>Feature sequence1 439 1353 gene locus_tag LOCUS_00010 439 1353 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978023.1 protein_id gnl|my_center|LOCUS_00010 1450 2649 gene locus_tag LOCUS_00020 1450 2649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979895.1 protein_id gnl|my_center|LOCUS_00020 3134 2787 gene locus_tag LOCUS_00030 3134 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3378 3136 gene locus_tag LOCUS_00040 3378 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168171.1 protein_id gnl|my_center|LOCUS_00040 3617 3381 gene locus_tag LOCUS_00050 3617 3381 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846873.1 protein_id gnl|my_center|LOCUS_00050 4772 3627 gene locus_tag LOCUS_00060 gene fbp 4772 3627 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846263.1 protein_id gnl|my_center|LOCUS_00060 4934 5335 gene locus_tag LOCUS_00070 gene lrs14 4934 5335 CDS product HTH-type transcriptional regulator Lrs14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979935.1 protein_id gnl|my_center|LOCUS_00070 5919 5632 gene locus_tag LOCUS_00080 5919 5632 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979487.1 protein_id gnl|my_center|LOCUS_00080 7392 5953 gene locus_tag LOCUS_00090 gene proS 7392 5953 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979486.1 protein_id gnl|my_center|LOCUS_00090 7748 7434 gene locus_tag LOCUS_00100 7748 7434 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979485.1 protein_id gnl|my_center|LOCUS_00100 7889 9514 gene locus_tag LOCUS_00110 7889 9514 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011277553.1 protein_id gnl|my_center|LOCUS_00110 11175 9511 gene locus_tag LOCUS_00120 gene thsB 11175 9511 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846874.1 protein_id gnl|my_center|LOCUS_00120 12698 11379 gene locus_tag LOCUS_00130 gene purB 12698 11379 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978241.1 protein_id gnl|my_center|LOCUS_00130 12861 13781 gene locus_tag LOCUS_00140 12861 13781 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978242.1 protein_id gnl|my_center|LOCUS_00140 13778 14824 gene locus_tag LOCUS_00150 13778 14824 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846248.1 protein_id gnl|my_center|LOCUS_00150 14987 16003 gene locus_tag LOCUS_00160 14987 16003 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978244.1 protein_id gnl|my_center|LOCUS_00160 15993 17387 gene locus_tag LOCUS_00170 15993 17387 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978245.1 protein_id gnl|my_center|LOCUS_00170 17417 18355 gene locus_tag LOCUS_00180 17417 18355 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846246.1 protein_id gnl|my_center|LOCUS_00180 18416 20161 gene locus_tag LOCUS_00190 18416 20161 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978239.1 protein_id gnl|my_center|LOCUS_00190 20435 20235 gene locus_tag LOCUS_00200 20435 20235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00200 20872 20354 gene locus_tag LOCUS_00210 20872 20354 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978238.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00210 21598 21083 gene locus_tag LOCUS_00220 21598 21083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22281 21595 gene locus_tag LOCUS_00230 22281 21595 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978236.1 protein_id gnl|my_center|LOCUS_00230 22490 24304 gene locus_tag LOCUS_00240 gene infB 22490 24304 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978230.1 protein_id gnl|my_center|LOCUS_00240 24727 24317 gene locus_tag LOCUS_00250 gene ndk 24727 24317 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846241.1 protein_id gnl|my_center|LOCUS_00250 24909 24724 gene locus_tag LOCUS_00260 24909 24724 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_00260 24982 25230 gene locus_tag LOCUS_00270 24982 25230 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978233.1 protein_id gnl|my_center|LOCUS_00270 25243 25890 gene locus_tag LOCUS_00280 gene upp 25243 25890 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978234.1 protein_id gnl|my_center|LOCUS_00280 25871 26260 gene locus_tag LOCUS_00290 25871 26260 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_00290 26267 27691 gene locus_tag LOCUS_00300 gene gatB 26267 27691 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846244.1 protein_id gnl|my_center|LOCUS_00300 27823 28077 gene locus_tag LOCUS_00310 27823 28077 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846238.1 protein_id gnl|my_center|LOCUS_00310 28078 30555 gene locus_tag LOCUS_00320 28078 30555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00320 30552 31439 gene locus_tag LOCUS_00330 30552 31439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 31442 32326 gene locus_tag LOCUS_00340 31442 32326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00340 32323 34083 gene locus_tag LOCUS_00350 32323 34083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00350 34089 35261 gene locus_tag LOCUS_00360 gene rpoA2 34089 35261 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846867.1 protein_id gnl|my_center|LOCUS_00360 35266 35577 gene locus_tag LOCUS_00370 35266 35577 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978224.1 protein_id gnl|my_center|LOCUS_00370 35582 36013 gene locus_tag LOCUS_00380 35582 36013 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_00380 36022 36465 gene locus_tag LOCUS_00390 36022 36465 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_00390 36957 36496 gene locus_tag LOCUS_00400 36957 36496 CDS product DUF151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978221.1 protein_id gnl|my_center|LOCUS_00400 37070 37624 gene locus_tag LOCUS_00410 37070 37624 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_00410 37690 38994 gene locus_tag LOCUS_00420 gene tuf 37690 38994 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_00420 39004 39321 gene locus_tag LOCUS_00430 gene rpsJ 39004 39321 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978218.1 protein_id gnl|my_center|LOCUS_00430 39330 39414 gene locus_tag LOCUS_t00010 39330 39414 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 39470 40264 gene locus_tag LOCUS_00440 39470 40264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979321.1 protein_id gnl|my_center|LOCUS_00440 40384 40566 gene locus_tag LOCUS_00450 40384 40566 CDS product chromatin protein Cren7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846948.1 protein_id gnl|my_center|LOCUS_00450 40601 41281 gene locus_tag LOCUS_00460 gene pyrH 40601 41281 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_00460 41294 41563 gene locus_tag LOCUS_00470 41294 41563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 41658 43037 gene locus_tag LOCUS_00480 gene lysS 41658 43037 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979323.1 protein_id gnl|my_center|LOCUS_00480 44274 43201 gene locus_tag LOCUS_00490 44274 43201 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980265.1 protein_id gnl|my_center|LOCUS_00490 46040 44271 gene locus_tag LOCUS_00500 gene glmS 46040 44271 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847024.1 protein_id gnl|my_center|LOCUS_00500 47013 46054 gene locus_tag LOCUS_00510 gene mvk 47013 46054 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980266.1 protein_id gnl|my_center|LOCUS_00510 48146 47010 gene locus_tag LOCUS_00520 48146 47010 CDS product threonyl-tRNA synthetase editing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846739.1 protein_id gnl|my_center|LOCUS_00520 49331 48147 gene locus_tag LOCUS_00530 49331 48147 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_00530 49467 49823 gene locus_tag LOCUS_00540 49467 49823 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267078.1 protein_id gnl|my_center|LOCUS_00540 50508 49795 gene locus_tag LOCUS_00550 50508 49795 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980271.1 protein_id gnl|my_center|LOCUS_00550 50544 50620 gene locus_tag LOCUS_t00020 50544 50620 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 50665 51888 gene locus_tag LOCUS_00560 50665 51888 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978886.1 protein_id gnl|my_center|LOCUS_00560 52533 53072 gene locus_tag LOCUS_00570 52533 53072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 53607 53059 gene locus_tag LOCUS_00580 53607 53059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 53807 53607 gene locus_tag LOCUS_00590 53807 53607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 54748 53954 gene locus_tag LOCUS_00600 54748 53954 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240278.1 protein_id gnl|my_center|LOCUS_00600 54782 55720 gene locus_tag LOCUS_00610 54782 55720 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978980.1 protein_id gnl|my_center|LOCUS_00610 55717 56688 gene locus_tag LOCUS_00620 gene mvaD 55717 56688 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846449.1 protein_id gnl|my_center|LOCUS_00620 57655 56702 gene locus_tag LOCUS_00630 57655 56702 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978966.1 protein_id gnl|my_center|LOCUS_00630 57694 59316 gene locus_tag LOCUS_00640 gene thrS 57694 59316 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978967.1 protein_id gnl|my_center|LOCUS_00640 59313 59768 gene locus_tag LOCUS_00650 59313 59768 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978968.1 protein_id gnl|my_center|LOCUS_00650 59774 60571 gene locus_tag LOCUS_00660 59774 60571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846388.1 protein_id gnl|my_center|LOCUS_00660 60617 60690 gene locus_tag LOCUS_t00030 60617 60690 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 62459 61599 gene locus_tag LOCUS_00670 62459 61599 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980488.1 protein_id gnl|my_center|LOCUS_00670 63001 62926 gene locus_tag LOCUS_t00040 63001 62926 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 63640 64608 gene locus_tag LOCUS_00680 63640 64608 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429777.1 protein_id gnl|my_center|LOCUS_00680 65456 64605 gene locus_tag LOCUS_00690 65456 64605 CDS product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110369211.1 protein_id gnl|my_center|LOCUS_00690 65487 65984 gene locus_tag LOCUS_00700 65487 65984 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_00700 66003 67235 gene locus_tag LOCUS_00710 gene ilvA 66003 67235 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978248.1 protein_id gnl|my_center|LOCUS_00710 68143 67238 gene locus_tag LOCUS_00720 gene map 68143 67238 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979464.1 protein_id gnl|my_center|LOCUS_00720 68198 68878 gene locus_tag LOCUS_00730 68198 68878 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979463.1 protein_id gnl|my_center|LOCUS_00730 68886 70286 gene locus_tag LOCUS_00740 68886 70286 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979461.1 protein_id gnl|my_center|LOCUS_00740 70280 71911 gene locus_tag LOCUS_00750 gene pheT 70280 71911 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979460.1 protein_id gnl|my_center|LOCUS_00750 72524 71898 gene locus_tag LOCUS_00760 72524 71898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846787.1 protein_id gnl|my_center|LOCUS_00760 74576 72774 gene locus_tag LOCUS_00770 74576 72774 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978275.1 protein_id gnl|my_center|LOCUS_00770 74996 75235 gene locus_tag LOCUS_00780 74996 75235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846575.1 protein_id gnl|my_center|LOCUS_00780 75278 76786 gene locus_tag LOCUS_00790 75278 76786 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979518.1 protein_id gnl|my_center|LOCUS_00790 76899 77174 gene locus_tag LOCUS_00800 76899 77174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 77246 77902 gene locus_tag LOCUS_00810 77246 77902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 78263 77886 gene locus_tag LOCUS_00820 78263 77886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 78547 79383 gene locus_tag LOCUS_00830 78547 79383 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979765.1 protein_id gnl|my_center|LOCUS_00830 80947 80459 gene locus_tag LOCUS_00840 80947 80459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429725.1 protein_id gnl|my_center|LOCUS_00840 81669 80929 gene locus_tag LOCUS_00850 81669 80929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 81938 82492 gene locus_tag LOCUS_00860 gene cyaB 81938 82492 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978253.1 protein_id gnl|my_center|LOCUS_00860 82825 82478 gene locus_tag LOCUS_00870 82825 82478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 83107 83577 gene locus_tag LOCUS_00880 83107 83577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 83585 84841 gene locus_tag LOCUS_00890 gene hisS 83585 84841 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978283.1 protein_id gnl|my_center|LOCUS_00890 85892 85350 gene locus_tag LOCUS_00900 85892 85350 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978257.1 protein_id gnl|my_center|LOCUS_00900 87045 85858 gene locus_tag LOCUS_00910 87045 85858 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_00910 87854 87336 gene locus_tag LOCUS_00920 87854 87336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 87961 88734 gene locus_tag LOCUS_00930 87961 88734 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_00930 90211 88967 gene locus_tag LOCUS_00940 90211 88967 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979933.1 protein_id gnl|my_center|LOCUS_00940 90888 90463 gene locus_tag LOCUS_00950 90888 90463 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_00950 92206 90974 gene locus_tag LOCUS_00960 92206 90974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 93384 92155 gene locus_tag LOCUS_00970 gene tldD 93384 92155 CDS product zinc metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979571.1 protein_id gnl|my_center|LOCUS_00970 94310 94729 gene locus_tag LOCUS_00980 94310 94729 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651021.1 protein_id gnl|my_center|LOCUS_00980 94730 95341 gene locus_tag LOCUS_00990 94730 95341 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980578.1 protein_id gnl|my_center|LOCUS_00990 95417 95791 gene locus_tag LOCUS_01000 95417 95791 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979946.1 protein_id gnl|my_center|LOCUS_01000 95797 97152 gene locus_tag LOCUS_01010 95797 97152 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979948.1 protein_id gnl|my_center|LOCUS_01010 98040 97114 gene locus_tag LOCUS_01020 98040 97114 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846974.1 protein_id gnl|my_center|LOCUS_01020 98690 98037 gene locus_tag LOCUS_01030 98690 98037 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979569.1 protein_id gnl|my_center|LOCUS_01030 99535 98729 gene locus_tag LOCUS_01040 99535 98729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 99587 99907 gene locus_tag LOCUS_01050 99587 99907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 99974 100837 gene locus_tag LOCUS_01060 gene cyoE 99974 100837 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 protein_id gnl|my_center|LOCUS_01060 100997 101170 gene locus_tag LOCUS_01070 100997 101170 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980123.1 protein_id gnl|my_center|LOCUS_01070 101435 101172 gene locus_tag LOCUS_01080 101435 101172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846562.1 protein_id gnl|my_center|LOCUS_01080 101795 102103 gene locus_tag LOCUS_01090 101795 102103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979474.1 protein_id gnl|my_center|LOCUS_01090 102127 102612 gene locus_tag LOCUS_01100 102127 102612 CDS product protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846965.1 protein_id gnl|my_center|LOCUS_01100 102609 103040 gene locus_tag LOCUS_01110 102609 103040 CDS product DUF2286 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979472.1 protein_id gnl|my_center|LOCUS_01110 105729 102991 gene locus_tag LOCUS_01120 105729 102991 CDS product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979471.1 protein_id gnl|my_center|LOCUS_01120 105746 105820 gene locus_tag LOCUS_t00050 105746 105820 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 106282 106355 gene locus_tag LOCUS_t00060 106282 106355 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 106932 106381 gene locus_tag LOCUS_01130 gene mobB 106932 106381 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980116.1 protein_id gnl|my_center|LOCUS_01130 106913 108058 gene locus_tag LOCUS_01140 106913 108058 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980117.1 protein_id gnl|my_center|LOCUS_01140 108036 108623 gene locus_tag LOCUS_01150 108036 108623 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011277031.1 protein_id gnl|my_center|LOCUS_01150 109111 109659 gene locus_tag LOCUS_01160 109111 109659 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980120.1 protein_id gnl|my_center|LOCUS_01160 109629 110837 gene locus_tag LOCUS_01170 109629 110837 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980121.1 protein_id gnl|my_center|LOCUS_01170 111378 110866 gene locus_tag LOCUS_01180 111378 110866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 112078 112629 gene locus_tag LOCUS_01190 112078 112629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979538.1 protein_id gnl|my_center|LOCUS_01190 112635 112862 gene locus_tag LOCUS_01200 112635 112862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 113684 113052 gene locus_tag LOCUS_01210 113684 113052 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979539.1 protein_id gnl|my_center|LOCUS_01210 114805 113816 gene locus_tag LOCUS_01220 114805 113816 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979540.1 protein_id gnl|my_center|LOCUS_01220 115136 114807 gene locus_tag LOCUS_01230 gene metG 115136 114807 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979541.1 protein_id gnl|my_center|LOCUS_01230 115257 115958 gene locus_tag LOCUS_01240 115257 115958 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979542.1 protein_id gnl|my_center|LOCUS_01240 115955 116200 gene locus_tag LOCUS_01250 gene purS 115955 116200 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846581.1 protein_id gnl|my_center|LOCUS_01250 116281 116871 gene locus_tag LOCUS_01260 gene purQ 116281 116871 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846582.1 protein_id gnl|my_center|LOCUS_01260 116868 117665 gene locus_tag LOCUS_01270 116868 117665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01270 117665 118963 gene locus_tag LOCUS_01280 117665 118963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01280 118960 120324 gene locus_tag LOCUS_01290 gene purF 118960 120324 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979546.1 protein_id gnl|my_center|LOCUS_01290 120312 121493 gene locus_tag LOCUS_01300 120312 121493 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979547.1 protein_id gnl|my_center|LOCUS_01300 121490 122908 gene locus_tag LOCUS_01310 gene purD 121490 122908 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979548.1 protein_id gnl|my_center|LOCUS_01310 122905 123870 gene locus_tag LOCUS_01320 gene purM 122905 123870 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979549.1 protein_id gnl|my_center|LOCUS_01320 123930 124379 gene locus_tag LOCUS_01330 123930 124379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979550.1 protein_id gnl|my_center|LOCUS_01330 124413 124655 gene locus_tag LOCUS_01340 124413 124655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 124810 125940 gene locus_tag LOCUS_01350 124810 125940 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979551.1 protein_id gnl|my_center|LOCUS_01350 125944 127296 gene locus_tag LOCUS_01360 gene argH 125944 127296 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979552.1 protein_id gnl|my_center|LOCUS_01360 127271 128389 gene locus_tag LOCUS_01370 gene carA 127271 128389 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979553.1 protein_id gnl|my_center|LOCUS_01370 128376 128705 gene locus_tag LOCUS_01380 128376 128705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01380 128708 131512 gene locus_tag LOCUS_01390 gene carB 128708 131512 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979554.1 protein_id gnl|my_center|LOCUS_01390 131509 132354 gene locus_tag LOCUS_01400 gene lysX 131509 132354 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979555.1 protein_id gnl|my_center|LOCUS_01400 132981 132394 gene locus_tag LOCUS_01410 132981 132394 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979556.1 protein_id gnl|my_center|LOCUS_01410 133173 133349 gene locus_tag LOCUS_01420 133173 133349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 133393 133581 gene locus_tag LOCUS_01430 133393 133581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 133562 134326 gene locus_tag LOCUS_01440 133562 134326 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846261.1 protein_id gnl|my_center|LOCUS_01440 134316 134492 gene locus_tag LOCUS_01450 134316 134492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 134508 135083 gene locus_tag LOCUS_01460 134508 135083 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867433.1 protein_id gnl|my_center|LOCUS_01460 136648 136845 gene locus_tag LOCUS_01470 136648 136845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 138001 137198 gene locus_tag LOCUS_01480 138001 137198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980387.1 protein_id gnl|my_center|LOCUS_01480 138716 138342 gene locus_tag LOCUS_01490 138716 138342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 138951 138875 gene locus_tag LOCUS_t00070 138951 138875 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 139162 139836 gene locus_tag LOCUS_01500 gene rpiA 139162 139836 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979326.1 protein_id gnl|my_center|LOCUS_01500 140896 139847 gene locus_tag LOCUS_01510 140896 139847 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 protein_id gnl|my_center|LOCUS_01510 140986 142905 gene locus_tag LOCUS_01520 140986 142905 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978304.1 protein_id gnl|my_center|LOCUS_01520 143141 142923 gene locus_tag LOCUS_01530 143141 142923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 143195 143800 gene locus_tag LOCUS_01540 143195 143800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980231.1 protein_id gnl|my_center|LOCUS_01540 143801 144301 gene locus_tag LOCUS_01550 143801 144301 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980232.1 protein_id gnl|my_center|LOCUS_01550 144825 144358 gene locus_tag LOCUS_01560 144825 144358 CDS product AAA-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980406.1 protein_id gnl|my_center|LOCUS_01560 144933 145430 gene locus_tag LOCUS_01570 144933 145430 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978265.1 protein_id gnl|my_center|LOCUS_01570 147170 145749 gene locus_tag LOCUS_01580 147170 145749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980448.1 protein_id gnl|my_center|LOCUS_01580 148311 147667 gene locus_tag LOCUS_01590 148311 147667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 148636 148397 gene locus_tag LOCUS_01600 148636 148397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 149136 148627 gene locus_tag LOCUS_01610 149136 148627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 149588 150019 gene locus_tag LOCUS_01620 149588 150019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980397.1 protein_id gnl|my_center|LOCUS_01620 150602 151174 gene locus_tag LOCUS_01630 gene pgsA 150602 151174 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979475.1 protein_id gnl|my_center|LOCUS_01630 151178 151543 gene locus_tag LOCUS_01640 151178 151543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978477.1 protein_id gnl|my_center|LOCUS_01640 152276 151443 gene locus_tag LOCUS_01650 gene priL 152276 151443 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979476.1 protein_id gnl|my_center|LOCUS_01650 152390 154099 gene locus_tag LOCUS_01660 gene metG 152390 154099 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979477.1 protein_id gnl|my_center|LOCUS_01660 156224 154092 gene locus_tag LOCUS_01670 156224 154092 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979478.1 protein_id gnl|my_center|LOCUS_01670 156292 156594 gene locus_tag LOCUS_01680 156292 156594 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979479.1 protein_id gnl|my_center|LOCUS_01680 156599 157171 gene locus_tag LOCUS_01690 156599 157171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 157173 158948 gene locus_tag LOCUS_01700 157173 158948 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846566.1 protein_id gnl|my_center|LOCUS_01700 158950 159492 gene locus_tag LOCUS_01710 158950 159492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01710 159531 160337 gene locus_tag LOCUS_01720 159531 160337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 160334 160963 gene locus_tag LOCUS_01730 160334 160963 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979483.1 protein_id gnl|my_center|LOCUS_01730 160966 161109 gene locus_tag LOCUS_01740 160966 161109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 162780 161890 gene locus_tag LOCUS_01750 gene speB 162780 161890 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978315.1 protein_id gnl|my_center|LOCUS_01750 162825 164546 gene locus_tag LOCUS_01760 gene glyS 162825 164546 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978316.1 protein_id gnl|my_center|LOCUS_01760 164546 164890 gene locus_tag LOCUS_01770 164546 164890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978317.1 protein_id gnl|my_center|LOCUS_01770 164887 165351 gene locus_tag LOCUS_01780 164887 165351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 165397 166023 gene locus_tag LOCUS_01790 165397 166023 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978319.1 protein_id gnl|my_center|LOCUS_01790 166025 166564 gene locus_tag LOCUS_01800 gene endA 166025 166564 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_01800 166603 167013 gene locus_tag LOCUS_01810 166603 167013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015385509.1 protein_id gnl|my_center|LOCUS_01810 168141 167233 gene locus_tag LOCUS_01820 gene speE 168141 167233 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978308.1 protein_id gnl|my_center|LOCUS_01820 168328 168143 gene locus_tag LOCUS_01830 168328 168143 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978307.1 protein_id gnl|my_center|LOCUS_01830 168566 168339 gene locus_tag LOCUS_01840 168566 168339 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_01840 168765 168852 gene locus_tag LOCUS_t00080 168765 168852 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 170055 169489 gene locus_tag LOCUS_01850 170055 169489 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979559.1 protein_id gnl|my_center|LOCUS_01850 170126 170485 gene locus_tag LOCUS_01860 170126 170485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846586.1 protein_id gnl|my_center|LOCUS_01860 170659 171147 gene locus_tag LOCUS_01870 170659 171147 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_01870 171534 171076 gene locus_tag LOCUS_01880 171534 171076 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979562.1 protein_id gnl|my_center|LOCUS_01880 171634 172617 gene locus_tag LOCUS_01890 gene amrS 171634 172617 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 protein_id gnl|my_center|LOCUS_01890 173688 172618 gene locus_tag LOCUS_01900 173688 172618 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979575.1 protein_id gnl|my_center|LOCUS_01900 175549 173720 gene locus_tag LOCUS_01910 175549 173720 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978810.1 protein_id gnl|my_center|LOCUS_01910 177364 175559 gene locus_tag LOCUS_01920 177364 175559 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978811.1 protein_id gnl|my_center|LOCUS_01920 177630 177974 gene locus_tag LOCUS_01930 177630 177974 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978432.1 protein_id gnl|my_center|LOCUS_01930 178023 178316 gene locus_tag LOCUS_01940 178023 178316 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846882.1 protein_id gnl|my_center|LOCUS_01940 178313 178966 gene locus_tag LOCUS_01950 178313 178966 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978430.1 protein_id gnl|my_center|LOCUS_01950 179772 180179 gene locus_tag LOCUS_01960 179772 180179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 180151 180834 gene locus_tag LOCUS_01970 gene trmJ 180151 180834 CDS product tRNA (cytidine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978427.1 protein_id gnl|my_center|LOCUS_01970 180862 181458 gene locus_tag LOCUS_01980 180862 181458 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_01980 181465 182649 gene locus_tag LOCUS_01990 gene spn 181465 182649 CDS product bifunctional sugar-1-phosphate nucleotidylyltransferase/acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978425.1 protein_id gnl|my_center|LOCUS_01990 182991 182653 gene locus_tag LOCUS_02000 182991 182653 CDS product DUF2175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980295.1 protein_id gnl|my_center|LOCUS_02000 183342 183962 gene locus_tag LOCUS_02010 183342 183962 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980368.1 protein_id gnl|my_center|LOCUS_02010 184093 185058 gene locus_tag LOCUS_02020 184093 185058 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980369.1 protein_id gnl|my_center|LOCUS_02020 185124 185750 gene locus_tag LOCUS_02030 185124 185750 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980293.1 protein_id gnl|my_center|LOCUS_02030 185847 186683 gene locus_tag LOCUS_02040 gene thyX 185847 186683 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980296.1 protein_id gnl|my_center|LOCUS_02040 186693 187124 gene locus_tag LOCUS_02050 gene ndhC 186693 187124 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980297.1 protein_id gnl|my_center|LOCUS_02050 187129 187800 gene locus_tag LOCUS_02060 187129 187800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 187784 189001 gene locus_tag LOCUS_02070 187784 189001 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980299.1 protein_id gnl|my_center|LOCUS_02070 188998 190056 gene locus_tag LOCUS_02080 gene nuoH 188998 190056 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846747.1 protein_id gnl|my_center|LOCUS_02080 