519..6923) product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338195.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(6951..7679) product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(7933..8613) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(8589..9539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(9536..11446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(11550..12527) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(12646..14316) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341224.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(14332..15750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384347.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(15754..16986) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970548.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(16996..17991) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(18078..19349) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 19589..20497 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 20552..20884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 20988..22478 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028720319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(22529..23332) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(23408..23830) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 23961..24851 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339059.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(24848..26131) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(26202..27002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(26999..27382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(27387..27752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(27756..28430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(28427..28837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(28831..30933) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384209.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 31125..32168 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 32165..33019 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531242.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 33021..34079 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844765.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 34081..34863 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(34929..36611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(36741..37253) product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(37338..37766) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(37766..38197) product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(38477..40147) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene ctaD CDS complement(40358..40762) product cytochrome c2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene cycA CDS complement(40846..41535) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene lipB tRNA 41873..41959 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 42096..42171 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(42320..43900) product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440221.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(44199..46370) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene katG CDS 46503..47405 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974036.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 47518..48165 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 sequence18 source 1..36603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..929 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 929..1657 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 1654..2826 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973818.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(2835..3203) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813393.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(3239..3919) product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338145.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 4062..4742 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391034.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 4824..5258 product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 5331..6536 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327931.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(6533..6814) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327930.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(6807..7310) product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967664.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(7326..8564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327928.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(8572..9480) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(9467..9994) product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(9994..10812) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(10812..11642) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967624.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(11639..12862) product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 12743..13021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(12952..14874) product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene nosZ CDS complement(14876..17101) product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 17226..17915 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391034.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 17999..18433 product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(18467..19687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(19684..21135) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338245.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 21299..21730 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720630.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 21727..22722 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 22724..23617 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720628.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(23598..24188) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383149.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(24198..24659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(24644..25315) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(25281..25430) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389030.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene nrdD CDS complement(25440..27452) product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(27532..27756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 27887..28339 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707559.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 28350..29723 product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338149.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 29728..30528 product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 30530..32419 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338147.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 32419..32934 product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 32938..33162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(33159..33869) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390386.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 34030..35151 product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967660.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene nirK CDS 35169..35978 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 sequence19 source 1..21524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 279..1127 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338397.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(1139..2449) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337061.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 2566..4212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(4222..4725) product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(4729..5595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722834.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(5622..6185) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337063.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(6185..7186) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337064.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(7197..8165) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(8175..9647) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(9668..10930) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337066.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(11163..11831) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722846.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(11835..13268) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(13450..14319) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722851.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene cpaB CDS complement(14395..14592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(14800..14997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(15229..15426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 15800..16642 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337069.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 16645..18078 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(18215..18946) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(18946..20241) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(20252..21241) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 sequence20 source 1..21231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..925 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336901.1:pyocin knob domain-containing protein locus_tag LOCUS_19620 CDS 941..1255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976004.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 1330..2010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2007..2369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 repeat_region 2437..6246 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggtctatccccgcgggtgcgggggagcc CDS complement(6310..6603) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene cas2e CDS complement(6603..7481) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene cas1e CDS complement(7481..8224) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(8221..8883) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene cas5e CDS complement(8880..10016) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene cas7e CDS complement(10009..10503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(10490..12007) product CRISPR-associated protein Cse1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(11997..14534) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(14677..14901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(15600..16661) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(16712..18094) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(18094..18246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(18367..18948) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640922.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(19057..19536) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(19801..20526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 sequence21 source 1..19966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 896..2197 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 2226..3224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 3316..4317 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 4317..5810 product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088040.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 5814..6656 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 6734..7483 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088039.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(7480..8019) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730127.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(8111..8887) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(8895..9917) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 10081..11247 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(11266..11772) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 11987..12757 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 12767..13549 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064685.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 13637..14797 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 14824..16488 product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene fadK CDS 16537..18597 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 18594..19796 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402686.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene pcaF sequence22 source 1..16235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331650.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(517..843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(926..3016) product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081097245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(3013..4506) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384022.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(4503..4706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(4703..6784) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214565953.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(6784..7392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975804.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(7560..8339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339615.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(8385..9188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(9185..9769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(10031..10669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(10683..11282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(11460..11900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(12060..12263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 12262..12987 product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537628.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 13065..13505 product glycine zipper family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331368.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 13814..13999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 14513..15742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 sequence23 source 1..311736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..710) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 886..2097 product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089442.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene phaZ CDS complement(2362..3474) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809141.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene nrfD CDS complement(3669..4286) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(4283..6064) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(6164..8101) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071115.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(8103..9278) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384341.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(9399..10385) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(10616..13750) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(13752..14894) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339206.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(14930..16312) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972396.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 16583..17218 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(17262..19349) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(19434..19841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(19946..21223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(21237..21722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(21845..22564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972674.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(22615..23367) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 23493..24110 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 24114..24809 product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 25000..25644 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(25646..26776) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337793.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene tgt CDS 26902..27579 product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(27580..28032) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191993882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(28034..29527) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720054.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 29651..30781 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene lptF CDS 30778..31887 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720056.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene lptG CDS 31887..34130 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337831.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene lptD CDS 34211..35443 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003627.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 35440..36447 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337833.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene pdxA CDS 36567..37409 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384457.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene rsmA CDS complement(37481..38152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 note possible pseudo, internal stop codon CDS complement(38410..39267) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337836.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene prmC CDS complement(39264..40319) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene prfA CDS 40425..40790 product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722920.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 40920..41993 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337792.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 42062..42421 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337105.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 42520..43266 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337104.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene tpiA CDS complement(43404..43865) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722912.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 44008..44313 product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337101.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 44306..45967 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337100.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 45942..46715 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563863.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 46712..47083 product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337098.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 47225..48037 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(48160..48885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 49200..49631 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003529.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene infC CDS 49796..50389 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 50396..50605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(50624..51997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(52001..52861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 53015..55366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 55506..56453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 56453..57505 product glycosyltransferase family 92 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061931.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 57640..58611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(58627..58971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(59172..59393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(59526..59831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 59975..61015 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337087.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene pyrC CDS 61101..61781 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 62004..63500 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337085.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(63582..63992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(64000..64230) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(64244..65302) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331459.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(65299..65586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 65760..66590 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331465.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 66603..67625 product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 67625..68863 product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene arsJ CDS 68953..70002 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337504.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene alr CDS 69999..70778 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 70775..71521 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719612.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 71521..71982 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719611.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 72165..73532 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719610.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene radA CDS 73558..74163 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719609.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 74286..75767 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719608.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene purF CDS complement(75974..76372) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720112.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(76365..77045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 77247..79265 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537909.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene tkt CDS 79364..80194 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 80198..81088 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337323.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(81129..82142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 82407..85160 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene acnA CDS 85315..85908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 85975..86286 product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003140884.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(86294..88894) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene mprF CDS complement(89006..89791) product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(89876..90283) product DUF6314 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855167.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 90361..91668 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene purB CDS 91766..92839 product FliG C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 93096..94100 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene gap CDS 94131..94274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 94371..95372 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene gap CDS 95565..95732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 95867..96499 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(96502..96999) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene coaD CDS complement(97091..97525) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720120.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(97602..98501) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337879.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 98607..100106 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565364.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 100308..101453 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338029.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 101453..102502 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338028.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 102533..103405 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene mmsB CDS 103493..103960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 104057..104713 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 104830..105033 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 105147..105527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 105529..105891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(105895..108768) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565362.