190044 190571 gene locus_tag LOCUS_02090 gene nuoI 190044 190571 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847026.1 protein_id gnl|my_center|LOCUS_02090 190552 191055 gene locus_tag LOCUS_02100 190552 191055 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980302.1 protein_id gnl|my_center|LOCUS_02100 191057 191344 gene locus_tag LOCUS_02110 191057 191344 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980303.1 protein_id gnl|my_center|LOCUS_02110 191436 194810 gene locus_tag LOCUS_02120 191436 194810 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980304.1 protein_id gnl|my_center|LOCUS_02120 194814 196202 gene locus_tag LOCUS_02130 gene nuoN 194814 196202 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980305.1 protein_id gnl|my_center|LOCUS_02130 196204 197184 gene locus_tag LOCUS_02140 196204 197184 CDS product L-myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846748.1 protein_id gnl|my_center|LOCUS_02140 199174 197267 gene locus_tag LOCUS_02150 199174 197267 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980280.1 protein_id gnl|my_center|LOCUS_02150 201285 199171 gene locus_tag LOCUS_02160 201285 199171 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846742.1 protein_id gnl|my_center|LOCUS_02160 202465 202782 gene locus_tag LOCUS_02170 202465 202782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 203533 202838 gene locus_tag LOCUS_02180 203533 202838 CDS product DNA endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846929.1 protein_id gnl|my_center|LOCUS_02180 203992 204207 gene locus_tag LOCUS_02190 203992 204207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 204440 204171 gene locus_tag LOCUS_02200 204440 204171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 205072 204494 gene locus_tag LOCUS_02210 205072 204494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02210 205862 205278 gene locus_tag LOCUS_02220 205862 205278 CDS product IS607-like element ISSto11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742643.1 protein_id gnl|my_center|LOCUS_02220 207321 206080 gene locus_tag LOCUS_02230 207321 206080 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978978.1 protein_id gnl|my_center|LOCUS_02230 208034 207318 gene locus_tag LOCUS_02240 208034 207318 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978977.1 protein_id gnl|my_center|LOCUS_02240 208169 208729 gene locus_tag LOCUS_02250 208169 208729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 210080 208830 gene locus_tag LOCUS_02260 210080 208830 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978812.1 protein_id gnl|my_center|LOCUS_02260 210117 211448 gene locus_tag LOCUS_02270 210117 211448 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978813.1 protein_id gnl|my_center|LOCUS_02270 211436 213145 gene locus_tag LOCUS_02280 211436 213145 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846917.1 protein_id gnl|my_center|LOCUS_02280 213222 213755 gene locus_tag LOCUS_02290 gene nuoB 213222 213755 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979576.1 protein_id gnl|my_center|LOCUS_02290 214969 213734 gene locus_tag LOCUS_02300 214969 213734 CDS product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980109.1 protein_id gnl|my_center|LOCUS_02300 215933 214989 gene locus_tag LOCUS_02310 215933 214989 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980693.1 protein_id gnl|my_center|LOCUS_02310 216894 216679 gene locus_tag LOCUS_02320 216894 216679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 217002 217301 gene locus_tag LOCUS_02330 217002 217301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 217802 217362 gene locus_tag LOCUS_02340 217802 217362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980172.1 protein_id gnl|my_center|LOCUS_02340 218162 217914 gene locus_tag LOCUS_02350 218162 217914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 218991 219065 gene locus_tag LOCUS_t00090 218991 219065 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 221080 220238 gene locus_tag LOCUS_02360 221080 220238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 221391 221077 gene locus_tag LOCUS_02370 221391 221077 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_02370 223121 222870 gene locus_tag LOCUS_02380 223121 222870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 223592 223362 gene locus_tag LOCUS_02390 223592 223362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 223906 223724 gene locus_tag LOCUS_02400 223906 223724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 224705 225100 gene locus_tag LOCUS_02410 224705 225100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 225564 225476 gene locus_tag LOCUS_t00100 225564 225476 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 225813 226949 gene locus_tag LOCUS_02420 225813 226949 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978025.1 protein_id gnl|my_center|LOCUS_02420 227073 227963 gene locus_tag LOCUS_02430 gene radA 227073 227963 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846870.1 protein_id gnl|my_center|LOCUS_02430 228678 229574 gene locus_tag LOCUS_02440 228678 229574 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980352.1 protein_id gnl|my_center|LOCUS_02440 229567 230481 gene locus_tag LOCUS_02450 229567 230481 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980353.1 protein_id gnl|my_center|LOCUS_02450 230483 231520 gene locus_tag LOCUS_02460 230483 231520 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980354.1 protein_id gnl|my_center|LOCUS_02460 231517 232509 gene locus_tag LOCUS_02470 gene aroF 231517 232509 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980355.1 protein_id gnl|my_center|LOCUS_02470 232506 233546 gene locus_tag LOCUS_02480 gene aroB 232506 233546 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980356.1 protein_id gnl|my_center|LOCUS_02480 233534 234319 gene locus_tag LOCUS_02490 233534 234319 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980357.1 protein_id gnl|my_center|LOCUS_02490 234297 235475 gene locus_tag LOCUS_02500 gene aroC 234297 235475 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980358.1 protein_id gnl|my_center|LOCUS_02500 235442 236239 gene locus_tag LOCUS_02510 235442 236239 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980360.1 protein_id gnl|my_center|LOCUS_02510 236208 237440 gene locus_tag LOCUS_02520 gene aroA 236208 237440 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980361.1 protein_id gnl|my_center|LOCUS_02520 237437 238063 gene locus_tag LOCUS_02530 237437 238063 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980362.1 protein_id gnl|my_center|LOCUS_02530 238847 238539 gene locus_tag LOCUS_02540 238847 238539 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980363.1 protein_id gnl|my_center|LOCUS_02540 238990 239277 gene locus_tag LOCUS_02550 238990 239277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846761.1 protein_id gnl|my_center|LOCUS_02550 239399 240238 gene locus_tag LOCUS_02560 239399 240238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02560 240253 240909 gene locus_tag LOCUS_02570 240253 240909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02570 241937 241710 gene locus_tag LOCUS_02580 241937 241710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980366.1 protein_id gnl|my_center|LOCUS_02580 242076 242831 gene locus_tag LOCUS_02590 242076 242831 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980365.1 protein_id gnl|my_center|LOCUS_02590 244444 243242 gene locus_tag LOCUS_02600 244444 243242 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_02600 244500 245147 gene locus_tag LOCUS_02610 244500 245147 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978423.1 protein_id gnl|my_center|LOCUS_02610 245149 245577 gene locus_tag LOCUS_02620 245149 245577 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978422.1 protein_id gnl|my_center|LOCUS_02620 245564 246112 gene locus_tag LOCUS_02630 245564 246112 CDS product RNase P p30-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846330.1 protein_id gnl|my_center|LOCUS_02630 246300 246515 gene locus_tag LOCUS_02640 246300 246515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 246623 248407 gene locus_tag LOCUS_02650 246623 248407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 249207 249935 gene locus_tag LOCUS_02660 gene psmA 249207 249935 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846326.1 protein_id gnl|my_center|LOCUS_02660 249946 250644 gene locus_tag LOCUS_02670 249946 250644 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978418.1 protein_id gnl|my_center|LOCUS_02670 250766 251371 gene locus_tag LOCUS_02680 gene rrp4 250766 251371 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978417.1 protein_id gnl|my_center|LOCUS_02680 251418 252071 gene locus_tag LOCUS_02690 gene rrp41 251418 252071 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846320.1 protein_id gnl|my_center|LOCUS_02690 252073 252921 gene locus_tag LOCUS_02700 gene rrp42 252073 252921 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978415.1 protein_id gnl|my_center|LOCUS_02700 252918 253130 gene locus_tag LOCUS_02710 252918 253130 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978414.1 protein_id gnl|my_center|LOCUS_02710 253584 253847 gene locus_tag LOCUS_02720 253584 253847 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978181.1 protein_id gnl|my_center|LOCUS_02720 253816 254202 gene locus_tag LOCUS_02730 253816 254202 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978412.1 protein_id gnl|my_center|LOCUS_02730 254214 254924 gene locus_tag LOCUS_02740 gene xpf 254214 254924 CDS product 3'-flap repair endonuclease Xpf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978411.1 protein_id gnl|my_center|LOCUS_02740 255357 257567 gene locus_tag LOCUS_02750 255357 257567 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846316.1 protein_id gnl|my_center|LOCUS_02750 257635 258288 gene locus_tag LOCUS_02760 257635 258288 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978408.1 protein_id gnl|my_center|LOCUS_02760 259092 258271 gene locus_tag LOCUS_02770 259092 258271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 259514 259116 gene locus_tag LOCUS_02780 259514 259116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 259741 259589 gene locus_tag LOCUS_02790 259741 259589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 260149 261156 gene locus_tag LOCUS_02800 gene leuB 260149 261156 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978405.1 protein_id gnl|my_center|LOCUS_02800 261252 264401 gene locus_tag LOCUS_02810 gene ileS 261252 264401 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978404.1 protein_id gnl|my_center|LOCUS_02810 264513 265160 gene locus_tag LOCUS_02820 264513 265160 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978403.1 protein_id gnl|my_center|LOCUS_02820 265326 266237 gene locus_tag LOCUS_02830 265326 266237 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978402.1 protein_id gnl|my_center|LOCUS_02830 266234 267034 gene locus_tag LOCUS_02840 gene rpl4p 266234 267034 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846313.1 protein_id gnl|my_center|LOCUS_02840 267031 267282 gene locus_tag LOCUS_02850 267031 267282 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978400.1 protein_id gnl|my_center|LOCUS_02850 267295 267699 gene locus_tag LOCUS_02860 267295 267699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 267642 268019 gene locus_tag LOCUS_02870 267642 268019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02870 268009 268431 gene locus_tag LOCUS_02880 268009 268431 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978398.1 protein_id gnl|my_center|LOCUS_02880 268435 268908 gene locus_tag LOCUS_02890 268435 268908 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978397.1 protein_id gnl|my_center|LOCUS_02890 268910 269608 gene locus_tag LOCUS_02900 268910 269608 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978396.1 protein_id gnl|my_center|LOCUS_02900 269589 269798 gene locus_tag LOCUS_02910 269589 269798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 270039 270371 gene locus_tag LOCUS_02920 270039 270371 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_02920 270376 270792 gene locus_tag LOCUS_02930 270376 270792 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846308.1 protein_id gnl|my_center|LOCUS_02930 270803 271204 gene locus_tag LOCUS_02940 gene rplX 270803 271204 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846306.1 protein_id gnl|my_center|LOCUS_02940 271219 271965 gene locus_tag LOCUS_02950 271219 271965 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978391.1 protein_id gnl|my_center|LOCUS_02950 271967 272494 gene locus_tag LOCUS_02960 271967 272494 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_02960 272496 272660 gene locus_tag LOCUS_02970 272496 272660 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978389.1 protein_id gnl|my_center|LOCUS_02970 272665 273066 gene locus_tag LOCUS_02980 272665 273066 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978388.1 protein_id gnl|my_center|LOCUS_02980 273077 273616 gene locus_tag LOCUS_02990 273077 273616 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978387.1 protein_id gnl|my_center|LOCUS_02990 273619 274005 gene locus_tag LOCUS_03000 273619 274005 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978386.1 protein_id gnl|my_center|LOCUS_03000 274009 274458 gene locus_tag LOCUS_03010 274009 274458 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978385.1 protein_id gnl|my_center|LOCUS_03010 274460 275047 gene locus_tag LOCUS_03020 274460 275047 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978384.1 protein_id gnl|my_center|LOCUS_03020 275044 275691 gene locus_tag LOCUS_03030 275044 275691 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978383.1 protein_id gnl|my_center|LOCUS_03030 275688 276125 gene locus_tag LOCUS_03040 275688 276125 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978382.1 protein_id gnl|my_center|LOCUS_03040 276138 276575 gene locus_tag LOCUS_03050 276138 276575 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978381.1 protein_id gnl|my_center|LOCUS_03050 276592 277983 gene locus_tag LOCUS_03060 gene secY 276592 277983 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978380.1 protein_id gnl|my_center|LOCUS_03060 277983 278576 gene locus_tag LOCUS_03070 277983 278576 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846302.1 protein_id gnl|my_center|LOCUS_03070 278578 279024 gene locus_tag LOCUS_03080 278578 279024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 279238 279768 gene locus_tag LOCUS_03090 279238 279768 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_03090 281822 279774 gene locus_tag LOCUS_03100 281822 279774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03100 282499 281777 gene locus_tag LOCUS_03110 282499 281777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03110 282529 284127 gene locus_tag LOCUS_03120 282529 284127 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978364.1 protein_id gnl|my_center|LOCUS_03120 284141 284386 gene locus_tag LOCUS_03130 284141 284386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 284413 285129 gene locus_tag LOCUS_03140 284413 285129 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978361.1 protein_id gnl|my_center|LOCUS_03140 285152 285571 gene locus_tag LOCUS_03150 285152 285571 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_03150 286071 285541 gene locus_tag LOCUS_03160 286071 285541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 287133 286378 gene locus_tag LOCUS_03170 287133 286378 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978368.1 protein_id gnl|my_center|LOCUS_03170 287409 287152 gene locus_tag LOCUS_03180 287409 287152 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978367.1 protein_id gnl|my_center|LOCUS_03180 287701 287411 gene locus_tag LOCUS_03190 287701 287411 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978366.1 protein_id gnl|my_center|LOCUS_03190 288879 288127 gene locus_tag LOCUS_03200 288879 288127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978375.1 protein_id gnl|my_center|LOCUS_03200 289169 288921 gene locus_tag LOCUS_03210 289169 288921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846299.1 protein_id gnl|my_center|LOCUS_03210 290079 289997 gene locus_tag LOCUS_t00110 290079 289997 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 290697 290620 gene locus_tag LOCUS_t00120 290697 290620 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 291736 290771 gene locus_tag LOCUS_03220 291736 290771 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846293.1 protein_id gnl|my_center|LOCUS_03220 292566 291862 gene locus_tag LOCUS_03230 292566 291862 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978359.1 protein_id gnl|my_center|LOCUS_03230 293027 292563 gene locus_tag LOCUS_03240 gene ribH 293027 292563 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846879.1 protein_id gnl|my_center|LOCUS_03240 293469 293008 gene locus_tag LOCUS_03250 gene ribC 293469 293008 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978357.1 protein_id gnl|my_center|LOCUS_03250 294122 293466 gene locus_tag LOCUS_03260 294122 293466 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978356.1 protein_id gnl|my_center|LOCUS_03260 294669 294157 gene locus_tag LOCUS_03270 294669 294157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 294694 295458 gene locus_tag LOCUS_03280 294694 295458 CDS product DUF2208 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978354.1 protein_id gnl|my_center|LOCUS_03280 296737 295442 gene locus_tag LOCUS_03290 296737 295442 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978353.1 protein_id gnl|my_center|LOCUS_03290 297048 297782 gene locus_tag LOCUS_03300 gene pcn 297048 297782 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978351.1 protein_id gnl|my_center|LOCUS_03300 297789 298751 gene locus_tag LOCUS_03310 297789 298751 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978350.1 protein_id gnl|my_center|LOCUS_03310 298748 299776 gene locus_tag LOCUS_03320 298748 299776 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_03320 300368 300826 gene locus_tag LOCUS_03330 300368 300826 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978348.1 protein_id gnl|my_center|LOCUS_03330 301281 300832 gene locus_tag LOCUS_03340 gene rnhA 301281 300832 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978745.1 protein_id gnl|my_center|LOCUS_03340 301703 301320 gene locus_tag LOCUS_03350 301703 301320 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978347.1 protein_id gnl|my_center|LOCUS_03350 301771 302400 gene locus_tag LOCUS_03360 301771 302400 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978346.1 protein_id gnl|my_center|LOCUS_03360 302405 303646 gene locus_tag LOCUS_03370 gene eif2g 302405 303646 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846878.1 protein_id gnl|my_center|LOCUS_03370 303625 304023 gene locus_tag LOCUS_03380 303625 304023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156005204.1 protein_id gnl|my_center|LOCUS_03380 304034 304588 gene locus_tag LOCUS_03390 304034 304588 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978343.1 protein_id gnl|my_center|LOCUS_03390 304585 304788 gene locus_tag LOCUS_03400 304585 304788 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978342.1 protein_id gnl|my_center|LOCUS_03400 304788 305279 gene locus_tag LOCUS_03410 304788 305279 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978341.1 protein_id gnl|my_center|LOCUS_03410 306576 305335 gene locus_tag LOCUS_03420 306576 305335 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978340.1 protein_id gnl|my_center|LOCUS_03420 308783 306573 gene locus_tag LOCUS_03430 308783 306573 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978339.1 protein_id gnl|my_center|LOCUS_03430 309650 313066 gene locus_tag LOCUS_03440 gene rgy 309650 313066 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846290.1 protein_id gnl|my_center|LOCUS_03440 313109 313933 gene locus_tag LOCUS_03450 313109 313933 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978336.1 protein_id gnl|my_center|LOCUS_03450 314011 314346 gene locus_tag LOCUS_03460 314011 314346 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979535.1 protein_id gnl|my_center|LOCUS_03460 314359 314826 gene locus_tag LOCUS_03470 314359 314826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 314863 315879 gene locus_tag LOCUS_03480 314863 315879 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979533.1 protein_id gnl|my_center|LOCUS_03480 316516 315854 gene locus_tag LOCUS_03490 316516 315854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979532.1 protein_id gnl|my_center|LOCUS_03490 317150 316497 gene locus_tag LOCUS_03500 317150 316497 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979531.1 protein_id gnl|my_center|LOCUS_03500 317727 317140 gene locus_tag LOCUS_03510 gene pyrE 317727 317140 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979530.1 protein_id gnl|my_center|LOCUS_03510 317796 318686 gene locus_tag LOCUS_03520 gene pyrB 317796 318686 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979529.1 protein_id gnl|my_center|LOCUS_03520 318688 319158 gene locus_tag LOCUS_03530 gene pyrI 318688 319158 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846971.1 protein_id gnl|my_center|LOCUS_03530 319181 319768 gene locus_tag LOCUS_03540 319181 319768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846579.1 protein_id gnl|my_center|LOCUS_03540 319737 320882 gene locus_tag LOCUS_03550 gene pyrC 319737 320882 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846578.1 protein_id gnl|my_center|LOCUS_03550 320875 321741 gene locus_tag LOCUS_03560 gene pyrD 320875 321741 CDS product dihydroorotate dehydrogenase PyrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846577.1 protein_id gnl|my_center|LOCUS_03560 321745 322050 gene locus_tag LOCUS_03570 321745 322050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979524.1 protein_id gnl|my_center|LOCUS_03570 322090 322704 gene locus_tag LOCUS_03580 322090 322704 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979522.1 protein_id gnl|my_center|LOCUS_03580 322763 323236 gene locus_tag LOCUS_03590 322763 323236 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846576.1 protein_id gnl|my_center|LOCUS_03590 324152 323223 gene locus_tag LOCUS_03600 324152 323223 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978295.1 protein_id gnl|my_center|LOCUS_03600 324669 324145 gene locus_tag LOCUS_03610 324669 324145 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978294.1 protein_id gnl|my_center|LOCUS_03610 325204 324659 gene locus_tag LOCUS_03620 325204 324659 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878254.1 protein_id gnl|my_center|LOCUS_03620 326258 325197 gene locus_tag LOCUS_03630 gene hflX 326258 325197 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978292.1 protein_id gnl|my_center|LOCUS_03630 326722 326255 gene locus_tag LOCUS_03640 326722 326255 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978291.1 protein_id gnl|my_center|LOCUS_03640 326822 327997 gene locus_tag LOCUS_03650 326822 327997 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846270.1 protein_id gnl|my_center|LOCUS_03650 328007 328480 gene locus_tag LOCUS_03660 328007 328480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978289.1 protein_id gnl|my_center|LOCUS_03660 328477 329202 gene locus_tag LOCUS_03670 328477 329202 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978288.1 protein_id gnl|my_center|LOCUS_03670 330627 329167 gene locus_tag LOCUS_03680 gene tgtA 330627 329167 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_03680 331073 330624 gene locus_tag LOCUS_03690 331073 330624 CDS product Lsm family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846267.1 protein_id gnl|my_center|LOCUS_03690 331132 331512 gene locus_tag LOCUS_03700 331132 331512 CDS product DNA-directed RNA polymerase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978285.1 protein_id gnl|my_center|LOCUS_03700 332142 331558 gene locus_tag LOCUS_03710 gene psmB 332142 331558 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978284.1 protein_id gnl|my_center|LOCUS_03710 333611 332391 gene locus_tag LOCUS_03720 333611 332391 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846588.1 protein_id gnl|my_center|LOCUS_03720 334056 333688 gene locus_tag LOCUS_03730 334056 333688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 334459 334932 gene locus_tag LOCUS_03740 334459 334932 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846667.1 protein_id gnl|my_center|LOCUS_03740 334962 335186 gene locus_tag LOCUS_03750 334962 335186 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979944.1 protein_id gnl|my_center|LOCUS_03750 335257 336093 gene locus_tag LOCUS_03760 335257 336093 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979943.1 protein_id gnl|my_center|LOCUS_03760 336217 337533 gene locus_tag LOCUS_03770 336217 337533 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_03770 337530 338612 gene locus_tag LOCUS_03780 337530 338612 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979941.1 protein_id gnl|my_center|LOCUS_03780 338653 339321 gene locus_tag LOCUS_03790 338653 339321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846994.1 protein_id gnl|my_center|LOCUS_03790 339308 340000 gene locus_tag LOCUS_03800 339308 340000 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979939.1 protein_id gnl|my_center|LOCUS_03800 339997 340923 gene locus_tag LOCUS_03810 339997 340923 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846993.1 protein_id gnl|my_center|LOCUS_03810 340953 341411 gene locus_tag LOCUS_03820 340953 341411 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979966.1 protein_id gnl|my_center|LOCUS_03820 341411 342502 gene locus_tag LOCUS_03830 341411 342502 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846669.1 protein_id gnl|my_center|LOCUS_03830 342611 343033 gene locus_tag LOCUS_03840 342611 343033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 343030 343446 gene locus_tag LOCUS_03850 343030 343446 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979970.1 protein_id gnl|my_center|LOCUS_03850 343706 343467 gene locus_tag LOCUS_03860 343706 343467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 343981 344448 gene locus_tag LOCUS_03870 343981 344448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007889.1 protein_id gnl|my_center|LOCUS_03870 344488 345156 gene locus_tag LOCUS_03880 344488 345156 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978822.1 protein_id gnl|my_center|LOCUS_03880 345273 346340 gene locus_tag LOCUS_03890 345273 346340 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979583.1 protein_id gnl|my_center|LOCUS_03890 346825 346337 gene locus_tag LOCUS_03900 346825 346337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 347244 348029 gene locus_tag LOCUS_03910 347244 348029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03910 348020 348367 gene locus_tag LOCUS_03920 348020 348367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 348473 349315 gene locus_tag LOCUS_03930 348473 349315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03930 350168 352648 gene locus_tag LOCUS_03940 gene acnA 350168 352648 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846424.1 protein_id gnl|my_center|LOCUS_03940 352721 356851 gene locus_tag LOCUS_03950 352721 356851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 356891 358174 gene locus_tag LOCUS_03960 356891 358174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 359566 359012 gene locus_tag LOCUS_03970 359566 359012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978864.1 protein_id gnl|my_center|LOCUS_03970 361445 360132 gene locus_tag LOCUS_03980 361445 360132 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978858.1 protein_id gnl|my_center|LOCUS_03980 361772 362233 gene locus_tag LOCUS_03990 361772 362233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 363004 362699 gene locus_tag LOCUS_04000 363004 362699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978609.1 protein_id gnl|my_center|LOCUS_04000 363615 363001 gene locus_tag LOCUS_04010 363615 363001 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978641.1 protein_id gnl|my_center|LOCUS_04010 363643 364824 gene locus_tag LOCUS_04020 363643 364824 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980451.1 protein_id gnl|my_center|LOCUS_04020 366477 364843 gene locus_tag LOCUS_04030 366477 364843 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978016.1 protein_id gnl|my_center|LOCUS_04030 366612 366932 gene locus_tag LOCUS_04040 366612 366932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 366929 368842 gene locus_tag LOCUS_04050 366929 368842 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319808.1 protein_id gnl|my_center|LOCUS_04050 368843 370024 gene locus_tag LOCUS_04060 368843 370024 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878528.1 protein_id gnl|my_center|LOCUS_04060 370028 371128 gene locus_tag LOCUS_04070 370028 371128 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877943.1 protein_id gnl|my_center|LOCUS_04070 371125 372162 gene locus_tag LOCUS_04080 gene acdA 371125 372162 CDS product 3-(aryl)acrylate reductase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357672.1 protein_id gnl|my_center|LOCUS_04080 375055 374351 gene locus_tag LOCUS_04090 375055 374351 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728150.1 protein_id gnl|my_center|LOCUS_04090 375387 375043 gene locus_tag LOCUS_04100 375387 375043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 376269 375424 gene locus_tag LOCUS_04110 376269 375424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04110 376715 376269 gene locus_tag LOCUS_04120 376715 376269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04120 377546 376764 gene locus_tag LOCUS_04130 377546 376764 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_04130 377768 379183 gene locus_tag LOCUS_04140 377768 379183 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764782.1 protein_id gnl|my_center|LOCUS_04140 379239 379994 gene locus_tag LOCUS_04150 379239 379994 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_04150 381060 381260 gene locus_tag LOCUS_04160 381060 381260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 381522 382637 gene locus_tag LOCUS_04170 381522 382637 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 protein_id gnl|my_center|LOCUS_04170 382887 385277 gene locus_tag LOCUS_04180 382887 385277 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337816.1 protein_id gnl|my_center|LOCUS_04180 385345 386193 gene locus_tag LOCUS_04190 385345 386193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 386208 386984 gene locus_tag LOCUS_04200 386208 386984 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_04200 387052 388923 gene locus_tag LOCUS_04210 387052 388923 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980561.1 protein_id gnl|my_center|LOCUS_04210 388937 389629 gene locus_tag LOCUS_04220 388937 389629 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248985.1 protein_id gnl|my_center|LOCUS_04220 389626 391233 gene locus_tag LOCUS_04230 389626 391233 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037548.1 protein_id gnl|my_center|LOCUS_04230 391199 391621 gene locus_tag LOCUS_04240 391199 391621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04240 391618 392526 gene locus_tag LOCUS_04250 391618 392526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04250 394323 392734 gene locus_tag LOCUS_04260 394323 392734 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04260 394697 394332 gene locus_tag LOCUS_04270 394697 394332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04270 394789 395559 gene locus_tag LOCUS_04280 394789 395559 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_04280 395566 395928 gene locus_tag LOCUS_04290 395566 395928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 396135 396686 gene locus_tag LOCUS_04300 396135 396686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 396972 398474 gene locus_tag LOCUS_04310 gene mdlC 396972 398474 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100230921.1 protein_id gnl|my_center|LOCUS_04310 399882 398743 gene locus_tag LOCUS_04320 399882 398743 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_04320 400323 401060 gene locus_tag LOCUS_04330 400323 401060 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867135.1 protein_id gnl|my_center|LOCUS_04330 401478 402326 gene locus_tag LOCUS_04340 gene cutB 401478 402326 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_04340 402331 402840 gene locus_tag LOCUS_04350 402331 402840 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_04350 404054 402837 gene locus_tag LOCUS_04360 gene thrC 404054 402837 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_04360 404183 405607 gene locus_tag LOCUS_04370 404183 405607 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978087.1 protein_id gnl|my_center|LOCUS_04370 407105 405645 gene locus_tag LOCUS_04380 407105 405645 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_04380 407517 407107 gene locus_tag LOCUS_04390 407517 407107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 408998 407841 gene locus_tag LOCUS_04400 408998 407841 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877710.1 protein_id gnl|my_center|LOCUS_04400 411286 409004 gene locus_tag LOCUS_04410 411286 409004 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_04410 411992 413317 gene locus_tag LOCUS_04420 411992 413317 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546536.1 protein_id gnl|my_center|LOCUS_04420 413940 415316 gene locus_tag LOCUS_04430 413940 415316 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968439.1 protein_id gnl|my_center|LOCUS_04430 415571 416005 gene locus_tag LOCUS_04440 415571 416005 CDS product CoxG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978538.1 protein_id gnl|my_center|LOCUS_04440 416083 417027 gene locus_tag LOCUS_04450 416083 417027 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947905.1 protein_id gnl|my_center|LOCUS_04450 417475 418800 gene locus_tag LOCUS_04460 417475 418800 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978704.1 protein_id gnl|my_center|LOCUS_04460 419542 420753 gene locus_tag LOCUS_04470 419542 420753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 420784 421194 gene locus_tag LOCUS_04480 420784 421194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 422338 421493 gene locus_tag LOCUS_04490 gene fabG 422338 421493 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_04490 422875 424086 gene locus_tag LOCUS_04500 422875 424086 CDS product 3-hydroxy-3-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814048.1 protein_id gnl|my_center|LOCUS_04500 424764 425576 gene locus_tag LOCUS_04510 424764 425576 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_04510 425573 426079 gene locus_tag LOCUS_04520 gene cutC 425573 426079 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_04520 426076 426855 gene locus_tag LOCUS_04530 426076 426855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04530 426870 428495 gene locus_tag LOCUS_04540 426870 428495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04540 430294 429212 gene locus_tag LOCUS_04550 430294 429212 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978015.1 protein_id gnl|my_center|LOCUS_04550 430718 430506 gene locus_tag LOCUS_04560 430718 430506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 430990 431376 gene locus_tag LOCUS_04570 gene tnpA 430990 431376 CDS product IS200/IS605-like element ISSto1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977980.1 protein_id gnl|my_center|LOCUS_04570 431363 431554 gene locus_tag LOCUS_04580 431363 431554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04580 431548 432672 gene locus_tag LOCUS_04590 431548 432672 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980639.1 protein_id gnl|my_center|LOCUS_04590 432767 433177 gene locus_tag LOCUS_04600 432767 433177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 433723 434823 gene locus_tag LOCUS_04610 433723 434823 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979869.1 protein_id gnl|my_center|LOCUS_04610 434820 435998 gene locus_tag LOCUS_04620 434820 435998 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979868.1 protein_id gnl|my_center|LOCUS_04620 435995 436504 gene locus_tag LOCUS_04630 435995 436504 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979867.1 protein_id gnl|my_center|LOCUS_04630 436495 436902 gene locus_tag LOCUS_04640 436495 436902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 438388 437789 gene locus_tag LOCUS_04650 438388 437789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 439228 438791 gene locus_tag LOCUS_04660 439228 438791 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978000.1 protein_id gnl|my_center|LOCUS_04660 439214 439378 gene locus_tag LOCUS_04670 439214 439378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 439937 439521 gene locus_tag LOCUS_04680 439937 439521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 440785 439997 gene locus_tag LOCUS_04690 440785 439997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229234.1 protein_id gnl|my_center|LOCUS_04690 442117 442329 gene locus_tag LOCUS_04700 442117 442329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 443389 442373 gene locus_tag LOCUS_04710 443389 442373 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256636.1 protein_id gnl|my_center|LOCUS_04710 443411 443797 gene locus_tag LOCUS_04720 443411 443797 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251209.1 protein_id gnl|my_center|LOCUS_04720 443769 444479 gene locus_tag LOCUS_04730 443769 444479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 445626 444451 gene locus_tag LOCUS_04740 445626 444451 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846343.1 protein_id gnl|my_center|LOCUS_04740 445768 446064 gene locus_tag LOCUS_04750 445768 446064 CDS product ribonuclease P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980209.1 protein_id gnl|my_center|LOCUS_04750 446081 446311 gene locus_tag LOCUS_04760 446081 446311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 446274 446759 gene locus_tag LOCUS_04770 446274 446759 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980211.1 protein_id gnl|my_center|LOCUS_04770 447536 446640 gene locus_tag LOCUS_04780 447536 446640 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980212.1 protein_id gnl|my_center|LOCUS_04780 448582 447551 gene locus_tag LOCUS_04790 448582 447551 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847017.1 protein_id gnl|my_center|LOCUS_04790 448634 448996 gene locus_tag LOCUS_04800 448634 448996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 449867 448926 gene locus_tag LOCUS_04810 449867 448926 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980491.1 protein_id gnl|my_center|LOCUS_04810 450075 450812 gene locus_tag LOCUS_04820 450075 450812 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980216.1 protein_id gnl|my_center|LOCUS_04820 450809 451282 gene locus_tag LOCUS_04830 450809 451282 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_04830 451322 452062 gene locus_tag LOCUS_04840 451322 452062 CDS product DUF929 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979760.1 protein_id gnl|my_center|LOCUS_04840 453778 452645 gene locus_tag LOCUS_04850 453778 452645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978618.1 protein_id gnl|my_center|LOCUS_04850 454833 454621 gene locus_tag LOCUS_04860 454833 454621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 454966 455481 gene locus_tag LOCUS_04870 454966 455481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 455441 456070 gene locus_tag LOCUS_04880 455441 456070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 456305 456511 gene locus_tag LOCUS_04890 456305 456511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 457745 456834 gene locus_tag LOCUS_04900 457745 456834 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978799.1 protein_id gnl|my_center|LOCUS_04900 460020 459058 gene locus_tag LOCUS_04910 460020 459058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 460752 460156 gene locus_tag LOCUS_04920 460752 460156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 461033 460692 gene locus_tag LOCUS_04930 461033 460692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 461202 462251 gene locus_tag LOCUS_04940 461202 462251 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_04940 462744 462178 gene locus_tag LOCUS_04950 462744 462178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04950 464126 462813 gene locus_tag LOCUS_04960 464126 462813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 464356 465027 gene locus_tag LOCUS_04970 464356 465027 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_04970 465037 466158 gene locus_tag LOCUS_04980 gene sat 465037 466158 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_04980 466696 467319 gene locus_tag LOCUS_04990 466696 467319 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846725.1 protein_id gnl|my_center|LOCUS_04990 467979 467263 gene locus_tag LOCUS_05000 467979 467263 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980200.1 protein_id gnl|my_center|LOCUS_05000 468745 468110 gene locus_tag LOCUS_05010 468745 468110 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980190.1 protein_id gnl|my_center|LOCUS_05010 469795 469058 gene locus_tag LOCUS_05020 469795 469058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979637.1 protein_id gnl|my_center|LOCUS_05020 470656 469877 gene locus_tag LOCUS_05030 470656 469877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979636.1 protein_id gnl|my_center|LOCUS_05030 470711 472039 gene locus_tag LOCUS_05040 470711 472039 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979669.1 protein_id gnl|my_center|LOCUS_05040 472026 473480 gene locus_tag LOCUS_05050 472026 473480 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979670.1 protein_id gnl|my_center|LOCUS_05050 473691 473846 gene locus_tag LOCUS_05060 473691 473846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05060 475588 474506 gene locus_tag LOCUS_05070 475588 474506 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980130.1 protein_id gnl|my_center|LOCUS_05070 476219 475728 gene locus_tag LOCUS_05080 476219 475728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 477579 476212 gene locus_tag LOCUS_05090 477579 476212 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211170.1 protein_id gnl|my_center|LOCUS_05090 479831 478317 gene locus_tag LOCUS_05100 479831 478317 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_05100 480923 479940 gene locus_tag LOCUS_05110 480923 479940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05110 481225 480863 gene locus_tag LOCUS_05120 481225 480863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05120 483765 482176 gene locus_tag LOCUS_05130 483765 482176 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399863.1 protein_id gnl|my_center|LOCUS_05130 484577 485872 gene locus_tag LOCUS_05140 484577 485872 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730163.1 protein_id gnl|my_center|LOCUS_05140 486394 486732 gene locus_tag LOCUS_05150 486394 486732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 486970 486848 gene locus_tag LOCUS_05160 486970 486848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 487167 488777 gene locus_tag LOCUS_05170 487167 488777 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399863.1 protein_id gnl|my_center|LOCUS_05170 489459 490802 gene locus_tag LOCUS_05180 489459 490802 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977991.1 protein_id gnl|my_center|LOCUS_05180 492660 490969 gene locus_tag LOCUS_05190 492660 490969 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399880.1 protein_id gnl|my_center|LOCUS_05190 493157 494503 gene locus_tag LOCUS_05200 493157 494503 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729569.1 protein_id gnl|my_center|LOCUS_05200 495511 497364 gene locus_tag LOCUS_05210 495511 497364 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703274.1 protein_id gnl|my_center|LOCUS_05210 497636 499090 gene locus_tag LOCUS_05220 497636 499090 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_05220 499133 499591 gene locus_tag LOCUS_05230 499133 499591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 500401 499826 gene locus_tag LOCUS_05240 500401 499826 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171802.1 protein_id gnl|my_center|LOCUS_05240 500638 500778 gene locus_tag LOCUS_05250 500638 500778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 500790 501161 gene locus_tag LOCUS_05260 500790 501161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846147.1 protein_id gnl|my_center|LOCUS_05260 501443 503878 gene locus_tag LOCUS_05270 501443 503878 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921440.1 protein_id gnl|my_center|LOCUS_05270 504292 503885 gene locus_tag LOCUS_05280 504292 503885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05280 505176 504298 gene locus_tag LOCUS_05290 505176 504298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05290 506762 505647 gene locus_tag LOCUS_05300 506762 505647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 507259 506819 gene locus_tag LOCUS_05310 507259 506819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 508315 507437 gene locus_tag LOCUS_05320 508315 507437 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979652.1 protein_id gnl|my_center|LOCUS_05320 509872 508679 gene locus_tag LOCUS_05330 509872 508679 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846343.1 protein_id gnl|my_center|LOCUS_05330 510187 511353 gene locus_tag LOCUS_05340 510187 511353 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_05340 512168 511500 gene locus_tag LOCUS_05350 512168 511500 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 protein_id gnl|my_center|LOCUS_05350 513111 512668 gene locus_tag LOCUS_05360 513111 512668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05360 513626 513111 gene locus_tag LOCUS_05370 513626 513111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 514471 515313 gene locus_tag LOCUS_05380 514471 515313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05380 515316 516773 gene locus_tag LOCUS_05390 515316 516773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05390 516779 517684 gene locus_tag LOCUS_05400 gene cutB 516779 517684 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979850.1 protein_id gnl|my_center|LOCUS_05400 517629 518117 gene locus_tag LOCUS_05410 gene cutC 517629 518117 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_05410 518795 518121 gene locus_tag LOCUS_05420 518795 518121 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809371.1 protein_id gnl|my_center|LOCUS_05420 519575 520234 gene locus_tag LOCUS_05430 519575 520234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05430 520252 520446 gene locus_tag LOCUS_05440 520252 520446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 520443 520916 gene locus_tag LOCUS_05450 gene cutC 520443 520916 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_05450 521104 521535 gene locus_tag LOCUS_05460 521104 521535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 521541 522356 gene locus_tag LOCUS_05470 521541 522356 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_05470 522403 524031 gene locus_tag LOCUS_05480 522403 524031 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979131.1 protein_id gnl|my_center|LOCUS_05480 524406 524086 gene locus_tag LOCUS_05490 524406 524086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 525086 524403 gene locus_tag LOCUS_05500 525086 524403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05500 525366 525959 gene locus_tag LOCUS_05510 525366 525959 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846139.1 protein_id gnl|my_center|LOCUS_05510 525974 527668 gene locus_tag LOCUS_05520 525974 527668 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977987.1 protein_id gnl|my_center|LOCUS_05520 529095 528331 gene locus_tag LOCUS_05530 529095 528331 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977985.1 protein_id gnl|my_center|LOCUS_05530 532153 531125 gene locus_tag LOCUS_05540 532153 531125 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978803.1 protein_id gnl|my_center|LOCUS_05540 532673 532188 gene locus_tag LOCUS_05550 gene purE 532673 532188 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880741.1 protein_id gnl|my_center|LOCUS_05550 533018 534283 gene locus_tag LOCUS_05560 533018 534283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 534273 534725 gene locus_tag LOCUS_05570 534273 534725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 534778 535425 gene locus_tag LOCUS_05580 534778 535425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 536687 536250 gene locus_tag LOCUS_05590 536687 536250 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978077.1 protein_id gnl|my_center|LOCUS_05590 538118 536781 gene locus_tag LOCUS_05600 gene merA 538118 536781 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846936.1 protein_id gnl|my_center|LOCUS_05600 538369 538115 gene locus_tag LOCUS_05610 538369 538115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 538608 538366 gene locus_tag LOCUS_05620 538608 538366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 538676 540181 gene locus_tag LOCUS_05630 gene glpK 538676 540181 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250347.1 protein_id gnl|my_center|LOCUS_05630 540973 540398 gene locus_tag LOCUS_05640 540973 540398 CDS product DUF2250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980177.1 protein_id gnl|my_center|LOCUS_05640 541554 540976 gene locus_tag LOCUS_05650 541554 540976 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980178.1 protein_id gnl|my_center|LOCUS_05650 543051 541870 gene locus_tag LOCUS_05660 543051 541870 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429682.1 protein_id gnl|my_center|LOCUS_05660 544375 544190 gene locus_tag LOCUS_05670 544375 544190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 545445 545062 gene locus_tag LOCUS_05680 545445 545062 CDS product CoxG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978538.1 protein_id gnl|my_center|LOCUS_05680 547418 545532 gene locus_tag LOCUS_05690 547418 545532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 548118 548819 gene locus_tag LOCUS_05700 548118 548819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 548919 549083 gene locus_tag LOCUS_05710 548919 549083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 549400 550653 gene locus_tag LOCUS_05720 549400 550653 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429692.1 protein_id gnl|my_center|LOCUS_05720 550863 551156 gene locus_tag LOCUS_05730 550863 551156 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168199.1 protein_id gnl|my_center|LOCUS_05730 552447 552232 gene locus_tag LOCUS_05740 552447 552232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 552789 552496 gene locus_tag LOCUS_05750 552789 552496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846828.1 protein_id gnl|my_center|LOCUS_05750 554869 552773 gene locus_tag LOCUS_05760 554869 552773 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980670.1 protein_id gnl|my_center|LOCUS_05760 555296 555556 gene locus_tag LOCUS_05770 555296 555556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 555713 556012 gene locus_tag LOCUS_05780 555713 556012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 556341 556009 gene locus_tag LOCUS_05790 556341 556009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 557764 557435 gene locus_tag LOCUS_05800 557764 557435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 558533 558778 gene locus_tag LOCUS_05810 558533 558778 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846437.1 protein_id gnl|my_center|LOCUS_05810 558759 559139 gene locus_tag LOCUS_05820 558759 559139 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014969.1 protein_id gnl|my_center|LOCUS_05820 559640 561829 gene locus_tag LOCUS_05830 gene cutA 559640 561829 CDS product glyceraldehyde dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980567.1 protein_id gnl|my_center|LOCUS_05830 561863 563104 gene locus_tag LOCUS_05840 561863 563104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977991.1 protein_id gnl|my_center|LOCUS_05840 564193 563666 gene locus_tag LOCUS_05850 564193 563666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 565052 566029 gene locus_tag LOCUS_05860 565052 566029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 566358 566573 gene locus_tag LOCUS_05870 566358 566573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 566587 566880 gene locus_tag LOCUS_05880 566587 566880 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846624.1 protein_id gnl|my_center|LOCUS_05880 567001 567531 gene locus_tag LOCUS_05890 567001 567531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 567765 568781 gene locus_tag LOCUS_05900 567765 568781 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429670.1 protein_id gnl|my_center|LOCUS_05900 568862 570349 gene locus_tag LOCUS_05910 568862 570349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 571290 571583 gene locus_tag LOCUS_05920 571290 571583 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978640.1 protein_id gnl|my_center|LOCUS_05920 571602 571802 gene locus_tag LOCUS_05930 571602 571802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 572460 572651 gene locus_tag LOCUS_05940 572460 572651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 573480 573307 gene locus_tag LOCUS_05950 573480 573307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 573543 573788 gene locus_tag LOCUS_05960 573543 573788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 575711 573873 gene locus_tag LOCUS_05970 575711 573873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168216.1 protein_id gnl|my_center|LOCUS_05970 575868 575713 gene locus_tag LOCUS_05980 575868 575713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 576521 575919 gene locus_tag LOCUS_05990 576521 575919 CDS product DUF1404 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015659.1 protein_id gnl|my_center|LOCUS_05990 576715 576518 gene locus_tag LOCUS_06000 576715 576518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980676.1 protein_id gnl|my_center|LOCUS_06000 578751 576991 gene locus_tag LOCUS_06010 578751 576991 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980682.1 protein_id gnl|my_center|LOCUS_06010 579302 578823 gene locus_tag LOCUS_06020 579302 578823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 579505 579299 gene locus_tag LOCUS_06030 579505 579299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 579852 580448 gene locus_tag LOCUS_06040 579852 580448 CDS product heme/copper-type cytochrome/quinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980681.1 protein_id gnl|my_center|LOCUS_06040 580441 580704 gene locus_tag LOCUS_06050 580441 580704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846830.1 protein_id gnl|my_center|LOCUS_06050 580694 582379 gene locus_tag LOCUS_06060 580694 582379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 582393 583310 gene locus_tag LOCUS_06070 582393 583310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980678.1 protein_id gnl|my_center|LOCUS_06070 584051 583245 gene locus_tag LOCUS_06080 584051 583245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980690.1 protein_id gnl|my_center|LOCUS_06080 585471 584083 gene locus_tag LOCUS_06090 gene queC 585471 584083 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980403.1 protein_id gnl|my_center|LOCUS_06090 585671 585471 gene locus_tag LOCUS_06100 585671 585471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 585705 587894 gene locus_tag LOCUS_06110 585705 587894 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846772.1 protein_id gnl|my_center|LOCUS_06110 587864 589756 gene locus_tag LOCUS_06120 587864 589756 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980401.1 protein_id gnl|my_center|LOCUS_06120 590299 589748 gene locus_tag LOCUS_06130 590299 589748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979703.1 protein_id gnl|my_center|LOCUS_06130 591161 592348 gene locus_tag LOCUS_06140 591161 592348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_06140 592370 594025 gene locus_tag LOCUS_06150 592370 594025 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467257.1 protein_id gnl|my_center|LOCUS_06150 594042 595034 gene locus_tag LOCUS_06160 594042 595034 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980658.1 protein_id gnl|my_center|LOCUS_06160 595904 596230 gene locus_tag LOCUS_06170 595904 596230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 596320 597771 gene locus_tag LOCUS_06180 596320 597771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980691.1 protein_id gnl|my_center|LOCUS_06180 598977 598330 gene locus_tag LOCUS_06190 598977 598330 CDS product DUF981 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979588.1 protein_id gnl|my_center|LOCUS_06190 599197 599622 gene locus_tag LOCUS_06200 599197 599622 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_06200 600384 601736 gene locus_tag LOCUS_06210 600384 601736 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978673.1 protein_id gnl|my_center|LOCUS_06210 602644 601967 gene locus_tag LOCUS_06220 602644 601967 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979601.1 protein_id gnl|my_center|LOCUS_06220 603109 602762 gene locus_tag LOCUS_06230 603109 602762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064500.1 protein_id gnl|my_center|LOCUS_06230 603413 603574 gene locus_tag LOCUS_06240 603413 603574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 603535 604161 gene locus_tag LOCUS_06250 603535 604161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 605885 604419 gene locus_tag LOCUS_06260 gene aldA 605885 604419 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225842.1 protein_id gnl|my_center|LOCUS_06260 606113 606496 gene locus_tag LOCUS_06270 606113 606496 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_06270 608280 606493 gene locus_tag LOCUS_06280 608280 606493 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_06280 609733 608402 gene locus_tag LOCUS_06290 609733 608402 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978848.1 protein_id gnl|my_center|LOCUS_06290 609882 610298 gene locus_tag LOCUS_06300 609882 610298 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_06300 612916 610559 gene locus_tag LOCUS_06310 612916 610559 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065536.1 protein_id gnl|my_center|LOCUS_06310 613024 613473 gene locus_tag LOCUS_06320 613024 613473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 613505 615481 gene locus_tag LOCUS_06330 613505 615481 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979587.1 protein_id gnl|my_center|LOCUS_06330 615992 615465 gene locus_tag LOCUS_06340 615992 615465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980091.1 protein_id gnl|my_center|LOCUS_06340 617151 616018 gene locus_tag LOCUS_06350 gene nirJ1 617151 616018 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966081.1 protein_id gnl|my_center|LOCUS_06350 618203 617148 gene locus_tag LOCUS_06360 618203 617148 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_06360 618316 619650 gene locus_tag LOCUS_06370 gene cbsA 618316 619650 CDS product cytochrome b558/566 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979723.1 protein_id gnl|my_center|LOCUS_06370 619647 620615 gene locus_tag LOCUS_06380 gene cbsB 619647 620615 CDS product cytochrome b558/566 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979724.1 protein_id gnl|my_center|LOCUS_06380 620617 621513 gene locus_tag LOCUS_06390 gene soxL2 620617 621513 CDS product Rieske iron-sulfur protein SoxL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979725.1 protein_id gnl|my_center|LOCUS_06390 621515 623158 gene locus_tag LOCUS_06400 621515 623158 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979726.1 protein_id gnl|my_center|LOCUS_06400 623243 623470 gene locus_tag LOCUS_06410 623243 623470 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979944.1 protein_id gnl|my_center|LOCUS_06410 623467 624888 gene locus_tag LOCUS_06420 623467 624888 CDS product SelD-related putative sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846378.1 protein_id gnl|my_center|LOCUS_06420 624885 625157 gene locus_tag LOCUS_06430 624885 625157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 626533 625682 gene locus_tag LOCUS_06440 626533 625682 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980321.1 protein_id gnl|my_center|LOCUS_06440 626751 627302 gene locus_tag LOCUS_06450 gene doxD 626751 627302 CDS product thiosulfate:quinone oxidoreductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979923.1 protein_id gnl|my_center|LOCUS_06450 627309 627800 gene locus_tag LOCUS_06460 gene doxA 627309 627800 CDS product thiosulfate:quinone oxidoreductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846665.1 protein_id gnl|my_center|LOCUS_06460 628328 629494 gene locus_tag LOCUS_06470 628328 629494 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182586238.1 protein_id gnl|my_center|LOCUS_06470 631265 629934 gene locus_tag LOCUS_06480 631265 629934 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978684.1 protein_id gnl|my_center|LOCUS_06480 632758 631565 gene locus_tag LOCUS_06490 632758 631565 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249449.1 protein_id gnl|my_center|LOCUS_06490 632893 633672 gene locus_tag LOCUS_06500 632893 633672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 634270 633662 gene locus_tag LOCUS_06510 634270 633662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 634687 635592 gene locus_tag LOCUS_06520 634687 635592 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979764.