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene uvrA CDS 109034..109408 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338309.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(109466..110623) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(110727..112124) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670037.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene lpdA CDS complement(112200..112775) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(112990..114252) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(114306..115373) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337883.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene queA CDS complement(115370..118738) product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337884.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 118820..119296 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 119498..120817 product DUF5930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337885.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 120807..121304 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(121385..122128) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337887.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 122484..123650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(123653..124216) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390781.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(124221..125345) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene prfB CDS complement(125442..127997) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337888.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 128214..129809 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 129806..130270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(130273..130698) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(130896..132092) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337638.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 132177..132506 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566170.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene erpA CDS 132503..132805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 132867..133646 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337637.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene xth CDS 133714..134283 product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 134533..136215 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(136261..137097) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719693.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(137094..137936) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene tatC CDS complement(137933..138403) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719691.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene tatB CDS complement(138429..138659) product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 138784..139455 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337827.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 139507..140082 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 140172..140651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(140648..141616) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 142201..142572 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719755.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(142645..142872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(143029..146268) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(146265..147239) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338241.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 147449..148738 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563716.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene serS CDS 148822..149523 product seryl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140459.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(149707..151263) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719849.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene der CDS complement(151319..152644) product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(152699..153355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337666.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(153467..155311) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337665.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(155443..156609) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 156765..157322 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337663.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(157332..158225) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene rarD CDS complement(158367..158798) product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(158953..159552) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719843.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(159767..160219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(160299..160850) product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337661.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(160843..163797) product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140189.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(163797..164120) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719839.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(164205..164498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(164498..165727) product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719837.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 165956..167521 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene ccmI CDS 167518..167997 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719835.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene ruvX CDS 167990..168226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(168328..169506) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(169514..170755) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969318.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(170768..171280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 171197..171412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 171540..172886 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337537.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene glmU CDS 172887..174701 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337536.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene glmS CDS 174701..175537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(175541..176314) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338100.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(176499..178655) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140090.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 178886..181432 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337133.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene pepN CDS complement(181559..181768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(181773..182405) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene scpB CDS complement(182402..183202) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(183195..184199) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337863.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(184199..185236) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055663807.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(185291..187036) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene argS CDS 187265..188812 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643995.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(189766..191442) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(191439..192215) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564427.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(192226..192918) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140172.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(192977..194416) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719681.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene nuoN CDS complement(194430..195965) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719680.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(195965..198073) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337553.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene nuoL CDS complement(198080..198385) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719678.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene nuoK CDS complement(198449..199051) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(199048..199458) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719676.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(199455..199946) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719675.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene nuoI CDS complement(199950..200987) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene nuoH CDS complement(201013..201411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337552.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(201417..203441) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140171.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene nuoG CDS complement(203500..203775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(203783..205078) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene nuoF CDS complement(205169..205465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(205518..206324) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337548.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene nuoE CDS complement(206324..207565) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564438.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(207620..208222) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337546.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(208235..208768) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719665.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(208759..209124) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719664.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(209381..210163) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337545.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(210160..211020) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337544.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(211013..211663) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083414.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(211660..213588) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337543.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(213716..215320) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003589.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(215317..215790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(215790..216950) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 217097..217336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 217393..217857 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840846.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(217895..219112) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(219167..220306) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 220497..221243 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337891.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(221380..222054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(222204..223337) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene ispG CDS complement(223422..224672) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140227.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(224784..226013) product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383993.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene hemA CDS 226233..227609 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(227655..227921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(228282..229397) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338952.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene proB CDS complement(229385..230410) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723388.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene obgE CDS complement(230593..231132) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723384.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(231322..231591) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723383.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene rpmA CDS complement(231606..231992) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723380.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene rplU CDS complement(232186..233295) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(233424..235247) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337683.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(235354..236130) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720280.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(236158..236832) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720279.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(236822..237883) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(238229..238987) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(239075..239536) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337610.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 239649..240206 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337609.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 240415..240621 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719763.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene rpmF CDS 240646..241809 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene plsX CDS 241806..242780 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 242907..243209 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719760.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene ihfA CDS 243206..244120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 tRNA 244231..244308 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 244404..245444 product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337605.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 245693..247210 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384510.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene gatB CDS complement(247273..247815) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 248063..248431 product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337136.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(248428..248697) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337130.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 248810..249433 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(249508..249936) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337126.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 250074..250571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 250649..251710 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040076.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene hisC CDS complement(251749..252906) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337124.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene rnd CDS complement(253165..253752) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140088.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene purN CDS complement(253749..254795) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene purM tRNA 255103..255178 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 255793..256329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 note possible pseudo, internal stop codon, frameshifted CDS complement(256286..256723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460651.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(256716..257078) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(257075..257398) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 257474..258139 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(258519..258749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 258793..258999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(259163..259594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 note possible pseudo, frameshifted CDS complement(259976..260173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 note possible pseudo, frameshifted CDS complement(260229..260393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 260801..263029 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336989.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 263316..264308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 264305..267193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(267199..267600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(267667..268473) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114367.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 268378..268593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 268590..270332 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339207.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 270472..272271 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(272437..272637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(272868..273254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(273750..275834) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 276252..277457 product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230131.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 277474..278127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 278118..278894 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(278861..279571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(279564..279815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(279830..281440) product (2,3-dihydroxybenzoyl)adenylate synthase BasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207283.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene basE CDS 281644..286005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 286024..287442 product norspermidine-2,3-dihydroxybenzoate synthase VibH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880577.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene vibH CDS 287439..288383 product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711620.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene fepB CDS 288388..289398 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880579.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 289395..290441 product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447980.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 290552..292657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 292695..293516 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(293517..295319) product yersiniabactin ABC transporter ATP-binding/permease protein YbtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168689.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene ybtQ CDS complement(295319..297190) product yersiniabactin ABC transporter ATP-binding/permease protein YbtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene ybtP CDS complement(297397..298593) product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969726.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene aztD CDS complement(298698..299360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(299376..300605) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538090.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(300737..301651) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537804.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene prpB CDS complement(301656..302825) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390072.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene prpC CDS complement(302822..304339) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(304336..304740) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 304878..306263 product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(306306..307280) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970636.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene nrdF CDS complement(307366..309546) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651373.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene nrdE CDS complement(309516..309932) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776482.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene nrdI CDS complement(309937..310158) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930015.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene nrdH CDS 310826..311242 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972320.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 311342..311686 product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816713.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 sequence24 source 1..14633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331650.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(512..844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(926..3049) product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081097245.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(3033..4502) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384022.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(4502..4708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(4714..6882) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(6882..7544) product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140290.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(7687..8466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339615.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(8512..9315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004245.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(9312..9896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(10102..10713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723274.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(10750..11376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(11558..11998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(12149..12376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 12466..13140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 13158..14219 product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537890.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 sequence25 source 1..11680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 17..93 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 256..633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(968..6913) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164452817.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(6910..10182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(10549..11265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(11350..11586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 sequence26 source 1..11579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..1543 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538090.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 1666..2052 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(2055..3485) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene cls CDS complement(3511..3849) product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(3849..4802) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101778793.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(4961..5521) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063830.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(5554..6981) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063168296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 7225..8313 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037486.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 8310..9860 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 9870..11348 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275526.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 sequence27 source 1..11186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..1313) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420576.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene hisC CDS complement(1317..2474) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene metC CDS complement(2471..3505) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243759.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(3502..4956) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530415.