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06520 635654 636532 gene locus_tag LOCUS_06530 635654 636532 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268899.1 protein_id gnl|my_center|LOCUS_06530 638156 636519 gene locus_tag LOCUS_06540 638156 636519 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979987.1 protein_id gnl|my_center|LOCUS_06540 639549 638161 gene locus_tag LOCUS_06550 639549 638161 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015092.1 protein_id gnl|my_center|LOCUS_06550 641150 639588 gene locus_tag LOCUS_06560 641150 639588 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254096.1 protein_id gnl|my_center|LOCUS_06560 641323 642510 gene locus_tag LOCUS_06570 641323 642510 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979456.1 protein_id gnl|my_center|LOCUS_06570 643004 642504 gene locus_tag LOCUS_06580 643004 642504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 643675 643007 gene locus_tag LOCUS_06590 643675 643007 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_06590 645719 644727 gene locus_tag LOCUS_06600 645719 644727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086008.1 protein_id gnl|my_center|LOCUS_06600 647464 645716 gene locus_tag LOCUS_06610 647464 645716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 648885 647425 gene locus_tag LOCUS_06620 648885 647425 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015092.1 protein_id gnl|my_center|LOCUS_06620 649761 650864 gene locus_tag LOCUS_06630 649761 650864 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978530.1 protein_id gnl|my_center|LOCUS_06630 650901 651401 gene locus_tag LOCUS_06640 650901 651401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06640 652125 651772 gene locus_tag LOCUS_06650 652125 651772 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525114.1 protein_id gnl|my_center|LOCUS_06650 652956 652222 gene locus_tag LOCUS_06660 652956 652222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651061.1 protein_id gnl|my_center|LOCUS_06660 653356 652937 gene locus_tag LOCUS_06670 653356 652937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06670 653760 653404 gene locus_tag LOCUS_06680 653760 653404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06680 654581 654165 gene locus_tag LOCUS_06690 654581 654165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 655159 654596 gene locus_tag LOCUS_06700 655159 654596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 656460 655363 gene locus_tag LOCUS_06710 656460 655363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978898.1 protein_id gnl|my_center|LOCUS_06710 656890 656498 gene locus_tag LOCUS_06720 656890 656498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978746.1 protein_id gnl|my_center|LOCUS_06720 657342 657527 gene locus_tag LOCUS_06730 657342 657527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 657892 657515 gene locus_tag LOCUS_06740 657892 657515 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762169.1 protein_id gnl|my_center|LOCUS_06740 659366 658494 gene locus_tag LOCUS_06750 659366 658494 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846421.1 protein_id gnl|my_center|LOCUS_06750 659302 659868 gene locus_tag LOCUS_06760 659302 659868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 661025 659862 gene locus_tag LOCUS_06770 661025 659862 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846833.1 protein_id gnl|my_center|LOCUS_06770 661193 662587 gene locus_tag LOCUS_06780 661193 662587 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978647.1 protein_id gnl|my_center|LOCUS_06780 662587 663840 gene locus_tag LOCUS_06790 662587 663840 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978648.1 protein_id gnl|my_center|LOCUS_06790 664709 663837 gene locus_tag LOCUS_06800 664709 663837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846560.1 protein_id gnl|my_center|LOCUS_06800 665170 665772 gene locus_tag LOCUS_06810 665170 665772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979440.1 protein_id gnl|my_center|LOCUS_06810 667335 666232 gene locus_tag LOCUS_06820 667335 666232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979145.1 protein_id gnl|my_center|LOCUS_06820 667464 669119 gene locus_tag LOCUS_06830 667464 669119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 669116 669424 gene locus_tag LOCUS_06840 669116 669424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 669444 670850 gene locus_tag LOCUS_06850 669444 670850 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979442.1 protein_id gnl|my_center|LOCUS_06850 670822 672291 gene locus_tag LOCUS_06860 670822 672291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429662.1 protein_id gnl|my_center|LOCUS_06860 672307 673044 gene locus_tag LOCUS_06870 672307 673044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 673811 673488 gene locus_tag LOCUS_06880 673811 673488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 674147 675058 gene locus_tag LOCUS_06890 674147 675058 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980565.1 protein_id gnl|my_center|LOCUS_06890 676637 675150 gene locus_tag LOCUS_06900 676637 675150 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980182.1 protein_id gnl|my_center|LOCUS_06900 676862 677446 gene locus_tag LOCUS_06910 676862 677446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 678664 677798 gene locus_tag LOCUS_06920 678664 677798 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980319.1 protein_id gnl|my_center|LOCUS_06920 680853 679264 gene locus_tag LOCUS_06930 680853 679264 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977995.1 protein_id gnl|my_center|LOCUS_06930 680979 681329 gene locus_tag LOCUS_06940 680979 681329 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 681440 682300 gene locus_tag LOCUS_06950 gene meaB 681440 682300 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846722.1 protein_id gnl|my_center|LOCUS_06950 682342 682584 gene locus_tag LOCUS_06960 682342 682584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 682904 682560 gene locus_tag LOCUS_06970 682904 682560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06970 683446 682868 gene locus_tag LOCUS_06980 683446 682868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06980 683884 683660 gene locus_tag LOCUS_06990 683884 683660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 684293 684691 gene locus_tag LOCUS_07000 684293 684691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 684965 684681 gene locus_tag LOCUS_07010 684965 684681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 686441 685026 gene locus_tag LOCUS_07020 686441 685026 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980445.1 protein_id gnl|my_center|LOCUS_07020 687613 686735 gene locus_tag LOCUS_07030 gene nurA 687613 686735 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980188.1 protein_id gnl|my_center|LOCUS_07030 690213 687610 gene locus_tag LOCUS_07040 gene rad50 690213 687610 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846723.1 protein_id gnl|my_center|LOCUS_07040 691322 690210 gene locus_tag LOCUS_07050 gene mre11 691322 690210 CDS product DNA double-strand break repair protein Mre11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980186.1 protein_id gnl|my_center|LOCUS_07050 692467 691322 gene locus_tag LOCUS_07060 692467 691322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07060 692856 692533 gene locus_tag LOCUS_07070 692856 692533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07070 693275 692934 gene locus_tag LOCUS_07080 693275 692934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 693381 693202 gene locus_tag LOCUS_07090 693381 693202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 694164 693397 gene locus_tag LOCUS_07100 694164 693397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763735.1 protein_id gnl|my_center|LOCUS_07100 695141 694167 gene locus_tag LOCUS_07110 695141 694167 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763736.1 protein_id gnl|my_center|LOCUS_07110 695644 695147 gene locus_tag LOCUS_07120 695644 695147 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978749.1 protein_id gnl|my_center|LOCUS_07120 696832 695732 gene locus_tag LOCUS_07130 696832 695732 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978775.1 protein_id gnl|my_center|LOCUS_07130 697585 696857 gene locus_tag LOCUS_07140 697585 696857 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978088.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07140 699964 698210 gene locus_tag LOCUS_07150 699964 698210 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846383.1 protein_id gnl|my_center|LOCUS_07150 700467 699970 gene locus_tag LOCUS_07160 700467 699970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 700544 701224 gene locus_tag LOCUS_07170 700544 701224 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429825.1 protein_id gnl|my_center|LOCUS_07170 701788 702459 gene locus_tag LOCUS_07180 701788 702459 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978586.1 protein_id gnl|my_center|LOCUS_07180 702741 703469 gene locus_tag LOCUS_07190 702741 703469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 704137 703883 gene locus_tag LOCUS_07200 704137 703883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 706068 705229 gene locus_tag LOCUS_07210 706068 705229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980523.1 protein_id gnl|my_center|LOCUS_07210 706969 706061 gene locus_tag LOCUS_07220 706969 706061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980522.1 protein_id gnl|my_center|LOCUS_07220 707527 706970 gene locus_tag LOCUS_07230 707527 706970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 708063 707527 gene locus_tag LOCUS_07240 708063 707527 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980290.1 protein_id gnl|my_center|LOCUS_07240 708263 709006 gene locus_tag LOCUS_07250 708263 709006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 709032 709475 gene locus_tag LOCUS_07260 709032 709475 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980291.1 protein_id gnl|my_center|LOCUS_07260 709623 710216 gene locus_tag LOCUS_07270 709623 710216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846728.1 protein_id gnl|my_center|LOCUS_07270 710627 710403 gene locus_tag LOCUS_07280 710627 710403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07280 711231 710905 gene locus_tag LOCUS_07290 711231 710905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 711992 711315 gene locus_tag LOCUS_07300 711992 711315 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978067.1 protein_id gnl|my_center|LOCUS_07300 712147 711989 gene locus_tag LOCUS_07310 712147 711989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 713077 712685 gene locus_tag LOCUS_07320 713077 712685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 713727 713233 gene locus_tag LOCUS_07330 713727 713233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 714435 714232 gene locus_tag LOCUS_07340 714435 714232 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978621.1 protein_id gnl|my_center|LOCUS_07340 714665 715531 gene locus_tag LOCUS_07350 714665 715531 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980205.1 protein_id gnl|my_center|LOCUS_07350 716370 716023 gene locus_tag LOCUS_07360 gene trxA 716370 716023 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846726.1 protein_id gnl|my_center|LOCUS_07360 718233 716407 gene locus_tag LOCUS_07370 718233 716407 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_07370 718816 718322 gene locus_tag LOCUS_07380 718816 718322 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980181.1 protein_id gnl|my_center|LOCUS_07380 718817 720337 gene locus_tag LOCUS_07390 718817 720337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 720541 721902 gene locus_tag LOCUS_07400 gene ppcA 720541 721902 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980180.1 protein_id gnl|my_center|LOCUS_07400 721904 722707 gene locus_tag LOCUS_07410 721904 722707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980179.1 protein_id gnl|my_center|LOCUS_07410 723150 722953 gene locus_tag LOCUS_07420 723150 722953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 723949 723236 gene locus_tag LOCUS_07430 723949 723236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 726743 724116 gene locus_tag LOCUS_07440 726743 724116 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978696.1 protein_id gnl|my_center|LOCUS_07440 727816 728808 gene locus_tag LOCUS_07450 727816 728808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429734.1 protein_id gnl|my_center|LOCUS_07450 728805 730235 gene locus_tag LOCUS_07460 728805 730235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978693.1 protein_id gnl|my_center|LOCUS_07460 730228 731226 gene locus_tag LOCUS_07470 730228 731226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978692.1 protein_id gnl|my_center|LOCUS_07470 731223 732149 gene locus_tag LOCUS_07480 731223 732149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846907.1 protein_id gnl|my_center|LOCUS_07480 732160 732654 gene locus_tag LOCUS_07490 732160 732654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 732662 733315 gene locus_tag LOCUS_07500 732662 733315 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980489.1 protein_id gnl|my_center|LOCUS_07500 734400 733270 gene locus_tag LOCUS_07510 734400 733270 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846613.1 protein_id gnl|my_center|LOCUS_07510 734881 734450 gene locus_tag LOCUS_07520 734881 734450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 734900 735565 gene locus_tag LOCUS_07530 734900 735565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156006377.1 protein_id gnl|my_center|LOCUS_07530 736023 735562 gene locus_tag LOCUS_07540 736023 735562 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058301.1 protein_id gnl|my_center|LOCUS_07540 736855 736070 gene locus_tag LOCUS_07550 736855 736070 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978764.1 protein_id gnl|my_center|LOCUS_07550 737370 737567 gene locus_tag LOCUS_07560 737370 737567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 737648 737890 gene locus_tag LOCUS_07570 737648 737890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 737854 738237 gene locus_tag LOCUS_07580 737854 738237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 738478 738720 gene locus_tag LOCUS_07590 738478 738720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 739380 738988 gene locus_tag LOCUS_07600 739380 738988 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979870.1 protein_id gnl|my_center|LOCUS_07600 739594 739370 gene locus_tag LOCUS_07610 739594 739370 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846657.1 protein_id gnl|my_center|LOCUS_07610 741604 741978 gene locus_tag LOCUS_07620 741604 741978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978994.1 protein_id gnl|my_center|LOCUS_07620 743885 742905 gene locus_tag LOCUS_07630 743885 742905 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846928.1 protein_id gnl|my_center|LOCUS_07630 746122 745523 gene locus_tag LOCUS_07640 746122 745523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 746960 746133 gene locus_tag LOCUS_07650 746960 746133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 748857 747661 gene locus_tag LOCUS_07660 748857 747661 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_07660 749522 748854 gene locus_tag LOCUS_07670 749522 748854 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978371.1 protein_id gnl|my_center|LOCUS_07670 750941 749796 gene locus_tag LOCUS_07680 750941 749796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980493.1 protein_id gnl|my_center|LOCUS_07680 752044 751127 gene locus_tag LOCUS_07690 752044 751127 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978840.1 protein_id gnl|my_center|LOCUS_07690 752839 752099 gene locus_tag LOCUS_07700 752839 752099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980443.1 protein_id gnl|my_center|LOCUS_07700 753818 753096 gene locus_tag LOCUS_07710 753818 753096 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763153.1 protein_id gnl|my_center|LOCUS_07710 753733 754014 gene locus_tag LOCUS_07720 753733 754014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 754070 754333 gene locus_tag LOCUS_07730 754070 754333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 754330 755457 gene locus_tag LOCUS_07740 754330 755457 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846423.1 protein_id gnl|my_center|LOCUS_07740 755463 757382 gene locus_tag LOCUS_07750 755463 757382 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978806.1 protein_id gnl|my_center|LOCUS_07750 757786 757379 gene locus_tag LOCUS_07760 757786 757379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 758338 757865 gene locus_tag LOCUS_07770 gene priX 758338 757865 CDS product DNA primase noncatalytic subunit PriX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978610.1 protein_id gnl|my_center|LOCUS_07770 759151 758378 gene locus_tag LOCUS_07780 759151 758378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 759792 762770 gene locus_tag LOCUS_07790 759792 762770 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980229.1 protein_id gnl|my_center|LOCUS_07790 762949 763776 gene locus_tag LOCUS_07800 762949 763776 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847020.1 protein_id gnl|my_center|LOCUS_07800 763751 764431 gene locus_tag LOCUS_07810 763751 764431 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980227.1 protein_id gnl|my_center|LOCUS_07810 764456 765196 gene locus_tag LOCUS_07820 764456 765196 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847038.1 protein_id gnl|my_center|LOCUS_07820 765180 765485 gene locus_tag LOCUS_07830 765180 765485 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940862.1 protein_id gnl|my_center|LOCUS_07830 765635 766291 gene locus_tag LOCUS_07840 765635 766291 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980225.1 protein_id gnl|my_center|LOCUS_07840 766291 766860 gene locus_tag LOCUS_07850 766291 766860 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980226.1 protein_id gnl|my_center|LOCUS_07850 766968 768281 gene locus_tag LOCUS_07860 gene pyk 766968 768281 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979673.1 protein_id gnl|my_center|LOCUS_07860 768963 768298 gene locus_tag LOCUS_07870 768963 768298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846903.1 protein_id gnl|my_center|LOCUS_07870 770602 769067 gene locus_tag LOCUS_07880 770602 769067 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979663.1 protein_id gnl|my_center|LOCUS_07880 770814 771017 gene locus_tag LOCUS_07890 770814 771017 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978621.1 protein_id gnl|my_center|LOCUS_07890 771670 771545 gene locus_tag LOCUS_07900 771670 771545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 773393 772899 gene locus_tag LOCUS_07910 773393 772899 CDS product DUF1286 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979343.1 protein_id gnl|my_center|LOCUS_07910 773480 773884 gene locus_tag LOCUS_07920 773480 773884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 774963 773932 gene locus_tag LOCUS_07930 774963 773932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980666.1 protein_id gnl|my_center|LOCUS_07930 775748 775563 gene locus_tag LOCUS_07940 775748 775563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 775949 776854 gene locus_tag LOCUS_07950 775949 776854 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429779.1 protein_id gnl|my_center|LOCUS_07950 777371 776919 gene locus_tag LOCUS_07960 777371 776919 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978465.1 protein_id gnl|my_center|LOCUS_07960 778363 777368 gene locus_tag LOCUS_07970 778363 777368 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978466.1 protein_id gnl|my_center|LOCUS_07970 778863 778369 gene locus_tag LOCUS_07980 778863 778369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 778948 779439 gene locus_tag LOCUS_07990 778948 779439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07990 779424 779759 gene locus_tag LOCUS_08000 779424 779759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 779756 780277 gene locus_tag LOCUS_08010 779756 780277 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846349.1 protein_id gnl|my_center|LOCUS_08010 780541 780305 gene locus_tag LOCUS_08020 780541 780305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 780648 781034 gene locus_tag LOCUS_08030 780648 781034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 781054 782439 gene locus_tag LOCUS_08040 781054 782439 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_08040 784008 782395 gene locus_tag LOCUS_08050 784008 782395 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978471.1 protein_id gnl|my_center|LOCUS_08050 784039 784323 gene locus_tag LOCUS_08060 784039 784323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 784313 785113 gene locus_tag LOCUS_08070 784313 785113 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978473.1 protein_id gnl|my_center|LOCUS_08070 785145 786341 gene locus_tag LOCUS_08080 785145 786341 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979972.1 protein_id gnl|my_center|LOCUS_08080 786553 786644 gene locus_tag LOCUS_t00130 786553 786644 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 786798 787121 gene locus_tag LOCUS_08090 786798 787121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 787151 787648 gene locus_tag LOCUS_08100 787151 787648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 787657 788184 gene locus_tag LOCUS_08110 787657 788184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 788200 788991 gene locus_tag LOCUS_08120 788200 788991 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978211.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08120 789056 789955 gene locus_tag LOCUS_08130 789056 789955 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978210.1 protein_id gnl|my_center|LOCUS_08130 789939 790742 gene locus_tag LOCUS_08140 789939 790742 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846234.1 protein_id gnl|my_center|LOCUS_08140 790739 791227 gene locus_tag LOCUS_08150 790739 791227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218266606.1 protein_id gnl|my_center|LOCUS_08150 791697 791176 gene locus_tag LOCUS_08160 gene rimI 791697 791176 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_08160 791744 792457 gene locus_tag LOCUS_08170 791744 792457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08170 792457 792969 gene locus_tag LOCUS_08180 792457 792969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08180 792985 793061 gene locus_tag LOCUS_t00140 792985 793061 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 794441 794893 gene locus_tag LOCUS_08190 794441 794893 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978714.1 protein_id gnl|my_center|LOCUS_08190 795659 794877 gene locus_tag LOCUS_08200 gene cobM 795659 794877 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846661.1 protein_id gnl|my_center|LOCUS_08200 796326 795661 gene locus_tag LOCUS_08210 796326 795661 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979885.1 protein_id gnl|my_center|LOCUS_08210 796919 796323 gene locus_tag LOCUS_08220 gene cbiT 796919 796323 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979887.1 protein_id gnl|my_center|LOCUS_08220 797971 796916 gene locus_tag LOCUS_08230 gene cbiD 797971 796916 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155864053.1 protein_id gnl|my_center|LOCUS_08230 798714 797968 gene locus_tag LOCUS_08240 798714 797968 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979890.1 protein_id gnl|my_center|LOCUS_08240 799734 798826 gene locus_tag LOCUS_08250 799734 798826 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979891.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08250 800410 799739 gene locus_tag LOCUS_08260 800410 799739 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979892.1 protein_id gnl|my_center|LOCUS_08260 800568 800407 gene locus_tag LOCUS_08270 800568 800407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 801392 800535 gene locus_tag LOCUS_08280 gene cbiG 801392 800535 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979893.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08280 801755 801540 gene locus_tag LOCUS_08290 801755 801540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 801824 802138 gene locus_tag LOCUS_08300 801824 802138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 802398 802222 gene locus_tag LOCUS_08310 802398 802222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 802375 802692 gene locus_tag LOCUS_08320 802375 802692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 802789 803043 gene locus_tag LOCUS_08330 802789 803043 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980311.1 protein_id gnl|my_center|LOCUS_08330 803164 803024 gene locus_tag LOCUS_08340 803164 803024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 803359 804204 gene locus_tag LOCUS_08350 803359 804204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978140.1 protein_id gnl|my_center|LOCUS_08350 804955 804176 gene locus_tag LOCUS_08360 804955 804176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846206.1 protein_id gnl|my_center|LOCUS_08360 805187 804903 gene locus_tag LOCUS_08370 805187 804903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 807423 805648 gene locus_tag LOCUS_08380 gene cedB 807423 805648 CDS product DNA import protein CedB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978136.1 protein_id gnl|my_center|LOCUS_08380 808547 807453 gene locus_tag LOCUS_08390 gene truD 808547 807453 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156004996.1 protein_id gnl|my_center|LOCUS_08390 808894 808556 gene locus_tag LOCUS_08400 gene pth2 808894 808556 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_08400 808961 809161 gene locus_tag LOCUS_08410 808961 809161 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978150.1 protein_id gnl|my_center|LOCUS_08410 809162 809446 gene locus_tag LOCUS_08420 809162 809446 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978151.1 protein_id gnl|my_center|LOCUS_08420 809876 809448 gene locus_tag LOCUS_08430 809876 809448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978135.1 protein_id gnl|my_center|LOCUS_08430 809925 810971 gene locus_tag LOCUS_08440 gene argC 809925 810971 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978134.1 protein_id gnl|my_center|LOCUS_08440 810971 811759 gene locus_tag LOCUS_08450 810971 811759 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_08450 811756 812178 gene locus_tag LOCUS_08460 gene lysM 811756 812178 CDS product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 protein_id gnl|my_center|LOCUS_08460 812301 812435 gene locus_tag LOCUS_08470 gene lysW/argW 812301 812435 CDS product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_08470 812432 813295 gene locus_tag LOCUS_08480 gene lysX 812432 813295 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978130.1 protein_id gnl|my_center|LOCUS_08480 813292 814449 gene locus_tag LOCUS_08490 813292 814449 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978129.1 protein_id gnl|my_center|LOCUS_08490 814388 815431 gene locus_tag LOCUS_08500 814388 815431 CDS product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978128.1 protein_id gnl|my_center|LOCUS_08500 815419 816201 gene locus_tag LOCUS_08510 gene uppS 815419 816201 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978127.1 protein_id gnl|my_center|LOCUS_08510 817490 816198 gene locus_tag LOCUS_08520 gene aspS 817490 816198 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978146.1 protein_id gnl|my_center|LOCUS_08520 817891 817487 gene locus_tag LOCUS_08530 817891 817487 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978145.1 protein_id gnl|my_center|LOCUS_08530 818026 818232 gene locus_tag LOCUS_08540 818026 818232 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978144.1 protein_id gnl|my_center|LOCUS_08540 818787 818233 gene locus_tag LOCUS_08550 818787 818233 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846214.1 protein_id gnl|my_center|LOCUS_08550 819250 819325 gene locus_tag LOCUS_t00150 819250 819325 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 820764 820126 gene locus_tag LOCUS_08560 820764 820126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 820888 821844 gene locus_tag LOCUS_08570 820888 821844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08570 821856 822146 gene locus_tag LOCUS_08580 821856 822146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08580 823570 823657 gene locus_tag LOCUS_t00160 823570 823657 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 823952 823638 gene locus_tag LOCUS_08590 823952 823638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 825133 824708 gene locus_tag LOCUS_08600 825133 824708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08600 826855 825317 gene locus_tag LOCUS_08610 826855 825317 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846212.1 protein_id gnl|my_center|LOCUS_08610 827570 827046 gene locus_tag LOCUS_08620 gene dcd 827570 827046 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846226.1 protein_id gnl|my_center|LOCUS_08620 827746 829605 gene locus_tag LOCUS_08630 827746 829605 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978175.1 protein_id gnl|my_center|LOCUS_08630 830809 829595 gene locus_tag LOCUS_08640 830809 829595 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978176.1 protein_id gnl|my_center|LOCUS_08640 831116 830841 gene locus_tag LOCUS_08650 831116 830841 CDS product U6 snRNA-associated Sm-like protein LSm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846864.1 protein_id gnl|my_center|LOCUS_08650 832744 832469 gene locus_tag LOCUS_08660 832744 832469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08660 833085 832798 gene locus_tag LOCUS_08670 833085 832798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08670 833402 833199 gene locus_tag LOCUS_08680 833402 833199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 833371 833679 gene locus_tag LOCUS_08690 833371 833679 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978179.1 protein_id gnl|my_center|LOCUS_08690 835623 833989 gene locus_tag LOCUS_08700 835623 833989 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978180.1 protein_id gnl|my_center|LOCUS_08700 837051 836389 gene locus_tag LOCUS_08710 837051 836389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846227.1 protein_id gnl|my_center|LOCUS_08710 838190 837501 gene locus_tag LOCUS_08720 838190 837501 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978168.1 protein_id gnl|my_center|LOCUS_08720 838910 838254 gene locus_tag LOCUS_08730 838910 838254 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978169.1 protein_id gnl|my_center|LOCUS_08730 839589 839344 gene locus_tag LOCUS_08740 839589 839344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 839623 841350 gene locus_tag LOCUS_08750 gene rqcH 839623 841350 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650963.1 protein_id gnl|my_center|LOCUS_08750 841888 841316 gene locus_tag LOCUS_08760 gene tmk 841888 841316 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978438.1 protein_id gnl|my_center|LOCUS_08760 843331 841943 gene locus_tag LOCUS_08770 843331 841943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 843814 843620 gene locus_tag LOCUS_08780 843814 843620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 844366 844290 gene locus_tag LOCUS_t00170 844366 844290 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 844518 845402 gene locus_tag LOCUS_08790 844518 845402 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846190.1 protein_id gnl|my_center|LOCUS_08790 845448 845591 gene locus_tag LOCUS_08800 845448 845591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 845615 845893 gene locus_tag LOCUS_08810 845615 845893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 847010 845859 gene locus_tag LOCUS_08820 847010 845859 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_08820 847181 847375 gene locus_tag LOCUS_08830 847181 847375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 847610 847359 gene locus_tag LOCUS_08840 847610 847359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 847843 847571 gene locus_tag LOCUS_08850 847843 847571 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_08850 847906 848241 gene locus_tag LOCUS_08860 847906 848241 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978437.1 protein_id gnl|my_center|LOCUS_08860 848274 849092 gene locus_tag LOCUS_08870 848274 849092 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979166.1 protein_id gnl|my_center|LOCUS_08870 850067 851419 gene locus_tag LOCUS_08880 gene glmM 850067 851419 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978186.1 protein_id gnl|my_center|LOCUS_08880 851416 851817 gene locus_tag LOCUS_08890 851416 851817 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978185.1 protein_id gnl|my_center|LOCUS_08890 851865 852278 gene locus_tag LOCUS_08900 851865 852278 CDS product DUF2153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846228.1 protein_id gnl|my_center|LOCUS_08900 852605 852520 gene locus_tag LOCUS_t00180 852605 852520 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 853241 852765 gene locus_tag LOCUS_08910 853241 852765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 853934 853260 gene locus_tag LOCUS_08920 gene hxlA 853934 853260 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978182.1 protein_id gnl|my_center|LOCUS_08920 854131 855924 gene locus_tag LOCUS_08930 854131 855924 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978165.1 protein_id gnl|my_center|LOCUS_08930 856086 856922 gene locus_tag LOCUS_08940 856086 856922 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978164.1 protein_id gnl|my_center|LOCUS_08940 858027 856924 gene locus_tag LOCUS_08950 858027 856924 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978163.1 protein_id gnl|my_center|LOCUS_08950 859415 858024 gene locus_tag LOCUS_08960 859415 858024 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978162.1 protein_id gnl|my_center|LOCUS_08960 861030 859432 gene locus_tag LOCUS_08970 861030 859432 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846222.1 protein_id gnl|my_center|LOCUS_08970 861297 861037 gene locus_tag LOCUS_08980 861297 861037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 861947 861282 gene locus_tag LOCUS_08990 861947 861282 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978159.1 protein_id gnl|my_center|LOCUS_08990 862803 861922 gene locus_tag LOCUS_09000 gene hemC 862803 861922 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978158.1 protein_id gnl|my_center|LOCUS_09000 864049 862796 gene locus_tag LOCUS_09010 gene hemL 864049 862796 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846220.1 protein_id gnl|my_center|LOCUS_09010 864990 864046 gene locus_tag LOCUS_09020 gene hemB 864990 864046 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978156.1 protein_id gnl|my_center|LOCUS_09020 866251 865010 gene locus_tag LOCUS_09030 866251 865010 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978155.1 protein_id gnl|my_center|LOCUS_09030 866894 866241 gene locus_tag LOCUS_09040 866894 866241 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846218.1 protein_id gnl|my_center|LOCUS_09040 867939 866944 gene locus_tag LOCUS_09050 gene fen 867939 866944 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742611.1 protein_id gnl|my_center|LOCUS_09050 868226 867996 gene locus_tag LOCUS_09060 868226 867996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846216.1 protein_id gnl|my_center|LOCUS_09060 869883 868231 gene locus_tag LOCUS_09070 869883 868231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09070 870461 869880 gene locus_tag LOCUS_09080 870461 869880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09080 871169 870531 gene locus_tag LOCUS_09090 gene cdvB1/B2 871169 870531 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_09090 871803 871276 gene locus_tag LOCUS_09100 871803 871276 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023634.1 protein_id gnl|my_center|LOCUS_09100 871958 871800 gene locus_tag LOCUS_09110 871958 871800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 872011 872352 gene locus_tag LOCUS_09120 872011 872352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 875808 872853 gene locus_tag LOCUS_r00010 875808 872853 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 877482 876000 gene locus_tag LOCUS_r00020 877482 876000 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 878282 877731 gene locus_tag LOCUS_09130 878282 877731 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980260.1 protein_id gnl|my_center|LOCUS_09130 879155 878283 gene locus_tag LOCUS_09140 879155 878283 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847023.1 protein_id gnl|my_center|LOCUS_09140 879243 880061 gene locus_tag LOCUS_09150 879243 880061 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979438.1 protein_id gnl|my_center|LOCUS_09150 881071 880097 gene locus_tag LOCUS_09160 881071 880097 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846559.1 protein_id gnl|my_center|LOCUS_09160 881570 881064 gene locus_tag LOCUS_09170 881570 881064 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846961.1 protein_id gnl|my_center|LOCUS_09170 882612 881605 gene locus_tag LOCUS_09180 882612 881605 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979435.1 protein_id gnl|my_center|LOCUS_09180 883463 882591 gene locus_tag LOCUS_09190 883463 882591 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846558.1 protein_id gnl|my_center|LOCUS_09190 883967 884365 gene locus_tag LOCUS_09200 gene trxA 883967 884365 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846557.1 protein_id gnl|my_center|LOCUS_09200 884372 884974 gene locus_tag LOCUS_09210 884372 884974 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980108.1 protein_id gnl|my_center|LOCUS_09210 885099 885467 gene locus_tag LOCUS_09220 885099 885467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09220 885425 886513 gene locus_tag LOCUS_09230 gene glnA 885425 886513 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09230 887401 886502 gene locus_tag LOCUS_09240 887401 886502 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979430.1 protein_id gnl|my_center|LOCUS_09240 888070 887423 gene locus_tag LOCUS_09250 888070 887423 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846960.1 protein_id gnl|my_center|LOCUS_09250 889224 888244 gene locus_tag LOCUS_09260 889224 888244 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979428.1 protein_id gnl|my_center|LOCUS_09260 890116 889211 gene locus_tag LOCUS_09270 gene moaA 890116 889211 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979427.1 protein_id gnl|my_center|LOCUS_09270 890266 890445 gene locus_tag LOCUS_09280 890266 890445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 891113 890442 gene locus_tag LOCUS_09290 891113 890442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979426.1 protein_id gnl|my_center|LOCUS_09290 892381 891485 gene locus_tag LOCUS_09300 892381 891485 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846959.1 protein_id gnl|my_center|LOCUS_09300 892679 892446 gene locus_tag LOCUS_09310 892679 892446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 893077 892676 gene locus_tag LOCUS_09320 893077 892676 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979423.1 protein_id gnl|my_center|LOCUS_09320 893165 893788 gene locus_tag LOCUS_09330 893165 893788 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_09330 893801 894784 gene locus_tag LOCUS_09340 893801 894784 CDS product DUF711 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979422.1 protein_id gnl|my_center|LOCUS_09340 894847 895890 gene locus_tag LOCUS_09350 894847 895890 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846958.1 protein_id gnl|my_center|LOCUS_09350 897049 895883 gene locus_tag LOCUS_09360 897049 895883 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979420.1 protein_id gnl|my_center|LOCUS_09360 897124 897588 gene locus_tag LOCUS_09370 897124 897588 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979419.1 protein_id gnl|my_center|LOCUS_09370 897594 897938 gene locus_tag LOCUS_09380 897594 897938 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014597.1 protein_id gnl|my_center|LOCUS_09380 897935 898090 gene locus_tag LOCUS_09390 897935 898090 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877221.1 protein_id gnl|my_center|LOCUS_09390 898095 898364 gene locus_tag LOCUS_09400 898095 898364 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979416.1 protein_id gnl|my_center|LOCUS_09400 898361 899029 gene locus_tag LOCUS_09410 898361 899029 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979414.1 protein_id gnl|my_center|LOCUS_09410 899032 899286 gene locus_tag LOCUS_09420 gene rpl18a 899032 899286 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846956.1 protein_id gnl|my_center|LOCUS_09420 899297 899749 gene locus_tag LOCUS_09430 899297 899749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 900002 900775 gene locus_tag LOCUS_09440 900002 900775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 900807 900986 gene locus_tag LOCUS_09450 900807 900986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 900990 901442 gene locus_tag LOCUS_09460 900990 901442 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979409.1 protein_id gnl|my_center|LOCUS_09460 901449 901955 gene locus_tag LOCUS_09470 901449 901955 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979408.1 protein_id gnl|my_center|LOCUS_09470 901959 902609 gene locus_tag LOCUS_09480 901959 902609 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846555.1 protein_id gnl|my_center|LOCUS_09480 902610 903596 gene locus_tag LOCUS_09490 902610 903596 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742658.1 protein_id gnl|my_center|LOCUS_09490 903640 903951 gene locus_tag LOCUS_09500 903640 903951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 903990 905576 gene locus_tag LOCUS_09510 903990 905576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09510 905471 906679 gene locus_tag LOCUS_09520 905471 906679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09520 907287 906676 gene locus_tag LOCUS_09530 907287 906676 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846192.1 protein_id gnl|my_center|LOCUS_09530 908063 907437 gene locus_tag LOCUS_09540 908063 907437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978117.1 protein_id gnl|my_center|LOCUS_09540 908191 909204 gene locus_tag LOCUS_09550 908191 909204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 909105 910706 gene locus_tag LOCUS_09560 909105 910706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 911313 910693 gene locus_tag LOCUS_09570 gene psmB 911313 910693 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978453.1 protein_id gnl|my_center|LOCUS_09570 912978 911962 gene locus_tag LOCUS_09580 912978 911962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09580 914015 913086 gene locus_tag LOCUS_09590 914015 913086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09590 914412 913999 gene locus_tag LOCUS_09600 914412 913999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 914553 915044 gene locus_tag LOCUS_09610 914553 915044 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978447.1 protein_id gnl|my_center|LOCUS_09610 915070 915606 gene locus_tag LOCUS_09620 915070 915606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 915615 916310 gene locus_tag LOCUS_09630 915615 916310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 916307 916552 gene locus_tag LOCUS_09640 916307 916552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149528472.1 protein_id gnl|my_center|LOCUS_09640 916758 917210 gene locus_tag LOCUS_09650 gene moaC 916758 917210 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 protein_id gnl|my_center|LOCUS_09650 918414 917188 gene locus_tag LOCUS_09660 918414 917188 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846342.1 protein_id gnl|my_center|LOCUS_09660 919391 918411 gene locus_tag LOCUS_09670 919391 918411 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978451.1 protein_id gnl|my_center|LOCUS_09670 919837 919388 gene locus_tag LOCUS_09680 919837 919388 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978452.1 protein_id gnl|my_center|LOCUS_09680 920099 919869 gene locus_tag LOCUS_09690 920099 919869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846339.1 protein_id gnl|my_center|LOCUS_09690 920462 920112 gene locus_tag LOCUS_09700 920462 920112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 920953 920456 gene locus_tag LOCUS_09710 920953 920456 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978442.1 protein_id gnl|my_center|LOCUS_09710 921511 920984 gene locus_tag LOCUS_09720 921511 920984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978440.1 protein_id gnl|my_center|LOCUS_09720 921590 922207 gene locus_tag LOCUS_09730 921590 922207 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978110.1 protein_id gnl|my_center|LOCUS_09730 922729 922499 gene locus_tag LOCUS_09740 922729 922499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 923632 922973 gene locus_tag LOCUS_09750 923632 922973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846712.1 protein_id gnl|my_center|LOCUS_09750 924788 923748 gene locus_tag LOCUS_09760 924788 923748 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980107.1 protein_id gnl|my_center|LOCUS_09760 925370 924807 gene locus_tag LOCUS_09770 925370 924807 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846443.1 protein_id gnl|my_center|LOCUS_09770 926470 925358 gene locus_tag LOCUS_09780 gene cca 926470 925358 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978948.1 protein_id gnl|my_center|LOCUS_09780 927117 926581 gene locus_tag LOCUS_09790 gene thpR 927117 926581 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267029.1 protein_id gnl|my_center|LOCUS_09790 927190 927525 gene locus_tag LOCUS_09800 927190 927525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09800 927522 927719 gene locus_tag LOCUS_09810 927522 927719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 927688 928116 gene locus_tag LOCUS_09820 927688 928116 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978945.1 protein_id gnl|my_center|LOCUS_09820 928981 928106 gene locus_tag LOCUS_09830 gene rnz 928981 928106 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978944.1 protein_id gnl|my_center|LOCUS_09830 929901 928978 gene locus_tag LOCUS_09840 929901 928978 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978943.1 protein_id gnl|my_center|LOCUS_09840 930764 929898 gene locus_tag LOCUS_09850 930764 929898 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_09850 930817 931671 gene locus_tag LOCUS_09860 930817 931671 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_09860 931613 932350 gene locus_tag LOCUS_09870 931613 932350 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762421.1 protein_id gnl|my_center|LOCUS_09870 932496 933230 gene locus_tag LOCUS_09880 gene priS 932496 933230 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978939.1 protein_id gnl|my_center|LOCUS_09880 933211 933663 gene locus_tag LOCUS_09890 933211 933663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 933684 933953 gene locus_tag LOCUS_09900 933684 933953 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_09900 934151 934927 gene locus_tag LOCUS_09910 934151 934927 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978935.1 protein_id gnl|my_center|LOCUS_09910 937667 935442 gene locus_tag LOCUS_09920 937667 935442 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978933.1 protein_id gnl|my_center|LOCUS_09920 937949 938455 gene locus_tag LOCUS_09930 937949 938455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 938388 938999 gene locus_tag LOCUS_09940 938388 938999 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979239.1 protein_id gnl|my_center|LOCUS_09940 940351 940275 gene locus_tag LOCUS_t00190 940351 940275 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 940431 940357 gene locus_tag LOCUS_t00200 940431 940357 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 940499 941245 gene locus_tag LOCUS_09950 940499 941245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168147.1 protein_id gnl|my_center|LOCUS_09950 941906 943132 gene locus_tag LOCUS_09960 941906 943132 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979397.1 protein_id gnl|my_center|LOCUS_09960 943129 944133 gene locus_tag LOCUS_09970 943129 944133 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979396.1 protein_id gnl|my_center|LOCUS_09970 944133 944531 gene locus_tag LOCUS_09980 944133 944531 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979395.1 protein_id gnl|my_center|LOCUS_09980 946401 945220 gene locus_tag LOCUS_09990 946401 945220 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650945.1 protein_id gnl|my_center|LOCUS_09990 946533 946853 gene locus_tag LOCUS_10000 946533 946853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 946994 947281 gene locus_tag LOCUS_10010 946994 947281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 948420 947719 gene locus_tag LOCUS_10020 948420 947719 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846944.1 protein_id gnl|my_center|LOCUS_10020 949667 948423 gene locus_tag LOCUS_10030 949667 948423 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_10030 949709 949891 gene locus_tag LOCUS_10040 949709 949891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 949815 951248 gene locus_tag LOCUS_10050 gene gatD 949815 951248 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979283.1 protein_id gnl|my_center|LOCUS_10050 951238 953130 gene locus_tag LOCUS_10060 gene gatE 951238 953130 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979281.1 protein_id gnl|my_center|LOCUS_10060 953224 954252 gene locus_tag LOCUS_10070 953224 954252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979280.1 protein_id gnl|my_center|LOCUS_10070 954614 954249 gene locus_tag LOCUS_10080 954614 954249 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846519.1 protein_id gnl|my_center|LOCUS_10080 957145 954686 gene locus_tag LOCUS_10090 957145 954686 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979278.1 protein_id gnl|my_center|LOCUS_10090 958669 957284 gene locus_tag LOCUS_10100 gene gatA 958669 957284 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846522.1 protein_id gnl|my_center|LOCUS_10100 958968 958675 gene locus_tag LOCUS_10110 gene gatC 958968 958675 CDS product Asp-tRNA(Asn) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979304.1 protein_id gnl|my_center|LOCUS_10110 959387 959019 gene locus_tag LOCUS_10120 959387 959019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 959465 960220 gene locus_tag LOCUS_10130 959465 960220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979269.1 protein_id gnl|my_center|LOCUS_10130 960453 960378 gene locus_tag LOCUS_t00210 960453 960378 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 962332 960467 gene locus_tag LOCUS_10140 962332 960467 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979277.1 protein_id gnl|my_center|LOCUS_10140 962372 962593 gene locus_tag LOCUS_10150 962372 962593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 963231 962944 gene locus_tag LOCUS_10160 963231 962944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979274.1 protein_id gnl|my_center|LOCUS_10160 963456 963764 gene locus_tag LOCUS_10170 963456 963764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846518.1 protein_id gnl|my_center|LOCUS_10170 965353 963818 gene locus_tag LOCUS_10180 gene thsA 965353 963818 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846517.1 protein_id gnl|my_center|LOCUS_10180 965499 965344 gene locus_tag LOCUS_10190 965499 965344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10190 965718 966797 gene locus_tag LOCUS_10200 gene twy1 965718 966797 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979301.1 protein_id gnl|my_center|LOCUS_10200 966837 967460 gene locus_tag LOCUS_10210 966837 967460 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742652.1 protein_id gnl|my_center|LOCUS_10210 968106 967453 gene locus_tag LOCUS_10220 968106 967453 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979298.1 protein_id gnl|my_center|LOCUS_10220 968858 968070 gene locus_tag LOCUS_10230 gene dph5 968858 968070 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979297.1 protein_id gnl|my_center|LOCUS_10230 968898 969644 gene locus_tag LOCUS_10240 968898 969644 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979296.1 protein_id gnl|my_center|LOCUS_10240 970417 970860 gene locus_tag LOCUS_10250 970417 970860 CDS product IS607-like element ISSto11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742643.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 970898 972103 gene locus_tag LOCUS_10260 970898 972103 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979067.1 protein_id gnl|my_center|LOCUS_10260 972664 973257 gene locus_tag LOCUS_10270 972664 973257 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_10270 973899 973246 gene locus_tag LOCUS_10280 973899 973246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 974238 974432 gene locus_tag LOCUS_10290 974238 974432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 975866 974847 gene locus_tag LOCUS_10300 975866 974847 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011278149.1 protein_id gnl|my_center|LOCUS_10300 977253 975910 gene locus_tag LOCUS_10310 977253 975910 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979319.1 protein_id gnl|my_center|LOCUS_10310 977680 977255 gene locus_tag LOCUS_10320 977680 977255 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979318.1 protein_id gnl|my_center|LOCUS_10320 979149 977980 gene locus_tag LOCUS_10330 979149 977980 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979317.1 protein_id gnl|my_center|LOCUS_10330 980738 979146 gene locus_tag LOCUS_10340 980738 979146 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 protein_id gnl|my_center|LOCUS_10340 981712 980777 gene locus_tag LOCUS_10350 981712 980777 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_10350 983079 981709 gene locus_tag LOCUS_10360 983079 981709 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979314.1 protein_id gnl|my_center|LOCUS_10360 983598 983362 gene locus_tag LOCUS_10370 983598 983362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846524.1 protein_id gnl|my_center|LOCUS_10370 983685 986441 gene locus_tag LOCUS_10380 983685 986441 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979313.1 protein_id gnl|my_center|LOCUS_10380 986498 986821 gene locus_tag LOCUS_10390 986498 986821 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979312.1 protein_id gnl|my_center|LOCUS_10390 990166 986804 gene locus_tag LOCUS_10400 gene rgy 990166 986804 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979311.1 protein_id gnl|my_center|LOCUS_10400 990733 991134 gene locus_tag LOCUS_10410 990733 991134 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979287.1 protein_id gnl|my_center|LOCUS_10410 991144 992046 gene locus_tag LOCUS_10420 991144 992046 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429766.1 protein_id gnl|my_center|LOCUS_10420 992027 993148 gene locus_tag LOCUS_10430 992027 993148 CDS product tRNA (guanine(26)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979289.1 protein_id gnl|my_center|LOCUS_10430 993504 993139 gene locus_tag LOCUS_10440 993504 993139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979290.1 protein_id gnl|my_center|LOCUS_10440 993710 993844 gene locus_tag LOCUS_10450 993710 993844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 993901 994623 gene locus_tag LOCUS_10460 993901 994623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979293.