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(5002..6369) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(6404..7408) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(7428..8219) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808030.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(8216..9016) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(9013..9873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 9766..10041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 10388..10759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 note possible pseudo, internal stop codon, frameshifted sequence28 source 1..9220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..769) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(856..1656) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723474.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(1656..2513) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723477.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2526..3629) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338990.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(3668..4780) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640832.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 4900..5697 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(5917..6966) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982293.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(6982..8964) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533164.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 sequence29 source 1..5489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 235..1698 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 1842..1918 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 1928..2003 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 rRNA 2300..5118 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 5203..5312 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 5413..5489 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 sequence30 source 1..5386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 147..1397 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536326.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 1421..1711 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112308747.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 1708..4641 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 4634..5200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 sequence31 source 1..4503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..1077 product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536328.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 1080..1763 product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 1775..3100 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968347.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 3199..4503 product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene glnT sequence32 source 1..2886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 17..93 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(50..1804) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209489743.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 sequence33 source 1..2884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..1268) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene cydB misc_feature complement(1275..>2884) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973556.1:cytochrome ubiquinol oxidase subunit I locus_tag LOCUS_23750 sequence34 source 1..288232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 489..887 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730602.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 880..2427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 2511..3674 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365316.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 3696..4277 product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339300.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 4423..4887 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563657.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene rplO CDS 4993..6351 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene secY CDS 6370..7026 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 7187..7555 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385301.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene rpsM CDS 7571..7960 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722534.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene rpsK CDS 8067..9098 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722536.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 9289..9708 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722538.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene rplQ CDS 9884..10495 product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538005.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 10548..11138 product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385295.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 11223..12533 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336957.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 12578..12958 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene crcB CDS 12955..14016 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136857752.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 14013..14678 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 14675..15388 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 15603..16619 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 16747..18009 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 18011..19324 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 19336..20127 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722560.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(20253..20774) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338695.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(20771..21385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338694.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(21382..22260) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene argB CDS 22389..23120 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(23176..24366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(24363..25355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(25367..25903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(26002..27723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 27937..28506 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene rfbC CDS 28503..29552 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene rfbB CDS 29549..30397 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836182.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene rfbD CDS 30394..31275 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724812.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene rfbA CDS 31377..34472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 34640..35758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 35858..37210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(37259..38200) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 38786..39274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 39271..41829 product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 41834..42877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 42975..44003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331298.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 43948..44139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 44155..45750 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331299.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(45966..48974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(49118..50284) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene ugd CDS 50480..51520 product DUF2793 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491179.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 51536..51829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976004.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(51792..52688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(52734..53549) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724798.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 54030..55199 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 55203..55859 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(55866..56843) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973916.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 57014..58177 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973473.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene glf CDS 58398..59522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(59560..61392) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383165.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(61514..62578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(62739..63389) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338692.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene yihA CDS complement(63389..64144) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338691.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(64141..65973) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038142527.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene yidC CDS complement(66131..67669) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338689.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(67747..68625) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338688.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene ttcA CDS complement(68618..68890) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721423.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene yidD CDS complement(68887..69369) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721421.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene rnpA CDS complement(69412..69546) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene rpmH CDS 69851..71251 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563098.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 71335..71838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 tRNA 71950..72026 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 72356..73423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(73471..74190) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531950.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(74420..75865) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331335.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(75926..77314) product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331334.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 tRNA complement(77813..77886) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 78037..78687 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720416.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 78806..80209 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 80337..81446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(81531..81851) product DUF6280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(82183..82926) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338103.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(82939..84687) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338102.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 84852..86057 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338101.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(86157..86561) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399589.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(86656..87768) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140093.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 87901..88683 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(88785..89120) product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337138.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(89124..92234) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(92430..92861) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719143.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 93088..94233 product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719144.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 94385..95581 product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140094.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(95483..95974) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337141.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(96079..96936) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene metF CDS 97030..97935 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719323.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 98014..99216 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392692.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 99300..100088 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 100173..100796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(100800..101495) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 101619..102038 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383048.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene mscL CDS complement(102093..103211) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338437.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene ald CDS 103359..103817 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338436.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(103814..105187) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337030.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 105071..105316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(105436..105642) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720900.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene rpsU CDS 105758..106426 product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 106423..107412 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 107433..107891 product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021993.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(107978..108613) product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383061.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 108747..109517 product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(109591..109779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(109938..111416) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(111566..112555) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(112582..114237) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339157.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(114234..115049) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(115046..115990) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(116032..117453) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337011.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene tldD CDS 117613..118500 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene coxB CDS 118511..119449 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722694.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene cyoE CDS 119446..119634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 119631..120203 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337013.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 120217..121023 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722701.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 121090..121767 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337014.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 121778..123175 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337015.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene thrC CDS 123172..124431 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 124431..125015 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722709.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 125054..126451 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140066.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(126456..126986) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(126983..127861) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(128027..128626) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337021.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 128703..129188 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563763.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 129237..129998 product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722722.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(130127..132367) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563776.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene ptsP CDS complement(132417..133679) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337028.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 133859..135403 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337027.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(135441..136085) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(136148..136582) product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337454.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(136654..137106) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974595.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(137245..138486) product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(138609..141677) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140215.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(141688..142803) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337795.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 143123..143443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 143540..143863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 144002..144187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 144304..144795 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524992.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(144866..145648) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 145755..146126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(146190..147482) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338519.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 147651..148412 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338520.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(148409..149785) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336858.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(149782..151332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(151473..153365) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140040.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(153602..155881) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336861.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 156063..156455 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564559.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 156455..157774 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336863.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 157776..158999 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336864.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 159008..159640 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336866.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene upp CDS 159704..161242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(161294..162310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336868.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(162432..164057) product acyl--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336869.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 164258..164905 product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(164966..167155) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337304.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(167148..167648) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918163.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(167648..168859) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337305.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(168869..169495) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530087.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(169846..170058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(170058..170504) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337306.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 170632..171000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(171087..171470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967889.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(171680..173455) product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337307.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(173476..173865) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719358.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(174121..174495) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719359.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 174643..175095 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 175092..175601 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337310.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 175594..176919 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(177038..178081) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003525.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene trpS CDS 178176..178859 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722664.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(178891..180438) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336999.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene murJ CDS complement(180435..183197) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337000.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(183248..184423) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722667.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 184521..185426 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337001.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene rsmI CDS 185423..185782 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722671.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 185839..186786 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383077.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene gshB CDS 186783..187694 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(187672..189186) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337003.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 189424..190302 product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720768.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 190299..191105 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338346.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 191157..192359 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene coaBC CDS 192379..192846 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338344.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene dut CDS 192846..193940 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139929.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 193978..194754 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 194751..195533 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528865.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 195599..197617 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338342.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(197750..198646) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383087.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(198700..199245) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669258.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 199443..200435 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337394.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(200508..201281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 201534..204035 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(204171..205004) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(205100..205636) product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140256.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(205727..206068) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724672.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(206222..206911) product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(206908..207513) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841687.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 207615..207863 product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383070.