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10460 994613 995668 gene locus_tag LOCUS_10470 994613 995668 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846947.1 protein_id gnl|my_center|LOCUS_10470 995820 996071 gene locus_tag LOCUS_10480 995820 996071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 996064 996975 gene locus_tag LOCUS_10490 996064 996975 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846945.1 protein_id gnl|my_center|LOCUS_10490 997068 997364 gene locus_tag LOCUS_10500 gene albA 997068 997364 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979310.1 protein_id gnl|my_center|LOCUS_10500 997443 997766 gene locus_tag LOCUS_10510 997443 997766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979309.1 protein_id gnl|my_center|LOCUS_10510 998019 997738 gene locus_tag LOCUS_10520 998019 997738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 998907 999347 gene locus_tag LOCUS_10530 998907 999347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1000600 999323 gene locus_tag LOCUS_10540 1000600 999323 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978684.1 protein_id gnl|my_center|LOCUS_10540 1001467 1001382 gene locus_tag LOCUS_t00220 1001467 1001382 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1002010 1002180 gene locus_tag LOCUS_10550 1002010 1002180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1004672 1002333 gene locus_tag LOCUS_10560 gene ppsA 1004672 1002333 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846514.1 protein_id gnl|my_center|LOCUS_10560 1005414 1004755 gene locus_tag LOCUS_10570 gene cdvB1/B2 1005414 1004755 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_10570 1005505 1005786 gene locus_tag LOCUS_10580 1005505 1005786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1007220 1005775 gene locus_tag LOCUS_10590 1007220 1005775 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846942.1 protein_id gnl|my_center|LOCUS_10590 1007483 1008490 gene locus_tag LOCUS_10600 gene thrC 1007483 1008490 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979259.1 protein_id gnl|my_center|LOCUS_10600 1008468 1009805 gene locus_tag LOCUS_10610 1008468 1009805 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979260.1 protein_id gnl|my_center|LOCUS_10610 1009798 1010442 gene locus_tag LOCUS_10620 1009798 1010442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10620 1010436 1010843 gene locus_tag LOCUS_10630 1010436 1010843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10630 1010846 1011508 gene locus_tag LOCUS_10640 1010846 1011508 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979262.1 protein_id gnl|my_center|LOCUS_10640 1011471 1012700 gene locus_tag LOCUS_10650 1011471 1012700 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846515.1 protein_id gnl|my_center|LOCUS_10650 1013475 1012690 gene locus_tag LOCUS_10660 gene argF 1013475 1012690 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979264.1 protein_id gnl|my_center|LOCUS_10660 1013527 1014255 gene locus_tag LOCUS_10670 1013527 1014255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979265.1 protein_id gnl|my_center|LOCUS_10670 1014252 1015316 gene locus_tag LOCUS_10680 1014252 1015316 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979266.1 protein_id gnl|my_center|LOCUS_10680 1015404 1016171 gene locus_tag LOCUS_10690 1015404 1016171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1016608 1017309 gene locus_tag LOCUS_10700 1016608 1017309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846943.1 protein_id gnl|my_center|LOCUS_10700 1017548 1017826 gene locus_tag LOCUS_10710 1017548 1017826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846516.1 protein_id gnl|my_center|LOCUS_10710 1017823 1018509 gene locus_tag LOCUS_10720 1017823 1018509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979270.1 protein_id gnl|my_center|LOCUS_10720 1019363 1018518 gene locus_tag LOCUS_10730 1019363 1018518 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545553.1 protein_id gnl|my_center|LOCUS_10730 1019684 1020352 gene locus_tag LOCUS_10740 1019684 1020352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1021642 1021154 gene locus_tag LOCUS_10750 1021642 1021154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1022663 1022349 gene locus_tag LOCUS_10760 gene zfx1 1022663 1022349 CDS product zinc-containing ferredoxin Zfx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978102.1 protein_id gnl|my_center|LOCUS_10760 1022787 1023284 gene locus_tag LOCUS_10770 1022787 1023284 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978103.1 protein_id gnl|my_center|LOCUS_10770 1023327 1024241 gene locus_tag LOCUS_10780 1023327 1024241 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978104.1 protein_id gnl|my_center|LOCUS_10780 1025298 1024222 gene locus_tag LOCUS_10790 1025298 1024222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1025993 1025295 gene locus_tag LOCUS_10800 gene alaXM 1025993 1025295 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 protein_id gnl|my_center|LOCUS_10800 1026263 1026000 gene locus_tag LOCUS_10810 1026263 1026000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846186.1 protein_id gnl|my_center|LOCUS_10810 1026391 1027716 gene locus_tag LOCUS_10820 1026391 1027716 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979128.1 protein_id gnl|my_center|LOCUS_10820 1027728 1028723 gene locus_tag LOCUS_10830 1027728 1028723 CDS product acryloyl-coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978456.1 protein_id gnl|my_center|LOCUS_10830 1028972 1030012 gene locus_tag LOCUS_10840 gene prf1 1028972 1030012 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742617.1 protein_id gnl|my_center|LOCUS_10840 1031234 1030131 gene locus_tag LOCUS_10850 1031234 1030131 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978089.1 protein_id gnl|my_center|LOCUS_10850 1032646 1031963 gene locus_tag LOCUS_10860 1032646 1031963 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846345.1 protein_id gnl|my_center|LOCUS_10860 1033939 1032863 gene locus_tag LOCUS_10870 1033939 1032863 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979254.1 protein_id gnl|my_center|LOCUS_10870 1034001 1034312 gene locus_tag LOCUS_10880 1034001 1034312 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979253.1 protein_id gnl|my_center|LOCUS_10880 1034350 1035657 gene locus_tag LOCUS_10890 1034350 1035657 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979252.1 protein_id gnl|my_center|LOCUS_10890 1035654 1036382 gene locus_tag LOCUS_10900 gene trpA 1035654 1036382 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979251.1 protein_id gnl|my_center|LOCUS_10900 1036372 1037412 gene locus_tag LOCUS_10910 gene trpD 1036372 1037412 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979250.1 protein_id gnl|my_center|LOCUS_10910 1037399 1037983 gene locus_tag LOCUS_10920 1037399 1037983 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846512.1 protein_id gnl|my_center|LOCUS_10920 1037980 1039278 gene locus_tag LOCUS_10930 1037980 1039278 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979248.1 protein_id gnl|my_center|LOCUS_10930 1039281 1039859 gene locus_tag LOCUS_10940 1039281 1039859 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979247.1 protein_id gnl|my_center|LOCUS_10940 1039901 1040614 gene locus_tag LOCUS_10950 gene trpC 1039901 1040614 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979246.1 protein_id gnl|my_center|LOCUS_10950 1040630 1041829 gene locus_tag LOCUS_10960 1040630 1041829 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979245.1 protein_id gnl|my_center|LOCUS_10960 1043600 1041885 gene locus_tag LOCUS_10970 1043600 1041885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 1044280 1043636 gene locus_tag LOCUS_10980 1044280 1043636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10980 1045240 1044650 gene locus_tag LOCUS_10990 1045240 1044650 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_10990 1046090 1046308 gene locus_tag LOCUS_11000 1046090 1046308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846510.1 protein_id gnl|my_center|LOCUS_11000 1046618 1046938 gene locus_tag LOCUS_11010 1046618 1046938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1047206 1046895 gene locus_tag LOCUS_11020 1047206 1046895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1047579 1047199 gene locus_tag LOCUS_11030 1047579 1047199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979242.1 protein_id gnl|my_center|LOCUS_11030 1048528 1047548 gene locus_tag LOCUS_11040 1048528 1047548 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979243.1 protein_id gnl|my_center|LOCUS_11040 1050087 1049350 gene locus_tag LOCUS_11050 gene sufC 1050087 1049350 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846505.1 protein_id gnl|my_center|LOCUS_11050 1051039 1050104 gene locus_tag LOCUS_11060 1051039 1050104 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846506.1 protein_id gnl|my_center|LOCUS_11060 1051543 1051169 gene locus_tag LOCUS_11070 1051543 1051169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1052293 1051550 gene locus_tag LOCUS_11080 1052293 1051550 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979223.1 protein_id gnl|my_center|LOCUS_11080 1052678 1052286 gene locus_tag LOCUS_11090 gene gcvH 1052678 1052286 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846941.1 protein_id gnl|my_center|LOCUS_11090 1053687 1052683 gene locus_tag LOCUS_11100 gene gcvT 1053687 1052683 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979225.1 protein_id gnl|my_center|LOCUS_11100 1053763 1055109 gene locus_tag LOCUS_11110 gene gcvPA 1053763 1055109 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979226.1 protein_id gnl|my_center|LOCUS_11110 1055110 1056615 gene locus_tag LOCUS_11120 gene gcvPB 1055110 1056615 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979227.1 protein_id gnl|my_center|LOCUS_11120 1057058 1056630 gene locus_tag LOCUS_11130 1057058 1056630 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979228.1 protein_id gnl|my_center|LOCUS_11130 1057362 1057036 gene locus_tag LOCUS_11140 1057362 1057036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979229.1 protein_id gnl|my_center|LOCUS_11140 1057665 1057375 gene locus_tag LOCUS_11150 1057665 1057375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1057704 1058396 gene locus_tag LOCUS_11160 1057704 1058396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11160 1058351 1058971 gene locus_tag LOCUS_11170 1058351 1058971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 1059219 1058968 gene locus_tag LOCUS_11180 1059219 1058968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1059391 1060101 gene locus_tag LOCUS_11190 gene cdvA 1059391 1060101 CDS product cell division protein CdvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979232.1 protein_id gnl|my_center|LOCUS_11190 1060111 1060881 gene locus_tag LOCUS_11200 gene cdvB 1060111 1060881 CDS product cell division protein CdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979233.1 protein_id gnl|my_center|LOCUS_11200 1060894 1062000 gene locus_tag LOCUS_11210 gene cdvC 1060894 1062000 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_11210 1062378 1062103 gene locus_tag LOCUS_11220 1062378 1062103 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846508.1 protein_id gnl|my_center|LOCUS_11220 1063524 1062409 gene locus_tag LOCUS_11230 1063524 1062409 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979237.1 protein_id gnl|my_center|LOCUS_11230 1064486 1063521 gene locus_tag LOCUS_11240 1064486 1063521 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979238.1 protein_id gnl|my_center|LOCUS_11240 1066476 1065847 gene locus_tag LOCUS_11250 1066476 1065847 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979662.1 protein_id gnl|my_center|LOCUS_11250 1066620 1068059 gene locus_tag LOCUS_11260 gene sufB 1066620 1068059 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979219.1 protein_id gnl|my_center|LOCUS_11260 1068072 1069208 gene locus_tag LOCUS_11270 1068072 1069208 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979218.1 protein_id gnl|my_center|LOCUS_11270 1069360 1069581 gene locus_tag LOCUS_11280 1069360 1069581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1069873 1071033 gene locus_tag LOCUS_11290 1069873 1071033 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_11290 1071427 1071567 gene locus_tag LOCUS_11300 1071427 1071567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1071643 1072194 gene locus_tag LOCUS_11310 1071643 1072194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1072211 1072474 gene locus_tag LOCUS_11320 1072211 1072474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1072471 1072890 gene locus_tag LOCUS_11330 1072471 1072890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1073766 1073527 gene locus_tag LOCUS_11340 1073766 1073527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1074013 1073714 gene locus_tag LOCUS_11350 1074013 1073714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1074507 1074419 gene locus_tag LOCUS_t00230 1074507 1074419 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1075251 1075493 gene locus_tag LOCUS_11360 1075251 1075493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846110.1 protein_id gnl|my_center|LOCUS_11360 1075490 1075897 gene locus_tag LOCUS_11370 1075490 1075897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1076604 1076377 gene locus_tag LOCUS_11380 1076604 1076377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1077289 1077516 gene locus_tag LOCUS_11390 1077289 1077516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11390 1077504 1077689 gene locus_tag LOCUS_11400 1077504 1077689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11400 1077830 1078876 gene locus_tag LOCUS_11410 1077830 1078876 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979390.1 protein_id gnl|my_center|LOCUS_11410 1078873 1079994 gene locus_tag LOCUS_11420 1078873 1079994 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979391.1 protein_id gnl|my_center|LOCUS_11420 1079995 1080402 gene locus_tag LOCUS_11430 1079995 1080402 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868486.1 protein_id gnl|my_center|LOCUS_11430 1080392 1081624 gene locus_tag LOCUS_11440 gene hmgA 1080392 1081624 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979393.1 protein_id gnl|my_center|LOCUS_11440 1081655 1082944 gene locus_tag LOCUS_11450 1081655 1082944 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979394.1 protein_id gnl|my_center|LOCUS_11450 1084152 1084075 gene locus_tag LOCUS_t00240 1084152 1084075 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1084235 1084570 gene locus_tag LOCUS_11460 1084235 1084570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1084587 1085396 gene locus_tag LOCUS_11470 1084587 1085396 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846458.1 protein_id gnl|my_center|LOCUS_11470 1085454 1086143 gene locus_tag LOCUS_11480 1085454 1086143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978899.1 protein_id gnl|my_center|LOCUS_11480 1086140 1087855 gene locus_tag LOCUS_11490 1086140 1087855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11490 1088140 1088754 gene locus_tag LOCUS_11500 1088140 1088754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1088760 1089938 gene locus_tag LOCUS_11510 1088760 1089938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978901.1 protein_id gnl|my_center|LOCUS_11510 1091292 1090312 gene locus_tag LOCUS_11520 1091292 1090312 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978014.1 protein_id gnl|my_center|LOCUS_11520 1094537 1091415 gene locus_tag LOCUS_11530 1094537 1091415 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979182.1 protein_id gnl|my_center|LOCUS_11530 1096228 1094573 gene locus_tag LOCUS_11540 1096228 1094573 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978028.1 protein_id gnl|my_center|LOCUS_11540 1096762 1096325 gene locus_tag LOCUS_11550 1096762 1096325 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978024.1 protein_id gnl|my_center|LOCUS_11550 1098053 1097172 gene locus_tag LOCUS_11560 1098053 1097172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11560 1098259 1098023 gene locus_tag LOCUS_11570 1098259 1098023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1098339 1098896 gene locus_tag LOCUS_11580 1098339 1098896 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978556.1 protein_id gnl|my_center|LOCUS_11580 1100769 1099417 gene locus_tag LOCUS_11590 1100769 1099417 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978554.1 protein_id gnl|my_center|LOCUS_11590 1100895 1101743 gene locus_tag LOCUS_11600 1100895 1101743 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978553.1 protein_id gnl|my_center|LOCUS_11600 1101740 1102804 gene locus_tag LOCUS_11610 1101740 1102804 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846370.1 protein_id gnl|my_center|LOCUS_11610 1103161 1102772 gene locus_tag LOCUS_11620 1103161 1102772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1105166 1103361 gene locus_tag LOCUS_11630 1105166 1103361 CDS product protease pro-enzyme activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980700.1 protein_id gnl|my_center|LOCUS_11630 1105834 1106943 gene locus_tag LOCUS_11640 1105834 1106943 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978545.1 protein_id gnl|my_center|LOCUS_11640 1106950 1107744 gene locus_tag LOCUS_11650 1106950 1107744 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846368.1 protein_id gnl|my_center|LOCUS_11650 1107774 1108004 gene locus_tag LOCUS_11660 1107774 1108004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1108088 1109341 gene locus_tag LOCUS_11670 1108088 1109341 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846893.1 protein_id gnl|my_center|LOCUS_11670 1110668 1109331 gene locus_tag LOCUS_11680 1110668 1109331 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846777.1 protein_id gnl|my_center|LOCUS_11680 1110753 1111478 gene locus_tag LOCUS_11690 gene cobS 1110753 1111478 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980427.1 protein_id gnl|my_center|LOCUS_11690 1111442 1112365 gene locus_tag LOCUS_11700 1111442 1112365 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846776.1 protein_id gnl|my_center|LOCUS_11700 1113289 1112291 gene locus_tag LOCUS_11710 1113289 1112291 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_11710 1113380 1113967 gene locus_tag LOCUS_11720 1113380 1113967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1114082 1116226 gene locus_tag LOCUS_11730 gene cutA 1114082 1116226 CDS product glyceraldehyde dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980423.1 protein_id gnl|my_center|LOCUS_11730 1116223 1116696 gene locus_tag LOCUS_11740 1116223 1116696 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980422.1 protein_id gnl|my_center|LOCUS_11740 1117465 1118001 gene locus_tag LOCUS_11750 1117465 1118001 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978121.1 protein_id gnl|my_center|LOCUS_11750 1120687 1119086 gene locus_tag LOCUS_11760 1120687 1119086 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978016.1 protein_id gnl|my_center|LOCUS_11760 1120918 1121097 gene locus_tag LOCUS_11770 1120918 1121097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1121332 1121682 gene locus_tag LOCUS_11780 1121332 1121682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1122323 1121679 gene locus_tag LOCUS_11790 1122323 1121679 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980395.1 protein_id gnl|my_center|LOCUS_11790 1122353 1122994 gene locus_tag LOCUS_11800 1122353 1122994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015403.1 protein_id gnl|my_center|LOCUS_11800 1122999 1124147 gene locus_tag LOCUS_11810 gene purT 1122999 1124147 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846770.1 protein_id gnl|my_center|LOCUS_11810 1124343 1124164 gene locus_tag LOCUS_11820 1124343 1124164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11820 1124783 1124520 gene locus_tag LOCUS_11830 1124783 1124520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11830 1125105 1124863 gene locus_tag LOCUS_11840 1125105 1124863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11840 1126534 1125662 gene locus_tag LOCUS_11850 1126534 1125662 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978476.1 protein_id gnl|my_center|LOCUS_11850 1127487 1126531 gene locus_tag LOCUS_11860 1127487 1126531 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978475.1 protein_id gnl|my_center|LOCUS_11860 1129179 1127488 gene locus_tag LOCUS_11870 1129179 1127488 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978474.1 protein_id gnl|my_center|LOCUS_11870 1129646 1131319 gene locus_tag LOCUS_11880 1129646 1131319 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980101.1 protein_id gnl|my_center|LOCUS_11880 1132334 1131264 gene locus_tag LOCUS_11890 1132334 1131264 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846769.1 protein_id gnl|my_center|LOCUS_11890 1132387 1133505 gene locus_tag LOCUS_11900 1132387 1133505 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980390.1 protein_id gnl|my_center|LOCUS_11900 1133502 1134215 gene locus_tag LOCUS_11910 1133502 1134215 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846768.1 protein_id gnl|my_center|LOCUS_11910 1135018 1134218 gene locus_tag LOCUS_11920 1135018 1134218 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980286.1 protein_id gnl|my_center|LOCUS_11920 1135113 1135901 gene locus_tag LOCUS_11930 1135113 1135901 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980289.1 protein_id gnl|my_center|LOCUS_11930 1136254 1135925 gene locus_tag LOCUS_11940 1136254 1135925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1137416 1141423 gene locus_tag LOCUS_11950 1137416 1141423 CDS product protease pro-enzyme activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980576.1 protein_id gnl|my_center|LOCUS_11950 1142467 1141427 gene locus_tag LOCUS_11960 1142467 1141427 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980545.1 protein_id gnl|my_center|LOCUS_11960 1143115 1143375 gene locus_tag LOCUS_11970 1143115 1143375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11970 1145766 1144627 gene locus_tag LOCUS_11980 1145766 1144627 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980418.1 protein_id gnl|my_center|LOCUS_11980 1146704 1145739 gene locus_tag LOCUS_11990 1146704 1145739 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015424.1 protein_id gnl|my_center|LOCUS_11990 1146876 1147376 gene locus_tag LOCUS_12000 1146876 1147376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12000 1147370 1148050 gene locus_tag LOCUS_12010 1147370 1148050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12010 1148431 1148754 gene locus_tag LOCUS_12020 1148431 1148754 CDS product translation initiation factor aIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846355.1 protein_id gnl|my_center|LOCUS_12020 1148751 1149521 gene locus_tag LOCUS_12030 1148751 1149521 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846354.1 protein_id gnl|my_center|LOCUS_12030 1150830 1149511 gene locus_tag LOCUS_12040 1150830 1149511 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978976.1 protein_id gnl|my_center|LOCUS_12040 1151917 1150859 gene locus_tag LOCUS_12050 1151917 1150859 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980409.1 protein_id gnl|my_center|LOCUS_12050 1152087 1151905 gene locus_tag LOCUS_12060 1152087 1151905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1153253 1152708 gene locus_tag LOCUS_12070 gene cobA 1153253 1152708 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846366.1 protein_id gnl|my_center|LOCUS_12070 1154573 1154049 gene locus_tag LOCUS_12080 1154573 1154049 CDS product TRASH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979777.1 protein_id gnl|my_center|LOCUS_12080 1154865 1157105 gene locus_tag LOCUS_12090 1154865 1157105 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979775.1 protein_id gnl|my_center|LOCUS_12090 1157646 1157113 gene locus_tag LOCUS_12100 1157646 1157113 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980400.1 protein_id gnl|my_center|LOCUS_12100 1158245 1158087 gene locus_tag LOCUS_12110 1158245 1158087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1159063 1158200 gene locus_tag LOCUS_12120 1159063 1158200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980399.1 protein_id gnl|my_center|LOCUS_12120 1159599 1160855 gene locus_tag LOCUS_12130 1159599 1160855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980433.1 protein_id gnl|my_center|LOCUS_12130 1162168 1161086 gene locus_tag LOCUS_12140 1162168 1161086 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980429.1 protein_id gnl|my_center|LOCUS_12140 1163020 1162643 gene locus_tag LOCUS_12150 1163020 1162643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12150 1163748 1163014 gene locus_tag LOCUS_12160 1163748 1163014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12160 1165063 1164824 gene locus_tag LOCUS_12170 1165063 1164824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846367.1 protein_id gnl|my_center|LOCUS_12170 1165875 1165063 gene locus_tag LOCUS_12180 1165875 1165063 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978544.1 protein_id gnl|my_center|LOCUS_12180 1165917 1166375 gene locus_tag LOCUS_12190 1165917 1166375 CDS product RecB-family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978296.1 protein_id gnl|my_center|LOCUS_12190 1166823 1166647 gene locus_tag LOCUS_12200 1166823 1166647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1166849 1167655 gene locus_tag LOCUS_12210 1166849 1167655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1167648 1168199 gene locus_tag LOCUS_12220 1167648 1168199 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978531.1 protein_id gnl|my_center|LOCUS_12220 1169876 1168206 gene locus_tag LOCUS_12230 1169876 1168206 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846364.1 protein_id gnl|my_center|LOCUS_12230 1169973 1170347 gene locus_tag LOCUS_12240 gene mce 1169973 1170347 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_12240 1170951 1171130 gene locus_tag LOCUS_12250 1170951 1171130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1171197 1171718 gene locus_tag LOCUS_12260 1171197 1171718 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_12260 1172451 1172077 gene locus_tag LOCUS_12270 1172451 1172077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12270 1173572 1172448 gene locus_tag LOCUS_12280 1173572 1172448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12280 1173680 1174177 gene locus_tag LOCUS_12290 1173680 1174177 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978535.1 protein_id gnl|my_center|LOCUS_12290 1174174 1174740 gene locus_tag LOCUS_12300 1174174 1174740 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978539.1 protein_id gnl|my_center|LOCUS_12300 1175197 1174706 gene locus_tag LOCUS_12310 gene cutC 1175197 1174706 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_12310 1176033 1175194 gene locus_tag LOCUS_12320 gene cutB 1176033 1175194 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_12320 1176723 1176298 gene locus_tag LOCUS_12330 1176723 1176298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1178038 1176851 gene locus_tag LOCUS_12340 1178038 1176851 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980454.1 protein_id gnl|my_center|LOCUS_12340 1178487 1178059 gene locus_tag LOCUS_12350 1178487 1178059 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980455.1 protein_id gnl|my_center|LOCUS_12350 1178629 1179210 gene locus_tag LOCUS_12360 1178629 1179210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978488.1 protein_id gnl|my_center|LOCUS_12360 1179710 1179177 gene locus_tag LOCUS_12370 1179710 1179177 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978489.1 protein_id gnl|my_center|LOCUS_12370 1179832 1180821 gene locus_tag LOCUS_12380 1179832 1180821 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980398.1 protein_id gnl|my_center|LOCUS_12380 1180897 1182069 gene locus_tag LOCUS_12390 1180897 1182069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1182071 1182682 gene locus_tag LOCUS_12400 1182071 1182682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12400 1182679 1183197 gene locus_tag LOCUS_12410 1182679 1183197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1183199 1184860 gene locus_tag LOCUS_12420 1183199 1184860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1185011 1185754 gene locus_tag LOCUS_12430 gene fabG 1185011 1185754 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979123.1 protein_id gnl|my_center|LOCUS_12430 1186535 1186930 gene locus_tag LOCUS_12440 1186535 1186930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12440 1190171 1187943 gene locus_tag LOCUS_12450 gene cutA 1190171 1187943 CDS product glyceraldehyde dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979848.1 protein_id gnl|my_center|LOCUS_12450 1190662 1190168 gene locus_tag LOCUS_12460 gene cutC 1190662 1190168 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_12460 1191501 1190659 gene locus_tag LOCUS_12470 gene cutB 1191501 1190659 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979850.1 protein_id gnl|my_center|LOCUS_12470 1191665 1192576 gene locus_tag LOCUS_12480 1191665 1192576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1192691 1193620 gene locus_tag LOCUS_12490 1192691 1193620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846673.1 protein_id gnl|my_center|LOCUS_12490 1194020 1193607 gene locus_tag LOCUS_12500 1194020 1193607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1194186 1194503 gene locus_tag LOCUS_12510 1194186 1194503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12510 1194649 1195500 gene locus_tag LOCUS_12520 1194649 1195500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12520 1195505 1195969 gene locus_tag LOCUS_12530 1195505 1195969 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978052.1 protein_id gnl|my_center|LOCUS_12530 1195989 1197569 gene locus_tag LOCUS_12540 1195989 1197569 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467257.1 protein_id gnl|my_center|LOCUS_12540 1197618 1198013 gene locus_tag LOCUS_12550 1197618 1198013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978769.1 protein_id gnl|my_center|LOCUS_12550 1198562 1198005 gene locus_tag LOCUS_12560 1198562 1198005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1200322 1198598 gene locus_tag LOCUS_12570 1200322 1198598 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978120.1 protein_id gnl|my_center|LOCUS_12570 1200953 1200303 gene locus_tag LOCUS_12580 1200953 1200303 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978119.1 protein_id gnl|my_center|LOCUS_12580 1201008 1201943 gene locus_tag LOCUS_12590 1201008 1201943 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846193.1 protein_id gnl|my_center|LOCUS_12590 1202812 1201928 gene locus_tag LOCUS_12600 1202812 1201928 CDS product translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980552.1 protein_id gnl|my_center|LOCUS_12600 1203220 1202849 gene locus_tag LOCUS_12610 1203220 1202849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1203830 1204075 gene locus_tag LOCUS_12620 1203830 1204075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 1204433 1204185 gene locus_tag LOCUS_12630 1204433 1204185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1204795 1204421 gene locus_tag LOCUS_12640 1204795 1204421 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978679.1 protein_id gnl|my_center|LOCUS_12640 1205144 1204773 gene locus_tag LOCUS_12650 1205144 1204773 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978678.1 protein_id gnl|my_center|LOCUS_12650 1206841 1206608 gene locus_tag LOCUS_12660 1206841 1206608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1207177 1206959 gene locus_tag LOCUS_12670 1207177 1206959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1208431 1208237 gene locus_tag LOCUS_12680 1208431 1208237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1208634 1208431 gene locus_tag LOCUS_12690 1208634 1208431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1208783 1208658 gene locus_tag LOCUS_12700 1208783 1208658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1209202 1210269 gene locus_tag LOCUS_12710 1209202 1210269 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147062.1 protein_id gnl|my_center|LOCUS_12710 1211383 1211508 gene locus_tag LOCUS_12720 1211383 1211508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1211872 1211534 gene locus_tag LOCUS_12730 1211872 1211534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 1212257 1211829 gene locus_tag LOCUS_12740 1212257 1211829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1212440 1212350 gene locus_tag LOCUS_t00250 1212440 1212350 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1213841 1212498 gene locus_tag LOCUS_12750 1213841 1212498 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978478.1 protein_id gnl|my_center|LOCUS_12750 1214995 1213838 gene locus_tag LOCUS_12760 1214995 1213838 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846352.1 protein_id gnl|my_center|LOCUS_12760 1215154 1215540 gene locus_tag LOCUS_12770 1215154 1215540 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978126.1 protein_id gnl|my_center|LOCUS_12770 1215537 1215833 gene locus_tag LOCUS_12780 1215537 1215833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1215945 1216541 gene locus_tag LOCUS_12790 gene hxlB 1215945 1216541 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978137.1 protein_id gnl|my_center|LOCUS_12790 1217034 1216549 gene locus_tag LOCUS_12800 1217034 1216549 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978581.1 protein_id gnl|my_center|LOCUS_12800 1218278 1217031 gene locus_tag LOCUS_12810 1218278 1217031 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978580.1 protein_id gnl|my_center|LOCUS_12810 1218371 1219000 gene locus_tag LOCUS_12820 gene tenA 1218371 1219000 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979013.1 protein_id gnl|my_center|LOCUS_12820 1221101 1218984 gene locus_tag LOCUS_12830 1221101 1218984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1221949 1221137 gene locus_tag LOCUS_12840 1221949 1221137 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979642.1 protein_id gnl|my_center|LOCUS_12840 1222093 1221995 gene locus_tag LOCUS_t00260 1222093 1221995 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1222746 1223432 gene locus_tag LOCUS_12850 1222746 1223432 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846925.1 protein_id gnl|my_center|LOCUS_12850 1223433 1224347 gene locus_tag LOCUS_12860 1223433 1224347 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978125.1 protein_id gnl|my_center|LOCUS_12860 1224527 1224931 gene locus_tag LOCUS_12870 gene lrs14 1224527 1224931 CDS product HTH-type transcriptional regulator Lrs14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980122.1 protein_id gnl|my_center|LOCUS_12870 1226873 1224939 gene locus_tag LOCUS_12880 1226873 1224939 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_12880 1226989 1227087 gene locus_tag LOCUS_t00270 1226989 1227087 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1227491 1228408 gene locus_tag LOCUS_12890 1227491 1228408 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979934.1 protein_id gnl|my_center|LOCUS_12890 1229854 1228409 gene locus_tag LOCUS_12900 1229854 1228409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_12900 1230007 1230813 gene locus_tag LOCUS_12910 1230007 1230813 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846346.1 protein_id gnl|my_center|LOCUS_12910 1230819 1231511 gene locus_tag LOCUS_12920 1230819 1231511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846347.1 protein_id gnl|my_center|LOCUS_12920 1231549 1232388 gene locus_tag LOCUS_12930 gene gdS-2 1231549 1232388 CDS product hexaprenyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978463.1 protein_id gnl|my_center|LOCUS_12930 1232840 1232385 gene locus_tag LOCUS_12940 1232840 1232385 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978019.1 protein_id gnl|my_center|LOCUS_12940 1234019 1232844 gene locus_tag LOCUS_12950 1234019 1232844 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_12950 1234664 1234296 gene locus_tag LOCUS_12960 1234664 1234296 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846745.1 protein_id gnl|my_center|LOCUS_12960 1234754 1235992 gene locus_tag LOCUS_12970 1234754 1235992 CDS product thermopsin family protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980288.1 protein_id gnl|my_center|LOCUS_12970 1237085 1238056 gene locus_tag LOCUS_12980 1237085 1238056 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_12980 1239618 1238074 gene locus_tag LOCUS_12990 1239618 1238074 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979663.1 protein_id gnl|my_center|LOCUS_12990 1241279 1239687 gene locus_tag LOCUS_13000 1241279 1239687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1241370 1243019 gene locus_tag LOCUS_13010 1241370 1243019 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846891.1 protein_id gnl|my_center|LOCUS_13010 1244238 1242985 gene locus_tag LOCUS_13020 1244238 1242985 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_13020 1244839 1244384 gene locus_tag LOCUS_13030 1244839 1244384 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979029.1 protein_id gnl|my_center|LOCUS_13030 1244916 1245707 gene locus_tag LOCUS_13040 1244916 1245707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 protein_id gnl|my_center|LOCUS_13040 1246964 1245717 gene locus_tag LOCUS_13050 1246964 1245717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009990130.1 protein_id gnl|my_center|LOCUS_13050 1247506 1247937 gene locus_tag LOCUS_13060 1247506 1247937 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978480.1 protein_id gnl|my_center|LOCUS_13060 1247934 1248221 gene locus_tag LOCUS_13070 1247934 1248221 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978481.1 protein_id gnl|my_center|LOCUS_13070 1248282 1249901 gene locus_tag LOCUS_13080 1248282 1249901 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978482.1 protein_id gnl|my_center|LOCUS_13080 1249970 1250860 gene locus_tag LOCUS_13090 1249970 1250860 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978483.1 protein_id gnl|my_center|LOCUS_13090 1250844 1251959 gene locus_tag LOCUS_13100 1250844 1251959 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846353.1 protein_id gnl|my_center|LOCUS_13100 1252294 1251956 gene locus_tag LOCUS_13110 1252294 1251956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846885.1 protein_id gnl|my_center|LOCUS_13110 1252794 1252279 gene locus_tag LOCUS_13120 1252794 1252279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978486.1 protein_id gnl|my_center|LOCUS_13120 1252984 1253751 gene locus_tag LOCUS_13130 1252984 1253751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1253806 1255194 gene locus_tag LOCUS_13140 gene iolF 1253806 1255194 CDS product myo-inositol transporter IolF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244597.1 protein_id gnl|my_center|LOCUS_13140 1256305 1255187 gene locus_tag LOCUS_13150 1256305 1255187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1256478 1257419 gene locus_tag LOCUS_13160 1256478 1257419 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226175.1 protein_id gnl|my_center|LOCUS_13160 1257561 1258262 gene locus_tag LOCUS_13170 1257561 1258262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1258259 1258972 gene locus_tag LOCUS_13180 1258259 1258972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1260051 1258900 gene locus_tag LOCUS_13190 1260051 1258900 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980274.1 protein_id gnl|my_center|LOCUS_13190 1261321 1260062 gene locus_tag LOCUS_13200 1261321 1260062 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011277826.1 protein_id gnl|my_center|LOCUS_13200 1261607 1263820 gene locus_tag LOCUS_13210 1261607 1263820 CDS product thermopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980717.1 protein_id gnl|my_center|LOCUS_13210 1264465 1264878 gene locus_tag LOCUS_13220 1264465 1264878 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013749.1 protein_id gnl|my_center|LOCUS_13220 1264885 1265181 gene locus_tag LOCUS_13230 1264885 1265181 CDS product DUF424 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846357.1 protein_id gnl|my_center|LOCUS_13230 1265178 1265873 gene locus_tag LOCUS_13240 1265178 1265873 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846889.1 protein_id gnl|my_center|LOCUS_13240 1265909 1266496 gene locus_tag LOCUS_13250 gene rnhB 1265909 1266496 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978497.1 protein_id gnl|my_center|LOCUS_13250 1266486 1267538 gene locus_tag LOCUS_13260 1266486 1267538 CDS product TGS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978498.1 protein_id gnl|my_center|LOCUS_13260 1267615 1268586 gene locus_tag LOCUS_13270 gene htpX 1267615 1268586 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 protein_id gnl|my_center|LOCUS_13270 1269362 1268580 gene locus_tag LOCUS_13280 1269362 1268580 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978765.1 protein_id gnl|my_center|LOCUS_13280 1269740 1269390 gene locus_tag LOCUS_13290 1269740 1269390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1269776 1270480 gene locus_tag LOCUS_13300 1269776 1270480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13300 1270486 1271205 gene locus_tag LOCUS_13310 1270486 1271205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13310 1272076 1271174 gene locus_tag LOCUS_13320 1272076 1271174 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007451.1 protein_id gnl|my_center|LOCUS_13320 1272075 1273004 gene locus_tag LOCUS_13330 1272075 1273004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13330 1272971 1273276 gene locus_tag LOCUS_13340 1272971 1273276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13340 1273627 1273244 gene locus_tag LOCUS_13350 1273627 1273244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13350 1274034 1273615 gene locus_tag LOCUS_13360 1274034 1273615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 1274301 1275050 gene locus_tag LOCUS_13370 1274301 1275050 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980434.1 protein_id gnl|my_center|LOCUS_13370 1275343 1275053 gene locus_tag LOCUS_13380 1275343 1275053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846534.1 protein_id gnl|my_center|LOCUS_13380 1276046 1275387 gene locus_tag LOCUS_13390 1276046 1275387 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979639.1 protein_id gnl|my_center|LOCUS_13390 1277461 1276142 gene locus_tag LOCUS_13400 1277461 1276142 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847010.1 protein_id gnl|my_center|LOCUS_13400 1278158 1277727 gene locus_tag LOCUS_13410 1278158 1277727 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978555.1 protein_id gnl|my_center|LOCUS_13410 1278633 1278163 gene locus_tag LOCUS_13420 1278633 1278163 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_13420 1279830 1278973 gene locus_tag LOCUS_13430 1279830 1278973 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979100.1 protein_id gnl|my_center|LOCUS_13430 1280552 1280196 gene locus_tag LOCUS_13440 1280552 1280196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978593.1 protein_id gnl|my_center|LOCUS_13440 1281844 1280654 gene locus_tag LOCUS_13450 1281844 1280654 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980246.1 protein_id gnl|my_center|LOCUS_13450 1282661 1281891 gene locus_tag LOCUS_13460 1282661 1281891 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979642.1 protein_id gnl|my_center|LOCUS_13460 1283077 1282730 gene locus_tag LOCUS_13470 1283077 1282730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980248.1 protein_id gnl|my_center|LOCUS_13470 1284242 1283115 gene locus_tag LOCUS_13480 1284242 1283115 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979714.1 protein_id gnl|my_center|LOCUS_13480 1285167 1284274 gene locus_tag LOCUS_13490 1285167 1284274 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979713.1 protein_id gnl|my_center|LOCUS_13490 1285273 1285563 gene locus_tag LOCUS_13500 1285273 1285563 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978804.1 protein_id gnl|my_center|LOCUS_13500 1286221 1285538 gene locus_tag LOCUS_13510 gene tpiA 1286221 1285538 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980103.1 protein_id gnl|my_center|LOCUS_13510 1289189 1286379 gene locus_tag LOCUS_13520 1289189 1286379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1290340 1292181 gene locus_tag LOCUS_13530 1290340 1292181 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013267177.1 protein_id gnl|my_center|LOCUS_13530 1293862 1292189 gene locus_tag LOCUS_13540 1293862 1292189 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980561.1 protein_id gnl|my_center|LOCUS_13540 1295060 1294146 gene locus_tag LOCUS_13550 1295060 1294146 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846990.1 protein_id gnl|my_center|LOCUS_13550 1295111 1296382 gene locus_tag LOCUS_13560 1295111 1296382 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979878.1 protein_id gnl|my_center|LOCUS_13560 1296428 1297237 gene locus_tag LOCUS_13570 gene prpB 1296428 1297237 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_13570 1297300 1298445 gene locus_tag LOCUS_13580 gene gltA 1297300 1298445 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979874.1 protein_id gnl|my_center|LOCUS_13580 1298549 1300426 gene locus_tag LOCUS_13590 1298549 1300426 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847039.1 protein_id gnl|my_center|LOCUS_13590 1300413 1301321 gene locus_tag LOCUS_13600 1300413 1301321 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980384.1 protein_id gnl|my_center|LOCUS_13600 1301322 1302332 gene locus_tag LOCUS_13610 1301322 1302332 CDS product succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846447.1 protein_id gnl|my_center|LOCUS_13610 1302329 1303180 gene locus_tag LOCUS_13620 gene sucD 1302329 1303180 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742632.1 protein_id gnl|my_center|LOCUS_13620 1303177 1303407 gene locus_tag LOCUS_13630 1303177 1303407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1303537 1304061 gene locus_tag LOCUS_13640 1303537 1304061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1304657 1304956 gene locus_tag LOCUS_13650 1304657 1304956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1305163 1305894 gene locus_tag LOCUS_13660 1305163 1305894 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978988.1 protein_id gnl|my_center|LOCUS_13660 1306163 1305903 gene locus_tag LOCUS_13670 1306163 1305903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1306913 1307092 gene locus_tag LOCUS_13680 1306913 1307092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1307138 1307770 gene locus_tag LOCUS_13690 1307138 1307770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980166.1 protein_id gnl|my_center|LOCUS_13690 1308921 1307989 gene locus_tag LOCUS_13700 1308921 1307989 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267088.1 protein_id gnl|my_center|LOCUS_13700 1309612 1309034 gene locus_tag LOCUS_13710 1309612 1309034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13710 1310436 1309735 gene locus_tag LOCUS_13720 1310436 1309735 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980413.1 protein_id gnl|my_center|LOCUS_13720 1310669 1310439 gene locus_tag LOCUS_13730 1310669 1310439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13730 1311307 1310660 gene locus_tag LOCUS_13740 1311307 1310660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13740 1312512 1311304 gene locus_tag LOCUS_13750 gene thiD 1312512 1311304 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651015.1 protein_id gnl|my_center|LOCUS_13750 1313523 1312522 gene locus_tag LOCUS_13760 1313523 1312522 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980417.1 protein_id gnl|my_center|LOCUS_13760 1313813 1315297 gene locus_tag LOCUS_13770 1313813 1315297 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978525.1 protein_id gnl|my_center|LOCUS_13770 1315294 1315749 gene locus_tag LOCUS_13780 1315294 1315749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1316116 1315700 gene locus_tag LOCUS_13790 1316116 1315700 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978523.1 protein_id gnl|my_center|LOCUS_13790 1316576 1316094 gene locus_tag LOCUS_13800 1316576 1316094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846362.1 protein_id gnl|my_center|LOCUS_13800 1316682 1317089 gene locus_tag LOCUS_13810 1316682 1317089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1317086 1317499 gene locus_tag LOCUS_13820 1317086 1317499 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978520.1 protein_id gnl|my_center|LOCUS_13820 1317698 1318306 gene locus_tag LOCUS_13830 1317698 1318306 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978518.1 protein_id gnl|my_center|LOCUS_13830 1318467 1318967 gene locus_tag LOCUS_13840 1318467 1318967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13840 1319009 1319446 gene locus_tag LOCUS_13850 1319009 1319446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13850 1319436 1320173 gene locus_tag LOCUS_13860 1319436 1320173 CDS product extragenic suppressor protein suhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978527.1 protein_id gnl|my_center|LOCUS_13860 1320604 1321308 gene locus_tag LOCUS_13870 1320604 1321308 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978764.1 protein_id gnl|my_center|LOCUS_13870 1323080 1321305 gene locus_tag LOCUS_13880 1323080 1321305 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978528.1 protein_id gnl|my_center|LOCUS_13880 1325106 1323556 gene locus_tag LOCUS_13890 1325106 1323556 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846891.1 protein_id gnl|my_center|LOCUS_13890 1326167 1326048 gene locus_tag LOCUS_13900 1326167 1326048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1326654 1326169 gene locus_tag LOCUS_13910 1326654 1326169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1328153 1326654 gene locus_tag LOCUS_13920 gene soxB 1328153 1326654 CDS product proton pump complex quinol oxidase subunit SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980480.1 protein_id gnl|my_center|LOCUS_13920 1328610 1328191 gene locus_tag LOCUS_13930 gene soxA 1328610 1328191 CDS product proton pump complex quinol oxidase subunit SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846856.1 protein_id gnl|my_center|LOCUS_13930 1329473 1328706 gene locus_tag LOCUS_13940 1329473 1328706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980473.1 protein_id gnl|my_center|LOCUS_13940 1329949 1329479 gene locus_tag LOCUS_13950 1329949 1329479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978045.1 protein_id gnl|my_center|LOCUS_13950 1330402 1329956 gene locus_tag LOCUS_13960 1330402 1329956 CDS product cytochrome B558 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978044.1 protein_id gnl|my_center|LOCUS_13960 1331958 1330399 gene locus_tag LOCUS_13970 1331958 1330399 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267084.1 protein_id gnl|my_center|LOCUS_13970 1332700 1331960 gene locus_tag LOCUS_13980 1332700 1331960 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846160.1 protein_id gnl|my_center|LOCUS_13980 1332991 1335402 gene locus_tag LOCUS_13990 1332991 1335402 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846854.1 protein_id gnl|my_center|LOCUS_13990 1335502 1335978 gene locus_tag LOCUS_14000 1335502 1335978 CDS product DUF1404 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980481.1 protein_id gnl|my_center|LOCUS_14000 1336032 1336640 gene locus_tag LOCUS_14010 1336032 1336640 CDS product sulfocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978043.1 protein_id gnl|my_center|LOCUS_14010 1336873 1337457 gene locus_tag LOCUS_14020 1336873 1337457 CDS product DUF1404 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980481.1 protein_id gnl|my_center|LOCUS_14020 1337900 1338850 gene locus_tag LOCUS_14030 gene soxL2 1337900 1338850 CDS product Rieske iron-sulfur protein SoxL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979725.1 protein_id gnl|my_center|LOCUS_14030 1338857 1339366 gene locus_tag LOCUS_14040 1338857 1339366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14040 1339438 1340520 gene locus_tag LOCUS_14050 1339438 1340520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14050 1340670 1340903 gene locus_tag LOCUS_14060 1340670 1340903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1340913 1341635 gene locus_tag LOCUS_14070 1340913 1341635 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846421.1 protein_id gnl|my_center|LOCUS_14070 1341645 1342694 gene locus_tag LOCUS_14080 1341645 1342694 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980376.1 protein_id gnl|my_center|LOCUS_14080 1343048 1342725 gene locus_tag LOCUS_14090 1343048 1342725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1343447 1343178 gene locus_tag LOCUS_14100 1343447 1343178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1343802 1343638 gene locus_tag LOCUS_14110 1343802 1343638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1344186 1343908 gene locus_tag LOCUS_14120 1344186 1343908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1344518 1344204 gene locus_tag LOCUS_14130 1344518 1344204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1345415 1345260 gene locus_tag LOCUS_14140 1345415 1345260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1345743 1346324 gene locus_tag LOCUS_14150 1345743 1346324 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978560.1 protein_id gnl|my_center|LOCUS_14150 1346321 1347193 gene locus_tag LOCUS_14160 1346321 1347193 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978561.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14160 1347363 1348007 gene locus_tag LOCUS_14170 1347363 1348007 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978562.1 protein_id gnl|my_center|LOCUS_14170 1348789 1348085 gene locus_tag LOCUS_14180 1348789 1348085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1349416 1348805 gene locus_tag LOCUS_14190 1349416 1348805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1349508 1350074 gene locus_tag LOCUS_14200 1349508 1350074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1350092 1350370 gene locus_tag LOCUS_14210 1350092 1350370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1351122 1350367 gene locus_tag LOCUS_14220 1351122 1350367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1353571 1351892 gene locus_tag LOCUS_14230 gene thsA 1353571 1351892 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846517.1 protein_id gnl|my_center|LOCUS_14230 1354111 1353695 gene locus_tag LOCUS_14240 1354111 1353695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1354997 1354125 gene locus_tag LOCUS_14250 1354997 1354125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14250 1355419 1354937 gene locus_tag LOCUS_14260 1355419 1354937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1355558 1355370 gene locus_tag LOCUS_14270 1355558 1355370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1355786 1356772 gene locus_tag LOCUS_14280 1355786 1356772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979645.1 protein_id gnl|my_center|LOCUS_14280 1356796 1357923 gene locus_tag LOCUS_14290 1356796 1357923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1359126 1358098 gene locus_tag LOCUS_14300 1359126 1358098 CDS product isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978517.1 protein_id gnl|my_center|LOCUS_14300 1360238 1360840 gene locus_tag LOCUS_14310 1360238 1360840 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978516.1 protein_id gnl|my_center|LOCUS_14310 1361013 1360837 gene locus_tag LOCUS_14320 1361013 1360837 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978515.1 protein_id gnl|my_center|LOCUS_14320 1361156 1361452 gene locus_tag LOCUS_14330 1361156 1361452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846359.1 protein_id gnl|my_center|LOCUS_14330 1361928 1361662 gene locus_tag LOCUS_14340 1361928 1361662 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978514.1 protein_id gnl|my_center|LOCUS_14340 1363112 1361937 gene locus_tag LOCUS_14350 1363112 1361937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978513.1 protein_id gnl|my_center|LOCUS_14350 1363275 1363102 gene locus_tag LOCUS_14360 1363275 1363102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14360 1363769 1363275 gene locus_tag LOCUS_14370 1363769 1363275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14370 1363897 1364553 gene locus_tag LOCUS_14380 1363897 1364553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1365105 1364494 gene locus_tag LOCUS_14390 1365105 1364494 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978509.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 1365904 1365233 gene locus_tag LOCUS_14400 1365904 1365233 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978508.1 protein_id gnl|my_center|LOCUS_14400 1366032 1368284 gene locus_tag LOCUS_14410 1366032 1368284 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978507.1 protein_id gnl|my_center|LOCUS_14410 1368676 1368281 gene locus_tag LOCUS_14420 1368676 1368281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1368666 1369355 gene locus_tag LOCUS_14430 1368666 1369355 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978505.1 protein_id gnl|my_center|LOCUS_14430 1369352 1370674 gene locus_tag LOCUS_14440 gene thiD 1369352 1370674 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978504.1 protein_id gnl|my_center|LOCUS_14440 1370671 1371225 gene locus_tag LOCUS_14450 1370671 1371225 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978503.1 protein_id gnl|my_center|LOCUS_14450 1371222 1371737 gene locus_tag LOCUS_14460 gene ppa 1371222 1371737 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846890.1 protein_id gnl|my_center|LOCUS_14460 1371734 1372981 gene locus_tag LOCUS_14470 1371734 1372981 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978501.1 protein_id gnl|my_center|LOCUS_14470 1374641 1372944 gene locus_tag LOCUS_14480 1374641 1372944 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978500.1 protein_id gnl|my_center|LOCUS_14480 1376211 1374841 gene locus_tag LOCUS_14490 1376211 1374841 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846358.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 1376185 1376349 gene locus_tag LOCUS_14500 1376185 1376349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1376353 1376499 gene locus_tag LOCUS_14510 1376353 1376499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1377415 1376948 gene locus_tag LOCUS_14520 1377415 1376948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1377631 1378629 gene locus_tag LOCUS_14530 gene ilvC 1377631 1378629 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_14530 1379768 1378956 gene locus_tag LOCUS_14540 gene tatC 1379768 1378956 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978579.1 protein_id gnl|my_center|LOCUS_14540 1380079 1379786 gene locus_tag LOCUS_14550 1380079 1379786 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978577.1 protein_id gnl|my_center|LOCUS_14550 1380248 1380661 gene locus_tag LOCUS_14560 1380248 1380661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1380701 1381438 gene locus_tag LOCUS_14570 1380701 1381438 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980407.1 protein_id gnl|my_center|LOCUS_14570 1382392 1381427 gene locus_tag LOCUS_14580 1382392 1381427 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980408.1 protein_id gnl|my_center|LOCUS_14580 1382624 1382367 gene locus_tag LOCUS_14590 1382624 1382367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846774.1 protein_id gnl|my_center|LOCUS_14590 1383287 1382673 gene locus_tag LOCUS_14600 1383287 1382673 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978559.1 protein_id gnl|my_center|LOCUS_14600 1383751 1383275 gene locus_tag LOCUS_14610 1383751 1383275 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846895.1 protein_id gnl|my_center|LOCUS_14610 1384676 1383765 gene locus_tag LOCUS_14620 1384676 1383765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1385366 1384887 gene locus_tag LOCUS_14630 1385366 1384887 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846375.1 protein_id gnl|my_center|LOCUS_14630 1385521 1386144 gene locus_tag LOCUS_14640 1385521 1386144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846901.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14640 1386141 1387139 gene locus_tag LOCUS_14650 1386141 1387139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978590.1 protein_id gnl|my_center|LOCUS_14650 1387846 1387166 gene locus_tag LOCUS_14660 1387846 1387166 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978591.1 protein_id gnl|my_center|LOCUS_14660 1388058 1387849 gene locus_tag LOCUS_14670 1388058 1387849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1388566 1389423 gene locus_tag LOCUS_14680 1388566 1389423 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980458.1 protein_id gnl|my_center|LOCUS_14680 1389420 1389764 gene locus_tag LOCUS_14690 1389420 1389764 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980460.1 protein_id gnl|my_center|LOCUS_14690 1390660 1389824 gene locus_tag LOCUS_14700 1390660 1389824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1391372 1390911 gene locus_tag LOCUS_14710 1391372 1390911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1392028 1391369 gene locus_tag LOCUS_14720 1392028 1391369 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980379.1 protein_id gnl|my_center|LOCUS_14720 1393472 1392483 gene locus_tag LOCUS_14730 1393472 1392483 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980380.1 protein_id gnl|my_center|LOCUS_14730 1394819 1393473 gene locus_tag LOCUS_14740 1394819 1393473 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980381.1 protein_id gnl|my_center|LOCUS_14740 1394937 1395116 gene locus_tag LOCUS_14750 1394937 1395116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1395116 1395961 gene locus_tag LOCUS_14760 1395116 1395961 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267101.