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(207886..208146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337408.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 208288..209034 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719501.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 209132..209446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 209459..209719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(209724..209993) product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338509.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(209993..210397) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720998.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene mce CDS 210536..211243 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338510.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(211248..211973) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338511.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 212114..212248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(212251..213522) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967274.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(213527..214894) product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(215014..216792) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338512.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene aspS CDS 217064..218404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 218484..221816 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene carB CDS 222127..222561 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513765.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 222575..223789 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085426.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 tRNA complement(223994..224068) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(224109..224183) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(224254..225132) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338062.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 225175..226524 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338061.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 226705..229122 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337791.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene lon CDS complement(229217..229435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 229624..229992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 tRNA 230012..230086 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 230239..231720 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338664.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 231732..232802 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338663.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 232802..234085 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338662.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene glcF CDS 234145..234924 product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 235085..235564 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338660.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(235625..236707) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836198.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene modC CDS complement(236707..237402) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531024.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene modB CDS complement(237407..238147) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836199.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene modA CDS complement(238212..238595) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385097.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 238702..239892 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 239902..240939 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338917.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 240936..241553 product glycosyltransferase family 29 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338918.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 241623..242645 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721972.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 242882..244465 product mucoidy inhibitor MuiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(244537..245187) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721974.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 245368..245748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 245850..247250 product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140017.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 247247..248077 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383288.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(248074..248421) product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721547.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(248697..248945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 249104..250234 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564386.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(250288..250983) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338929.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(250967..252502) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338928.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(252499..253488) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669892.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene thiB CDS complement(253851..254267) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 254423..255523 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721996.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene aroC CDS 255615..256244 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(256257..257030) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722115.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(257134..257916) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722004.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene petC CDS complement(257935..259248) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722007.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene petB CDS complement(259267..259836) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722009.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene petA CDS complement(260074..260793) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(260793..261293) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338743.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 261442..262311 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(262364..262555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(262663..263589) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921380.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(263595..264665) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338745.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene queG CDS complement(264710..265375) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003737.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(265429..265785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(265785..266384) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720894.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene recR CDS complement(266386..266733) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720893.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(266799..268574) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(268699..269358) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339257.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(269449..269937) product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101341700.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(270059..270979) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(271300..274212) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338324.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene ileS CDS 274590..275249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205631827.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 275246..275647 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene ybgC CDS 275809..276504 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720852.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene tolQ CDS 276508..276993 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720851.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene tolR CDS 277000..278481 product cell envelope integrity/translocation protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139941.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 278589..279908 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720849.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene tolB CDS 279977..280504 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720848.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene pal CDS 280509..281357 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338401.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene ybgF CDS 281354..282577 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338400.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene tilS CDS 282655..284550 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720845.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene ftsH CDS 284566..285372 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705336.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene tam CDS 285360..285953 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 286006..287673 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 287741..288046 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561857.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 sequence35 source 1..2251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..845) product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085780.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene eutC misc_feature complement(857..>2251) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388787.1:ethanolamine ammonia-lyase subunit EutB locus_tag LOCUS_26570 sequence36 source 1..2084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..1232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(1229..1894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 sequence37 source 1..1996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(326..1357) product IS110-like element ISRhru3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391189.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(1563..1904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 note possible pseudo, internal stop codon, frameshifted sequence38 source 1..1754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..823 product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973949.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 820..1503 product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973950.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 sequence39 source 1..1605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence40 source 1..1562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(636..>1562) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181318520.1:tail tape measure protein locus_tag LOCUS_26640 sequence41 source 1..1505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..1490) product IS1182-like element ISYen4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173543.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 sequence42 source 1..1498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(526..828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(882..1331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 sequence43 source 1..1271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(563..940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 note possible pseudo, frameshifted CDS complement(937..1140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 note possible pseudo, frameshifted sequence44 source 1..1265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..599 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722857.1:CoA transferase subunit A locus_tag LOCUS_26700 CDS 599..1243 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 sequence45 source 1..274263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..1733) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921551.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(1889..3787) product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(3798..4109) product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089262.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 4345..5991 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 5988..6830 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 6827..8218 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 8437..9348 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 9438..10424 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140036.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(10421..10900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 10787..11017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 11171..11533 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383934.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene rpsF CDS 11551..11778 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720283.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene rpsR CDS 11791..12363 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338021.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene rplI CDS 12506..13339 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(13497..14831) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene tig CDS 15043..16194 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 16191..17660 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338958.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(17673..19067) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384423.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(19064..20305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384424.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(20359..21039) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337631.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(21071..21682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(21679..22008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(22053..23234) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337632.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(23242..23406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(23441..24850) product DUF2927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140185.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 25297..26418 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337733.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 26435..27196 product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337734.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 27334..28263 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165113428.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(28279..31620) product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(31620..32873) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339136.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 33054..34208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 34378..35904 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(36071..36946) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(37048..37938) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337672.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene miaA CDS 38072..38803 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337673.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene pyrH CDS 38941..39504 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384346.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene frr CDS 39541..40284 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719857.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene uppS CDS 40281..41102 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 41106..42284 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337676.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene dxr CDS 42288..43631 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337677.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene rseP CDS 43715..43888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 44104..46479 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337678.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene bamA CDS 46489..47181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 47262..47723 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719864.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene fabZ CDS 47727..48521 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene lpxA CDS 48518..49330 product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337681.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene lpxI CDS 49327..50481 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene lpxB CDS 50481..50765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(50774..51658) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(51668..54085) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338622.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(54107..57547) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529825.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 57775..58788 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970722.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(58887..59447) product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562233.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 59751..61373 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337736.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 61421..62521 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562231.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 62540..62803 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719929.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 62808..64010 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(64071..64751) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337738.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 65207..66784 product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537591.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(66785..67072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 67293..68408 product DUF6456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337784.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(68423..68848) product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388435.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(69110..69472) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 tRNA 69833..69907 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 70104..70178 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(70297..70692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(70695..71081) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719588.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(71072..71941) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918323.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(71943..72404) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529946.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(72410..74518) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337488.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(74530..74895) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337489.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(74886..75167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(75284..76237) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337814.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(76239..77561) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337813.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(77572..78615) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365311.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 78917..80275 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337812.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 80332..81330 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 81327..82460 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 82461..84098 product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395262.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 84100..85185 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384634.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene ugpC CDS complement(85186..86511) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337783.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(86545..87486) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920552.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(87483..89057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337781.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(89047..89193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 89430..90017 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140213.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 90010..91119 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337780.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene aroB CDS complement(91276..91962) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 91948..93474 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225218.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 93471..94121 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 94213..95430 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562193.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(95545..95862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(96086..97804) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537699.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 98211..98984 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140204.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 99109..100158 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(100155..100853) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(100918..101832) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384198.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(101829..102725) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384199.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 103019..103774 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719944.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene rpsB CDS 103832..104785 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719943.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene tsf CDS complement(105102..105908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(106037..107788) product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(107809..108237) product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(108272..109147) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(109209..109889) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338841.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene gph CDS complement(109889..110443) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975096.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(110585..111277) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337745.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene rpe CDS complement(111428..112414) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339166.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(112631..114868) product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(114865..116037) product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(116058..116768) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577701.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(116925..118694) product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(118900..119295) product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640293.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(119396..119932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 120045..121220 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399360.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 121217..122176 product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872222.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 122194..122640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719733.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 122633..123352 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969564.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 123349..124128 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528734.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(124098..124718) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975094.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(124715..125527) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969566.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(125532..126503) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969567.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 126709..127398 product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399358.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene pedF CDS 127402..128310 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399356.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(128340..129197) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(129194..131242) product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345196.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(131290..132915) product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337820.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(132912..134876) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337821.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene glgX CDS complement(134927..136363) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003625.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene glgA CDS complement(136421..137692) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720043.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene glgC CDS complement(137715..139760) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337498.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene glgB CDS complement(139883..142285) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337823.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(142476..143531) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337843.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 143698..144096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(144099..144620) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337845.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(144617..145258) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337846.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene gmk CDS complement(145262..146176) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337847.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 146341..147066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(147150..148520) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337849.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 148699..149805 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720078.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 149959..151143 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537683.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 151252..152040 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 152093..152797 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 152799..153806 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 153803..155131 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 155280..156836 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565333.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene guaA CDS complement(157044..160478) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337755.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene mfd CDS complement(160528..161058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337756.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 161230..162228 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719957.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene hemB CDS 162352..162909 product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719958.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(162989..163609) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336991.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(163719..164279) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385193.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(164276..164854) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337790.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(164908..165171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 165433..165951 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336990.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene ssb CDS complement(166020..167579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 167715..168179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 168176..169522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(169557..170054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 170346..170750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(171111..171290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 171208..172941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 173055..175820 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338409.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 tRNA complement(175979..176055) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(176140..177360) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566727.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(177372..177932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(177959..178444) product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720600.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(178446..179729) product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139917.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(179729..180499) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene sufC CDS complement(180530..181135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(181167..181700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(181806..183320) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139918.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene sufB CDS complement(183357..184433) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338229.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(184591..185049) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720606.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 185241..185900 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720607.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 185900..186163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 186160..186759 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384251.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 186756..187187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 187248..188462 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336833.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(188518..188775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 189172..189789 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338232.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 189864..190478 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384253.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 190498..190830 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384254.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 190892..192712 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720611.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene typA CDS complement(192799..193923) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337929.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(193920..194726) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(194723..195604) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(195807..197219) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337930.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(197654..197902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(198010..199305) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338164.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(199302..200249) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338165.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(200246..201292) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338166.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(201282..202814) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338167.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(202811..203830) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338168.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(203982..206225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(206354..207112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(207262..208356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(208689..212651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(213449..214399) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719936.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene lipA CDS 214617..215165 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 215317..215688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 215856..216038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(216084..217103) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene arsB tRNA complement(217451..217534) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(217603..218457) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008163.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 218590..219168 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 219168..219650 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384324.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 219807..222551 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337619.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene gyrA CDS 222584..223285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 223379..224722 product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337618.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene trmFO CDS 224724..225560 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486256.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene gluQRS CDS complement(225563..225922) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337616.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene hisI CDS 225983..226423 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(226575..226697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(226776..228866) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337615.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene recG CDS complement(228863..231112) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337614.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene ligA CDS complement(231171..231884) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719770.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(231980..232258) product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719769.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 232400..233554 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337613.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene mnmA CDS complement(233634..235586) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088814.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(235637..236017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 236508..238958 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene nirB CDS 238955..239281 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene nirD CDS complement(239450..240322) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140207.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 240441..242909 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337759.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(243013..244134) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140208.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene hflX CDS 244060..244326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(244293..244526) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719962.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene hfq CDS complement(244671..246188) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719963.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(246198..247574) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719964.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene trkA CDS complement(247787..249202) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719965.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(249195..251459) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(251530..252903) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719967.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(252907..253977) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719968.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(253974..254948) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337762.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene dusB CDS 255177..256316 product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384089.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 256319..256801 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337764.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 256798..257265 product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337765.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(257262..257723) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719940.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 257817..258383 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene hpt CDS 258380..258550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(258551..259081) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336994.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(259074..259232) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722657.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene ccmD CDS complement(259229..259957) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669985.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(260041..260703) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722655.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene ccmB CDS complement(260840..261472) product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336993.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene ccmA CDS complement(261511..261879) product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722651.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(261866..262849) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722650.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene secF CDS complement(262862..264526) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722648.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene secD CDS complement(264541..264882) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene yajC CDS complement(265206..266369) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720066.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 266432..267265 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337840.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene mazG CDS complement(267324..268139) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384626.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(268163..269107) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384482.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene dusA CDS complement(269506..269682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 note possible pseudo, frameshifted CDS complement(269979..270185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 note possible pseudo, internal stop codon, frameshifted CDS complement(270441..270911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(270895..271881) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613682.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(271878..272966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(273393..274151) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 sequence46 source 1..1099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 411..647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 650..1093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 sequence47 source 1..1033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence48 source 1..1001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence49 source 1..237871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 344..1858 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 1922..2791 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207993.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 2999..3571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 3701..5557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(5667..6950) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(7121..8203) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008106.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(8247..9179) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564218.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(9176..10255) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339412.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(10252..11769) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339411.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(11769..12713) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339410.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene xdhC CDS complement(12710..15058) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975970.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene xdhB CDS complement(15055..16443) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339408.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene xdhA CDS 16662..20162 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene dnaE CDS complement(20213..20419) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724468.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 20493..21986 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339406.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene hisS CDS 21986..23059 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339405.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 23056..23748 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724462.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene hisG CDS complement(23752..24591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(24591..25277) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103989.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene ureG CDS complement(25274..26986) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267497.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene ureC CDS complement(26990..27685) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267498.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(27699..28367) product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(28364..28822) product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267500.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene ureE CDS complement(28871..29566) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene urtE CDS complement(29566..30315) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974752.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene urtD CDS complement(30319..31464) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974751.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene urtC CDS complement(31470..32363) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215689.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene urtB CDS complement(32424..33671) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974749.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 34519..35562 product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113129.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 35626..36732 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 36733..37914 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974748.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 37922..38572 product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313570.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 tRNA complement(38660..38734) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(38891..40672) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565538.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene recJ CDS complement(40677..41264) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338205.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 41380..41577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 41654..42952 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 43086..44051 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565540.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene glpX CDS complement(44137..44796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(44793..45341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(45353..47071) product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338203.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 47383..49389 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486260.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene dnaG CDS 49525..51537 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338200.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene rpoD CDS 51570..52082 product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966411.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 52195..52587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(52597..53460) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 53566..53931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 53989..54309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 54309..54725 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396765.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 54866..55333 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720557.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene nrdR CDS 55330..56418 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338198.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene ribD CDS complement(56415..58442) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537791.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(58442..59572) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338467.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(59653..60939) product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537790.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 61141..61737 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 61734..62867 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561762.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene ribB CDS 62869..63420 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720942.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 63417..63917 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841646.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene nusB CDS 64044..64394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338464.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 64715..65185 product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139947.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(65169..65405) product DUF6324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561771.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 tRNA 65534..65610 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(65617..66783) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090727.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(66776..66961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(66963..67184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(67184..68935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(68932..70248) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(70255..70836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(70928..71206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(71203..71394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 71474..71725 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107649648.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 71878..72381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 72368..72796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(72797..74581) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(74568..75062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(75081..75302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(75618..75890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(75893..76063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(76060..76476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(76759..77691) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242776.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 77791..78657 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367316.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 78984..79328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 note possible pseudo, frameshifted tRNA 79473..79562 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(80254..80964) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 81070..81924 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827762.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 81959..82852 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(82933..84813) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193082.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(84810..86378) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007421.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(86399..87016) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706154.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 87285..89090 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227785.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 89213..89872 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140311.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 90146..91234 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920660.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 91399..91590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 note possible pseudo, internal stop codon CDS complement(91733..92710) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 92885..95434 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336984.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene ptsP CDS 95431..96414 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene pfkB CDS 96546..98291 product PTS fructose transporter subunit EIIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336986.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(98404..99501) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721019.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene ychF CDS 99638..100429 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338525.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene trpA CDS 100605..101768 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338523.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(101759..102658) product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086786.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 102863..103474 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721014.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 103725..103922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383181.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(103977..104381) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559549.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 104446..105453 product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265949.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene ftrA CDS complement(105446..106729) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(106737..107282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(107279..108298) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 108506..108784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 108856..109431 product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389137.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 109444..110097 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389136.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 110189..110596 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139951.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(110687..111358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(111351..113309) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003707.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene parE CDS complement(113487..114152) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 114320..115348 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338472.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene ppk2 CDS 115544..115999 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566035.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 116067..116642 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338252.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 116687..118069 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338470.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(118240..118665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(118677..119879) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720951.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 120023..120304 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 120386..120904 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139949.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 121013..122167 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 122181..122561 product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724527.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(122537..123601) product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338254.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene epmA CDS 123699..124268 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720643.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene efp CDS 124334..124786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(124793..125236) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339106.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 125394..125903 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723732.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene fabA CDS 125928..127157 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339105.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene fabB CDS 127186..127962 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339104.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(128018..128620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 128681..129514 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337350.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(129489..129917) product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(130000..130335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(130982..131896) product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene thyX CDS 132153..133046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 133052..134485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 134536..134964 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720555.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(134971..135681) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338521.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene pth CDS 135849..136841 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529574.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 136929..137915 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387975.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene gap CDS complement(138000..138719) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722809.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(138865..139086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 139199..140065 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140071.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(140038..141024) product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337055.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 141391..141759 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722818.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 141837..142658 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563818.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 142765..144102 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(144109..144762) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039897.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(144832..146955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(147064..147231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 147188..149263 product BB2324 family autotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039723.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(149411..150691) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972735.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 150925..151527 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384535.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 151756..152451 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992301.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene bluB CDS 152674..153462 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338388.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene thiM CDS 153459..154070 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338387.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene thiE CDS 154067..154870 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene thiD CDS 154867..155544 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066884.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene tenA CDS complement(155576..156856) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140073.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene guaD CDS complement(156944..157789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 157943..159328 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722827.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene mgtE CDS 159325..159882 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337060.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 160035..160850 product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537935.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 160985..162769 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 162774..163157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 163255..163995 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338392.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 164125..164304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(164305..165165) product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385284.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 165246..165863 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388415.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 165914..166834 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338391.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(166977..168014) product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337289.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene choV CDS complement(168011..168847) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337290.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene choW CDS complement(168921..169850) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066528.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 169968..170549 product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337292.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene betI CDS 170546..171997 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337293.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene betB CDS 172097..173752 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337294.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene betA CDS 173861..174451 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140124.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 174526..175065 product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383079.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 175134..175379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(175433..176827) product propionyl-CoA assimilation transcriptional regulator PccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719339.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene pccR CDS complement(176876..178072) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337296.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(178154..178504) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940209.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 178790..180322 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719342.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 180333..180776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 181039..181158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 181315..181710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719345.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(181593..181994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 182063..182275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 182440..184446 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(184562..185056) product DUF4174 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337300.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 185259..187388 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene scpA CDS complement(187550..188740) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387889.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene nhaA CDS 189012..189737 product molecular chaperone DjiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720970.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 189718..190731 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 190749..191171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(191198..192757) product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338484.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(192808..194970) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338483.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(195021..195698) product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720965.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(195700..196800) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(196876..198066) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(198063..198830) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399793.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 198973..199956 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967763.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(200024..201130) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158216.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(201382..202488) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180937856.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(202667..203494) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337625.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(203673..204137) product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719789.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(204261..204728) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337627.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 204825..207596 product [glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140182.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(207604..208245) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719793.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene eda CDS complement(208365..210182) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538199.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene edd CDS 210402..211061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 211133..212341 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 212341..212883 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337630.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 212883..213383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 213481..214947 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562257.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene zwf CDS 214944..215615 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337699.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene pgl CDS 215615..217222 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337700.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene pgi CDS complement(217361..218590) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337692.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 218657..219289 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337693.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 219286..219948 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 220141..220740 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337695.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(220757..220924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 221067..222164 product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337252.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(222161..223117) product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene bmt CDS complement(223246..223557) product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719280.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 223831..224592 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383888.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 224605..224844 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene purS CDS 224920..225588 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719283.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene purQ CDS 225731..227431 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337255.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 227435..228766 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719285.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 229332..232154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(232214..232438) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337257.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 232530..233273 product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719288.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(233408..234196) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338959.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 234250..234669 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723418.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 234819..235280 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720164.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene rplM CDS 235283..235774 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720163.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene rpsI CDS 235929..236627 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 236629..237360 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720902.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene pssA sequence50 source 1..216528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 note possible pseudo, internal stop codon, frameshifted CDS complement(1229..1417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 1503..2483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(2824..3849) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339123.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(3971..5320) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816312.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(5415..6323) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 6424..7368 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene speB CDS complement(7384..9177) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene atzF CDS complement(9177..12677) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene uca CDS complement(12682..13278) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140961.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(13289..14089) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140962.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(14061..14918) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090873437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(14915..15733) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614998.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(15746..16813) product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(17167..20658) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537424.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(20655..22136) product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537423.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(22078..22641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383261.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(22681..23403) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927848.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(23485..23853) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061307.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene cyoD CDS complement(23853..24491) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819722.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene cyoC CDS complement(24488..26482) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061309.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene cyoB CDS complement(26472..27545) product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976134.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene cyoA CDS 27928..28875 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537506.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene cyoE CDS 28951..29559 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392579.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(29538..30299) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205939.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene bioC CDS complement(30296..30910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(30907..32193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(32193..32822) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973493.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene bioD CDS complement(32819..33949) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533325.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(33946..34950) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329308.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene bioB CDS 35268..37052 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 37049..38368 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336880.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 38581..39531 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336881.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 39624..41726 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336882.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 41723..42094 product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336883.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(42098..43945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(43942..44406) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966268.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(44539..45381) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973576.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(45378..46217) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313845.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(46225..47142) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973575.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(47139..48146) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973574.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(48216..49820) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313842.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(49992..51170) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973573.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 51418..52572 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061602.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 52633..53760 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529734.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 53721..54353 product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139955.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 54422..55468 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338222.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 55446..55793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 55805..56281 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338220.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 56281..57162 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970855.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(57159..57869) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338219.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(57862..58260) product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720584.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 58451..59293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 59384..59968 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180325543.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 59955..60344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 60362..60904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(60910..62322) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338214.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 62416..62694 product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383832.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 62702..63403 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720577.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 63487..65211 product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338212.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 65275..65865 product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338211.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 65862..66896 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338210.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 66957..67565 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561934.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 67656..69071 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338335.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene dacB CDS complement(69072..69971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(70083..70505) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720750.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 70609..72219 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008131.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(72253..73167) product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 73234..75657 product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383673.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(75702..76205) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338334.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 76326..77921 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330167.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 78278..80248 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561943.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene acs CDS 80252..80941 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 81148..81456 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339076.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 81453..83186 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339077.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 83245..85071 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720742.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 85085..85480 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 85477..87558 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(87705..88046) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862103.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene arsC CDS complement(88037..89095) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338626.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(89092..89430) product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338625.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 89602..91170 product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970201.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 note possible pseudo, internal stop codon CDS 91313..92575 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(92576..93067) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336828.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(93172..94002) product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336829.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(93999..95414) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336830.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene puuE CDS 95529..95885 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336831.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene uraH CDS 95993..97255 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339433.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 97450..98079 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720342.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 98193..99461 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338056.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene clpX CDS 99557..99937 product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720340.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 99974..100474 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene mlaD CDS 100471..100848 product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720338.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(100812..101426) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338055.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene aat CDS complement(101566..102912) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537788.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene accC CDS complement(102923..103414) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720335.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene accB CDS 103706..105043 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920799.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 105047..106366 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene preA CDS complement(106373..106972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(107078..107698) product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720331.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(107832..108416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(108555..109136) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338050.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 109339..110589 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720329.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 110670..112124 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140243.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene hydA CDS 112124..112912 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537570.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 112968..113438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 113448..114311 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720326.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 114308..115156 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338047.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 115204..116184 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969953.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 116284..116721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(116718..117836) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 118011..119315 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338041.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 119392..119811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 119811..120119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 120121..122808 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 122915..124039 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338039.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(124046..125554) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198383.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(125551..126021) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868950.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(126018..129047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(129044..129895) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970673.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(129906..131273) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(131270..132787) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974576.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(132834..133442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(133439..133939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(134045..134965) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(134974..135603) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967785.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(135600..136247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(136272..136529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 136505..136768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 136823..137947 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 137955..139511 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 139508..140557 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 140559..141494 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 141491..142897 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 142908..143771 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845532.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 143775..145088 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385587.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(145092..145652) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337853.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 145743..146081 product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338037.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 146178..148172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(148182..148397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 148551..148799 product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720309.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(148888..149769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 149851..151539 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338036.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 tRNA 151582..151657 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(151864..152106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 note possible pseudo, internal stop codon, frameshifted CDS 152467..152952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(152993..153967) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene speB CDS complement(153979..154761) product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(154761..155468) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097624.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(155462..156220) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(156217..156996) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530446.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(156996..157811) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309981.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(157861..158913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 159086..159721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(159725..160705) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528843.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 161045..162250 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399310.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(162279..163166) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971214.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 163257..163796 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971215.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 163799..164962 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699157.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 165125..165736 product YkoF family thiamine/hydroxymethylpyrimidine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368488.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 165759..166511 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368487.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 166504..167259 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368486.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 167256..168254 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368485.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(168258..169253) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204915.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(169250..170893) product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973292.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(170968..171201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 171133..172413 product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338261.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 172410..173408 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 173405..174841 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338263.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 174906..177164 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene hypF CDS 177364..178440 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 178444..180237 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 180286..181062 product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene cybH CDS 181396..182004 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 182004..182324 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338269.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 182335..182748 product hydrogenase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338270.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 182753..183580 product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 183577..184383 product [NiFe]-hydrogenase assembly chaperone HybE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338272.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene hybE CDS 184380..185264 product HupK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338273.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 185257..185598 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338274.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene hypA CDS 185598..186497 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338275.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene hypB CDS 186497..187972 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338276.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 187974..188264 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338277.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene hypC CDS 188261..189397 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338278.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene hypD CDS 189471..190493 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene hypE CDS 191433..192770 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338095.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 192835..194001 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(194144..194494) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337701.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 194602..195690 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 tRNA complement(195714..195787) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(196054..196899) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 197092..197514 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719804.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene dksA CDS 197618..198796 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337635.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(198908..199315) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968972.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(199400..200416) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669564.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene moaA CDS 200548..201075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 201090..201557 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140259.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 201821..203413 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972360.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 203432..204868 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163901150.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(204917..205309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(205309..205608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(205605..206174) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920592.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(206243..206554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(206588..207022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 207238..208527 product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565719.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(208545..209027) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435416.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene ybaK CDS complement(209024..209386) product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(209383..209742) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384293.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(209752..211599) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445450.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 211769..213562 product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550684.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS 213652..215304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880803.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 tRNA 215375..215448 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 215551..215820 product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(215878..216036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(216046..216198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 sequence51 source 1..193961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(347..1444) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385720.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(1760..4024) product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 4237..4650 product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339404.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(4804..5610) product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337932.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 tRNA complement(6068..6164) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 6359..7012 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538104.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 6996..8774 product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538103.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(8823..10007) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337766.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 tRNA 10104..10178 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS 10341..10724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 10792..11649 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975631.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 11711..12952 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339121.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(12949..13425) product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385200.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene nikR CDS 13553..14320 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339127.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 14320..14931 product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339128.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene cbiM CDS 14928..15515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339129.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 15512..16222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 16219..16923 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339131.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 17030..18865 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970221.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene ilvD CDS 18930..19475 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389004.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(19512..19826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(20076..20591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(20601..20996) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(21048..22346) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543324.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 22492..22950 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037316.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene mntR CDS 23155..23481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(23575..25224) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336975.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(25272..26249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 26419..26889 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722610.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene greA CDS 26915..27994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336974.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(28061..28642) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338449.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(28642..29226) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338451.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene mobA CDS 29311..30027 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 30024..30362 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720923.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(30421..31047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338453.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(31295..31768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(31765..32811) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338455.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(32808..34499) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338456.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 34628..35578 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(35721..36281) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338648.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 36446..37252 product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563045.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(37259..40699) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(40704..42155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(42270..43085) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338649.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(43095..43448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 43619..44584 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721320.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 44577..45062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 45059..45640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 45637..46914 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338650.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene pyrC CDS 46944..47543 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563048.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene plsY CDS 47593..48018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(48172..49542) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338651.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(49587..50111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338652.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(50108..50833) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338653.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 50864..51814 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338654.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene ubiA CDS 51876..54239 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338655.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 54257..54589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383388.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(54716..54943) product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563132.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(54940..55725) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338702.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene fdhD CDS complement(55722..58598) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338701.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene fdhF CDS complement(58595..60121) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338700.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(60118..60570) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085922.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(60671..61543) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338699.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 61688..62506 product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338698.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 62508..62687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 62688..63641 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711559.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 63652..64428 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383369.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 64738..66633 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338696.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene uvrC CDS 66698..67762 product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491191.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 67807..68436 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721439.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene pgsA CDS 68429..68677 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721437.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene moaD CDS 68679..69116 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721436.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(69145..70173) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338563.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 70245..70910 product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338562.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene mnmD CDS 70907..71779 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721079.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(71776..73725) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338564.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 73860..74732 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841738.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene dapA CDS complement(74888..76267) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722307.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(76269..77639) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336843.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(77781..79109) product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721316.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene nhaD CDS 79627..81174 product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563902.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 81171..81386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 81391..83190 product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720276.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene mdoH CDS 83183..84436 product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338013.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(84444..85346) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721410.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 85446..86018 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339565.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 86275..87780 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338684.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene ffh CDS 87777..88316 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338683.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 88313..88609 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721398.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 88652..89005 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382929.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene rpsP CDS 89083..89592 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721394.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene rimM CDS 89592..90434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 90431..91369 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080517624.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene trmD CDS 91499..91927 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707321.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 92224..92595 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721387.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene rplS CDS 92607..92828 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382925.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene rpmE CDS 93012..93821 product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(93824..93979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(94086..94529) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339256.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene aroQ CDS complement(94604..96922) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 97042..98277 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384562.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene pepT CDS 98289..98987 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(98990..99994) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530538.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 100095..100955 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(100952..101704) product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337779.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene cobF CDS complement(101750..102415) product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723748.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(102681..103430) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337778.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene cobA CDS complement(103427..104749) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086056.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(104770..105552) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337777.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene cobM CDS complement(105549..105896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(105893..107083) product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337775.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 107082..107837 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(107810..108547) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337773.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene cobJ CDS complement(108544..109281) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174893316.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(109284..109913) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086049.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(109913..111049) product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086048.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene cobG CDS complement(111046..114285) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337770.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene cobN CDS complement(114285..115328) product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337769.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene cobW CDS complement(115331..115684) product DUF1636 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562166.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 116028..116648 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337767.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene cobO CDS 116917..118362 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338494.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS complement(118359..119318) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338490.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene cobD CDS complement(119318..120256) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338227.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene cbiB CDS complement(120253..121047) product L-threonine kinase BluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139952.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene bluE CDS complement(121044..121619) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966025.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 121686..122189 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966032.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene cobU CDS 122186..123193 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531074.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene cobT CDS 123190..123936 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140155.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene cobS CDS complement(123924..124382) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724653.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(124393..125112) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724655.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(125125..126009) product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383359.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene cysW CDS complement(126002..126832) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724659.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene cysT CDS complement(126840..127967) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836193.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(128155..128619) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 128818..129090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 129100..129546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(129518..130603) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384035.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 130891..131913 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339091.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 131921..134629 product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140331.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene rbbA CDS 134634..135758 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339089.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 135891..138740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 139027..140475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(140631..140990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(141017..142000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(142222..144021) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670005.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene lepA CDS complement(144110..144658) product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337283.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(144660..145292) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337284.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(145286..145993) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337285.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 146147..146335 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720048.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 146540..146836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337161.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(146821..147351) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 147299..147988 product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339143.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 148228..148515 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337158.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene rpmB CDS 148636..148989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719170.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 149034..149555 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337160.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(149625..150638) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337157.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene meaB CDS 150762..151517 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719167.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 151525..153963 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337156.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene hrpB CDS complement(153970..154698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(154850..155776) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337153.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene argF CDS complement(155841..157022) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337152.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 157306..158175 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383598.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 158284..158631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(158727..158915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 159250..159801 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384899.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene ruvC CDS 159798..160466 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338315.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene ruvA CDS 160541..161587 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338313.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene ruvB CDS 161650..162057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(162124..163137) product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384544.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(163134..164537) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338326.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 164810..165577 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338327.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene truA CDS complement(165579..167507) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338776.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(167633..168238) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338777.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(168235..168939) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338778.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 169235..170362 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537986.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 170485..171351 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337320.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 171445..172479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336997.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 172490..172945 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383650.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS 173054..173611 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 173601..174254 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337317.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene tsaB CDS 174254..174679 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337316.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 174835..175824 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719369.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 175824..177398 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337315.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 177395..178486 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337314.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 178486..179454 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669233.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 179438..180238 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719365.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 180310..181233 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337312.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 181230..181991 product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537523.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(181997..182233) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721241.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(182293..183840) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563008.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(184036..186009) product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 186339..187631 product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721248.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene ccrA CDS complement(187708..188385) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337269.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(188382..189515) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669217.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(189512..190315) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337272.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 190573..191598 product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209066719.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 191595..192374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 sequence52 source 1..80459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..1485) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920703.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene rpoN CDS complement(1546..2736) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818883.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 3224..5203 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086466.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(5295..6125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(6122..8392) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528125.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(8448..10604) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170065.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(10704..11108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(11112..13046) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338380.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(13378..13656) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383555.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(13725..14663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 tRNA complement(14876..14952) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 15154..15861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(15881..16498) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467620.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(16612..16821) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS 16969..19401 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337824.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(19438..19827) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231200.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(19964..21442) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337641.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene glpK CDS complement(21463..23040) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669370.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene glpD CDS 23190..23684 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720830.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(23742..26240) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339447.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(26237..26908) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724571.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 26907..27599 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670506.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(27602..28822) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975684.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(28883..30259) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039043.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(30354..31298) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139943.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene hemC CDS 31414..32445 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338412.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene hemE CDS complement(32536..34563) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313934.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(34662..34811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(34892..35122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 35115..36383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(36412..37296) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338414.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene hemF CDS 37399..37809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338415.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(37829..38638) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720866.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(38681..39742) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338416.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(39765..40106) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338417.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene clpS CDS 40228..40923 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 41184..42836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(42909..43067) product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720871.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene ccoS CDS complement(43080..45326) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338419.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(45331..45786) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338420.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(45797..47239) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338421.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene ccoG CDS complement(47508..48401) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338422.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene ccoP CDS complement(48414..48629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(48641..49369) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720877.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene ccoO CDS complement(49382..50983) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338423.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene ccoN CDS 51237..52076 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720879.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(52136..52462) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382924.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(52494..53240) product Crp/Fnr family transcriptional regulator FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720880.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene fnrL CDS 53299..54654 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338424.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene hemN CDS complement(54826..56052) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(56049..57641) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338426.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(57638..58744) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561816.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(58744..59895) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537534.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(59927..61816) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338427.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(61956..62489) product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720887.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 62690..63538 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720888.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(63560..64036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(64104..65096) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene nudC CDS 65377..67296 product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537606.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 67484..68503 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 68550..69338 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383351.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 69338..70102 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338612.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 70265..71101 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338321.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(71098..71796) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561962.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(71883..72809) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338319.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(72806..73510) product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338318.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(73662..74315) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720727.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene fsa CDS 74444..76633 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338317.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 76747..77370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 77464..78870 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140143.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene rimO CDS 78968..79459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(79520..79936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(80029..80433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460