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14760 1396386 1396565 gene locus_tag LOCUS_14770 1396386 1396565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1397050 1396637 gene locus_tag LOCUS_14780 1397050 1396637 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978594.1 protein_id gnl|my_center|LOCUS_14780 1397693 1397154 gene locus_tag LOCUS_14790 1397693 1397154 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978770.1 protein_id gnl|my_center|LOCUS_14790 1398474 1397698 gene locus_tag LOCUS_14800 1398474 1397698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14800 1398743 1398471 gene locus_tag LOCUS_14810 1398743 1398471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14810 1399244 1400431 gene locus_tag LOCUS_14820 1399244 1400431 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978015.1 protein_id gnl|my_center|LOCUS_14820 1400428 1402671 gene locus_tag LOCUS_14830 1400428 1402671 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_14830 1402744 1402905 gene locus_tag LOCUS_14840 1402744 1402905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1403688 1403933 gene locus_tag LOCUS_14850 1403688 1403933 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846780.1 protein_id gnl|my_center|LOCUS_14850 1404002 1405165 gene locus_tag LOCUS_14860 1404002 1405165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1405162 1406379 gene locus_tag LOCUS_14870 1405162 1406379 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980340.1 protein_id gnl|my_center|LOCUS_14870 1406403 1407428 gene locus_tag LOCUS_14880 1406403 1407428 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980538.1 protein_id gnl|my_center|LOCUS_14880 1407465 1408376 gene locus_tag LOCUS_14890 gene speB 1407465 1408376 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_14890 1408373 1409056 gene locus_tag LOCUS_14900 1408373 1409056 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846811.1 protein_id gnl|my_center|LOCUS_14900 1409088 1409840 gene locus_tag LOCUS_14910 1409088 1409840 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980502.1 protein_id gnl|my_center|LOCUS_14910 1409842 1410603 gene locus_tag LOCUS_14920 1409842 1410603 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847037.1 protein_id gnl|my_center|LOCUS_14920 1410871 1411062 gene locus_tag LOCUS_14930 1410871 1411062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14930 1412014 1412892 gene locus_tag LOCUS_14940 1412014 1412892 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980466.1 protein_id gnl|my_center|LOCUS_14940 1413427 1412873 gene locus_tag LOCUS_14950 1413427 1412873 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979808.1 protein_id gnl|my_center|LOCUS_14950 1413531 1414289 gene locus_tag LOCUS_14960 1413531 1414289 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847022.1 protein_id gnl|my_center|LOCUS_14960 1414362 1414805 gene locus_tag LOCUS_14970 1414362 1414805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1414694 1414936 gene locus_tag LOCUS_14980 1414694 1414936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1415548 1415766 gene locus_tag LOCUS_14990 1415548 1415766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1417059 1415929 gene locus_tag LOCUS_15000 1417059 1415929 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979067.1 protein_id gnl|my_center|LOCUS_15000 1417777 1417193 gene locus_tag LOCUS_15010 1417777 1417193 CDS product IS607-like element ISSto11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742643.1 protein_id gnl|my_center|LOCUS_15010 1418294 1417818 gene locus_tag LOCUS_15020 1418294 1417818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1418599 1418291 gene locus_tag LOCUS_15030 1418599 1418291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1418750 1419079 gene locus_tag LOCUS_15040 1418750 1419079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15040 1420300 1419200 gene locus_tag LOCUS_15050 1420300 1419200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978695.1 protein_id gnl|my_center|LOCUS_15050 1420380 1421051 gene locus_tag LOCUS_15060 1420380 1421051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1422048 1422920 gene locus_tag LOCUS_15070 1422048 1422920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846404.1 protein_id gnl|my_center|LOCUS_15070 1422917 1423717 gene locus_tag LOCUS_15080 1422917 1423717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846403.1 protein_id gnl|my_center|LOCUS_15080 1423765 1424076 gene locus_tag LOCUS_15090 1423765 1424076 CDS product muconolactone Delta-isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846487.1 protein_id gnl|my_center|LOCUS_15090 1424110 1424916 gene locus_tag LOCUS_15100 1424110 1424916 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015949.1 protein_id gnl|my_center|LOCUS_15100 1425000 1425248 gene locus_tag LOCUS_15110 1425000 1425248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15110 1425296 1425571 gene locus_tag LOCUS_15120 1425296 1425571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 1426207 1426635 gene locus_tag LOCUS_15130 1426207 1426635 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980230.1 protein_id gnl|my_center|LOCUS_15130 1426632 1427480 gene locus_tag LOCUS_15140 1426632 1427480 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846803.1 protein_id gnl|my_center|LOCUS_15140 1427691 1427978 gene locus_tag LOCUS_15150 1427691 1427978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15150 1428009 1428539 gene locus_tag LOCUS_15160 1428009 1428539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15160 1428918 1430441 gene locus_tag LOCUS_15170 gene cimA 1428918 1430441 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980284.1 protein_id gnl|my_center|LOCUS_15170 1430577 1431467 gene locus_tag LOCUS_15180 gene ubiA 1430577 1431467 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980285.1 protein_id gnl|my_center|LOCUS_15180 1431497 1432363 gene locus_tag LOCUS_15190 1431497 1432363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1432539 1433516 gene locus_tag LOCUS_15200 1432539 1433516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1433513 1434766 gene locus_tag LOCUS_15210 1433513 1434766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1434805 1436169 gene locus_tag LOCUS_15220 1434805 1436169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1436132 1436311 gene locus_tag LOCUS_15230 1436132 1436311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1436326 1438398 gene locus_tag LOCUS_15240 1436326 1438398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1438382 1439392 gene locus_tag LOCUS_15250 1438382 1439392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1439389 1440120 gene locus_tag LOCUS_15260 1439389 1440120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1440796 1440383 gene locus_tag LOCUS_15270 1440796 1440383 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979755.1 protein_id gnl|my_center|LOCUS_15270 1441291 1440827 gene locus_tag LOCUS_15280 1441291 1440827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1441719 1441345 gene locus_tag LOCUS_15290 1441719 1441345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979147.1 protein_id gnl|my_center|LOCUS_15290 1442166 1443017 gene locus_tag LOCUS_15300 1442166 1443017 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015265.1 protein_id gnl|my_center|LOCUS_15300 1443373 1443014 gene locus_tag LOCUS_15310 1443373 1443014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1443447 1443941 gene locus_tag LOCUS_15320 1443447 1443941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1443971 1445245 gene locus_tag LOCUS_15330 1443971 1445245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978029.1 protein_id gnl|my_center|LOCUS_15330 1445300 1445617 gene locus_tag LOCUS_15340 1445300 1445617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979758.1 protein_id gnl|my_center|LOCUS_15340 1445614 1446066 gene locus_tag LOCUS_15350 1445614 1446066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1446188 1445958 gene locus_tag LOCUS_15360 1446188 1445958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1446325 1447554 gene locus_tag LOCUS_15370 1446325 1447554 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846808.1 protein_id gnl|my_center|LOCUS_15370 1447558 1448184 gene locus_tag LOCUS_15380 1447558 1448184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1448927 1450618 gene locus_tag LOCUS_15390 1448927 1450618 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980127.1 protein_id gnl|my_center|LOCUS_15390 1450620 1451648 gene locus_tag LOCUS_15400 1450620 1451648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980126.1 protein_id gnl|my_center|LOCUS_15400 1451651 1451842 gene locus_tag LOCUS_15410 1451651 1451842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980125.1 protein_id gnl|my_center|LOCUS_15410 1452595 1452987 gene locus_tag LOCUS_15420 1452595 1452987 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978832.1 protein_id gnl|my_center|LOCUS_15420 1453493 1452993 gene locus_tag LOCUS_15430 1453493 1452993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429693.1 protein_id gnl|my_center|LOCUS_15430 1454815 1455108 gene locus_tag LOCUS_15440 1454815 1455108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1455815 1455105 gene locus_tag LOCUS_15450 1455815 1455105 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429827.1 protein_id gnl|my_center|LOCUS_15450 1455949 1456212 gene locus_tag LOCUS_15460 1455949 1456212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1456244 1456957 gene locus_tag LOCUS_15470 1456244 1456957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1456861 1457223 gene locus_tag LOCUS_15480 1456861 1457223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1457254 1457874 gene locus_tag LOCUS_15490 1457254 1457874 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980308.1 protein_id gnl|my_center|LOCUS_15490 1458469 1458212 gene locus_tag LOCUS_15500 1458469 1458212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15500 1458680 1458423 gene locus_tag LOCUS_15510 1458680 1458423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15510 1459509 1459024 gene locus_tag LOCUS_15520 1459509 1459024 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503330.1 protein_id gnl|my_center|LOCUS_15520 1460142 1461125 gene locus_tag LOCUS_15530 gene gyaR 1460142 1461125 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_15530 1461466 1461131 gene locus_tag LOCUS_15540 gene glnB 1461466 1461131 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_15540 1462463 1461477 gene locus_tag LOCUS_15550 1462463 1461477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15550 1462843 1462400 gene locus_tag LOCUS_15560 1462843 1462400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15560 1463207 1464073 gene locus_tag LOCUS_15570 1463207 1464073 CDS product bifunctional 2-dehydro-3-deoxy-phosphogluconate/2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846807.1 protein_id gnl|my_center|LOCUS_15570 1464070 1465002 gene locus_tag LOCUS_15580 gene kdgK 1464070 1465002 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980563.1 protein_id gnl|my_center|LOCUS_15580 1465097 1466257 gene locus_tag LOCUS_15590 1465097 1466257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15590 1466263 1466628 gene locus_tag LOCUS_15600 1466263 1466628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15600 1466858 1467340 gene locus_tag LOCUS_15610 1466858 1467340 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_15610 1467919 1467314 gene locus_tag LOCUS_15620 1467919 1467314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1468070 1468585 gene locus_tag LOCUS_15630 1468070 1468585 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978887.1 protein_id gnl|my_center|LOCUS_15630 1471168 1469465 gene locus_tag LOCUS_15640 1471168 1469465 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878782.1 protein_id gnl|my_center|LOCUS_15640 1471284 1472147 gene locus_tag LOCUS_15650 1471284 1472147 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980282.1 protein_id gnl|my_center|LOCUS_15650 1472547 1472110 gene locus_tag LOCUS_15660 1472547 1472110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1473433 1474101 gene locus_tag LOCUS_15670 1473433 1474101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15670 1474101 1475597 gene locus_tag LOCUS_15680 1474101 1475597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15680 1475676 1476491 gene locus_tag LOCUS_15690 1475676 1476491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1476488 1477252 gene locus_tag LOCUS_15700 1476488 1477252 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979077.1 protein_id gnl|my_center|LOCUS_15700 1477264 1477902 gene locus_tag LOCUS_15710 1477264 1477902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979076.1 protein_id gnl|my_center|LOCUS_15710 1477895 1478206 gene locus_tag LOCUS_15720 1477895 1478206 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846470.1 protein_id gnl|my_center|LOCUS_15720 1480006 1478861 gene locus_tag LOCUS_15730 1480006 1478861 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979972.1 protein_id gnl|my_center|LOCUS_15730 1480344 1480003 gene locus_tag LOCUS_15740 1480344 1480003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1480958 1480365 gene locus_tag LOCUS_15750 gene dps 1480958 1480365 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144276.1 protein_id gnl|my_center|LOCUS_15750 1482272 1481418 gene locus_tag LOCUS_15760 1482272 1481418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15760 1483545 1482904 gene locus_tag LOCUS_15770 1483545 1482904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1484479 1483538 gene locus_tag LOCUS_15780 1484479 1483538 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393677.1 protein_id gnl|my_center|LOCUS_15780 1486179 1484476 gene locus_tag LOCUS_15790 gene hyfB 1486179 1484476 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_15790 1486784 1486179 gene locus_tag LOCUS_15800 1486784 1486179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1487893 1486781 gene locus_tag LOCUS_15810 1487893 1486781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1489161 1487896 gene locus_tag LOCUS_15820 1489161 1487896 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_15820 1489926 1490102 gene locus_tag LOCUS_15830 1489926 1490102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15830 1490123 1490497 gene locus_tag LOCUS_15840 1490123 1490497 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978679.1 protein_id gnl|my_center|LOCUS_15840 1490719 1491381 gene locus_tag LOCUS_15850 1490719 1491381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1492279 1491740 gene locus_tag LOCUS_15860 1492279 1491740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15860 1492655 1492383 gene locus_tag LOCUS_15870 1492655 1492383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15870 1492765 1493139 gene locus_tag LOCUS_15880 1492765 1493139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1493160 1493312 gene locus_tag LOCUS_15890 1493160 1493312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1493771 1495240 gene locus_tag LOCUS_15900 1493771 1495240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1495473 1495604 gene locus_tag LOCUS_15910 1495473 1495604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1498278 1495759 gene locus_tag LOCUS_15920 1498278 1495759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1498409 1499284 gene locus_tag LOCUS_15930 1498409 1499284 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263020.1 protein_id gnl|my_center|LOCUS_15930 1499907 1500122 gene locus_tag LOCUS_15940 1499907 1500122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1502729 1500681 gene locus_tag LOCUS_15950 1502729 1500681 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979624.1 protein_id gnl|my_center|LOCUS_15950 1502838 1503347 gene locus_tag LOCUS_15960 1502838 1503347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1503349 1504137 gene locus_tag LOCUS_15970 1503349 1504137 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978059.1 protein_id gnl|my_center|LOCUS_15970 1504761 1505984 gene locus_tag LOCUS_15980 1504761 1505984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1506149 1507843 gene locus_tag LOCUS_15990 gene ilvD 1506149 1507843 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980252.1 protein_id gnl|my_center|LOCUS_15990 1507845 1508942 gene locus_tag LOCUS_16000 1507845 1508942 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979764.1 protein_id gnl|my_center|LOCUS_16000 1510978 1509887 gene locus_tag LOCUS_16010 1510978 1509887 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978916.1 protein_id gnl|my_center|LOCUS_16010 1511603 1511304 gene locus_tag LOCUS_16020 1511603 1511304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1511913 1512098 gene locus_tag LOCUS_16030 1511913 1512098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1513063 1514307 gene locus_tag LOCUS_16040 1513063 1514307 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053783.1 protein_id gnl|my_center|LOCUS_16040 1515035 1515334 gene locus_tag LOCUS_16050 1515035 1515334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1516540 1518105 gene locus_tag LOCUS_16060 1516540 1518105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1518294 1520627 gene locus_tag LOCUS_16070 1518294 1520627 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978604.1 protein_id gnl|my_center|LOCUS_16070 1520540 1520725 gene locus_tag LOCUS_16080 1520540 1520725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1521308 1521841 gene locus_tag LOCUS_16090 1521308 1521841 CDS product IS607-like element ISSto11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742643.1 protein_id gnl|my_center|LOCUS_16090 1521885 1522361 gene locus_tag LOCUS_16100 1521885 1522361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 1522369 1523016 gene locus_tag LOCUS_16110 1522369 1523016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16110 1524308 1523487 gene locus_tag LOCUS_16120 gene arnR 1524308 1523487 CDS product HTH-type transcriptional activator ArnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980602.1 protein_id gnl|my_center|LOCUS_16120 1524761 1524387 gene locus_tag LOCUS_16130 1524761 1524387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1525516 1524839 gene locus_tag LOCUS_16140 1525516 1524839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1526103 1525612 gene locus_tag LOCUS_16150 1526103 1525612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1527606 1526161 gene locus_tag LOCUS_16160 1527606 1526161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980604.1 protein_id gnl|my_center|LOCUS_16160 1528069 1527593 gene locus_tag LOCUS_16170 1528069 1527593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1528257 1529153 gene locus_tag LOCUS_16180 1528257 1529153 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980606.1 protein_id gnl|my_center|LOCUS_16180 1529176 1529907 gene locus_tag LOCUS_16190 1529176 1529907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1529897 1530358 gene locus_tag LOCUS_16200 1529897 1530358 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980608.1 protein_id gnl|my_center|LOCUS_16200 1530360 1530848 gene locus_tag LOCUS_16210 1530360 1530848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980609.1 protein_id gnl|my_center|LOCUS_16210 1530830 1531531 gene locus_tag LOCUS_16220 1530830 1531531 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980610.1 protein_id gnl|my_center|LOCUS_16220 1531535 1533076 gene locus_tag LOCUS_16230 1531535 1533076 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980611.1 protein_id gnl|my_center|LOCUS_16230 1533123 1534484 gene locus_tag LOCUS_16240 1533123 1534484 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980612.1 protein_id gnl|my_center|LOCUS_16240 1536363 1535509 gene locus_tag LOCUS_16250 1536363 1535509 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979652.1 protein_id gnl|my_center|LOCUS_16250 1536887 1536489 gene locus_tag LOCUS_16260 1536887 1536489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1537185 1536925 gene locus_tag LOCUS_16270 1537185 1536925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16270 1537808 1537978 gene locus_tag LOCUS_16280 1537808 1537978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1537966 1539348 gene locus_tag LOCUS_16290 1537966 1539348 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014205.1 protein_id gnl|my_center|LOCUS_16290 1539345 1540496 gene locus_tag LOCUS_16300 1539345 1540496 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979124.1 protein_id gnl|my_center|LOCUS_16300 1540653 1542101 gene locus_tag LOCUS_16310 1540653 1542101 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_16310 1542311 1542997 gene locus_tag LOCUS_16320 1542311 1542997 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227980.1 protein_id gnl|my_center|LOCUS_16320 1543110 1544702 gene locus_tag LOCUS_16330 1543110 1544702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1544763 1545659 gene locus_tag LOCUS_16340 1544763 1545659 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082464.1 protein_id gnl|my_center|LOCUS_16340 1546923 1545664 gene locus_tag LOCUS_16350 1546923 1545664 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_16350 1547327 1549180 gene locus_tag LOCUS_16360 1547327 1549180 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027129.1 protein_id gnl|my_center|LOCUS_16360 1549227 1550192 gene locus_tag LOCUS_16370 1549227 1550192 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865093.1 protein_id gnl|my_center|LOCUS_16370 1550583 1550167 gene locus_tag LOCUS_16380 1550583 1550167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1550792 1550556 gene locus_tag LOCUS_16390 1550792 1550556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1551693 1554029 gene locus_tag LOCUS_16400 1551693 1554029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1554116 1555993 gene locus_tag LOCUS_16410 1554116 1555993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077263.1 protein_id gnl|my_center|LOCUS_16410 1556083 1557105 gene locus_tag LOCUS_16420 1556083 1557105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_16420 1557102 1558046 gene locus_tag LOCUS_16430 1557102 1558046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 protein_id gnl|my_center|LOCUS_16430 1558616 1558780 gene locus_tag LOCUS_16440 1558616 1558780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16440 1558801 1560381 gene locus_tag LOCUS_16450 1558801 1560381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 1560768 1562906 gene locus_tag LOCUS_16460 1560768 1562906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1563018 1563485 gene locus_tag LOCUS_16470 1563018 1563485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16470 1563482 1564861 gene locus_tag LOCUS_16480 1563482 1564861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16480 1564935 1565957 gene locus_tag LOCUS_16490 1564935 1565957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197536754.1 protein_id gnl|my_center|LOCUS_16490 1565954 1566910 gene locus_tag LOCUS_16500 1565954 1566910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1566965 1568893 gene locus_tag LOCUS_16510 1566965 1568893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1569973 1568903 gene locus_tag LOCUS_16520 1569973 1568903 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975777.1 protein_id gnl|my_center|LOCUS_16520 1570790 1569975 gene locus_tag LOCUS_16530 1570790 1569975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1571766 1570858 gene locus_tag LOCUS_16540 1571766 1570858 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921669.1 protein_id gnl|my_center|LOCUS_16540 1573017 1571809 gene locus_tag LOCUS_16550 1573017 1571809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1574026 1573187 gene locus_tag LOCUS_16560 1574026 1573187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1574679 1574029 gene locus_tag LOCUS_16570 1574679 1574029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1574897 1574577 gene locus_tag LOCUS_16580 1574897 1574577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1575014 1575769 gene locus_tag LOCUS_16590 1575014 1575769 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_16590 1575819 1576748 gene locus_tag LOCUS_16600 1575819 1576748 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_16600 1576783 1577856 gene locus_tag LOCUS_16610 1576783 1577856 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_16610 1580764 1577831 gene locus_tag LOCUS_16620 1580764 1577831 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979014.1 protein_id gnl|my_center|LOCUS_16620 1582805 1580808 gene locus_tag LOCUS_16630 gene malA 1582805 1580808 CDS product alpha-glucosidase MalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980614.1 protein_id gnl|my_center|LOCUS_16630 1583025 1583180 gene locus_tag LOCUS_16640 1583025 1583180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1585271 1583625 gene locus_tag LOCUS_16650 1585271 1583625 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_16650 1586448 1585282 gene locus_tag LOCUS_16660 1586448 1585282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16660 1586726 1586445 gene locus_tag LOCUS_16670 1586726 1586445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16670 1587209 1586964 gene locus_tag LOCUS_16680 1587209 1586964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1587369 1587172 gene locus_tag LOCUS_16690 1587369 1587172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1587551 1587417 gene locus_tag LOCUS_16700 1587551 1587417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1589117 1587783 gene locus_tag LOCUS_16710 1589117 1587783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1590348 1589323 gene locus_tag LOCUS_16720 1590348 1589323 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_16720 1591068 1590379 gene locus_tag LOCUS_16730 1591068 1590379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1592144 1591065 gene locus_tag LOCUS_16740 1592144 1591065 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_16740 1592412 1593467 gene locus_tag LOCUS_16750 1592412 1593467 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_16750 1594900 1593461 gene locus_tag LOCUS_16760 1594900 1593461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16760 1595331 1594864 gene locus_tag LOCUS_16770 1595331 1594864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1595492 1595274 gene locus_tag LOCUS_16780 1595492 1595274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1595528 1596544 gene locus_tag LOCUS_16790 1595528 1596544 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 protein_id gnl|my_center|LOCUS_16790 1596545 1597555 gene locus_tag LOCUS_16800 1596545 1597555 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926009.1 protein_id gnl|my_center|LOCUS_16800 1597552 1598562 gene locus_tag LOCUS_16810 1597552 1598562 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979074.1 protein_id gnl|my_center|LOCUS_16810 1600451 1599168 gene locus_tag LOCUS_16820 1600451 1599168 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168140.1 protein_id gnl|my_center|LOCUS_16820 1601235 1601570 gene locus_tag LOCUS_16830 1601235 1601570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16830 1601600 1602037 gene locus_tag LOCUS_16840 1601600 1602037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16840 1602120 1602734 gene locus_tag LOCUS_16850 1602120 1602734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1603236 1604255 gene locus_tag LOCUS_16860 1603236 1604255 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867726.1 protein_id gnl|my_center|LOCUS_16860 1604579 1607155 gene locus_tag LOCUS_16870 1604579 1607155 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_16870 1607168 1607398 gene locus_tag LOCUS_16880 1607168 1607398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1607609 1607752 gene locus_tag LOCUS_16890 1607609 1607752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1607905 1608906 gene locus_tag LOCUS_16900 1607905 1608906 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_16900 1610059 1608929 gene locus_tag LOCUS_16910 1610059 1608929 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_16910 1611009 1610047 gene locus_tag LOCUS_16920 1611009 1610047 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_16920 1611101 1611667 gene locus_tag LOCUS_16930 1611101 1611667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16930 1611649 1611813 gene locus_tag LOCUS_16940 1611649 1611813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1611848 1612033 gene locus_tag LOCUS_16950 1611848 1612033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1612030 1612197 gene locus_tag LOCUS_16960 1612030 1612197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1613329 1612295 gene locus_tag LOCUS_16970 1613329 1612295 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980662.1 protein_id gnl|my_center|LOCUS_16970 1614336 1613428 gene locus_tag LOCUS_16980 1614336 1613428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1614439 1614732 gene locus_tag LOCUS_16990 1614439 1614732 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022869.1 protein_id gnl|my_center|LOCUS_16990 1614737 1614976 gene locus_tag LOCUS_17000 1614737 1614976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1614979 1615797 gene locus_tag LOCUS_17010 1614979 1615797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1615850 1618468 gene locus_tag LOCUS_17020 1615850 1618468 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218266864.1 protein_id gnl|my_center|LOCUS_17020 1618997 1620436 gene locus_tag LOCUS_17030 1618997 1620436 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_17030 1620616 1620801 gene locus_tag LOCUS_17040 1620616 1620801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1620782 1622473 gene locus_tag LOCUS_17050 1620782 1622473 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979739.1 protein_id gnl|my_center|LOCUS_17050 1622464 1622682 gene locus_tag LOCUS_17060 1622464 1622682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17060 1622688 1623032 gene locus_tag LOCUS_17070 1622688 1623032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17070 1624573 1625049 gene locus_tag LOCUS_17080 1624573 1625049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1625618 1625448 gene locus_tag LOCUS_17090 1625618 1625448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1626017 1626694 gene locus_tag LOCUS_17100 1626017 1626694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1627583 1626891 gene locus_tag LOCUS_17110 1627583 1626891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1628756 1628019 gene locus_tag LOCUS_17120 1628756 1628019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1629845 1628910 gene locus_tag LOCUS_17130 1629845 1628910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1631566 1629980 gene locus_tag LOCUS_17140 1631566 1629980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1632537 1631563 gene locus_tag LOCUS_17150 1632537 1631563 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979050.1 protein_id gnl|my_center|LOCUS_17150 1633250 1632753 gene locus_tag LOCUS_17160 gene crn1 1633250 1632753 CDS product CRISPR-associated ring nuclease Crn1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846121.1 protein_id gnl|my_center|LOCUS_17160 1633606 1634514 gene locus_tag LOCUS_17170 gene cas4a 1633606 1634514 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 protein_id gnl|my_center|LOCUS_17170 1634715 1635311 gene locus_tag LOCUS_17180 1634715 1635311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1635675 1635532 gene locus_tag LOCUS_17190 1635675 1635532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1635897 1636685 gene locus_tag LOCUS_17200 1635897 1636685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979819.1 protein_id gnl|my_center|LOCUS_17200 1637984 1637325 gene locus_tag LOCUS_17210 1637984 1637325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1638527 1638210 gene locus_tag LOCUS_17220 1638527 1638210 CDS product clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846641.1 protein_id gnl|my_center|LOCUS_17220 1639245 1638517 gene locus_tag LOCUS_17230 1639245 1638517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17230 1639420 1639232 gene locus_tag LOCUS_17240 1639420 1639232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1640367 1639951 gene locus_tag LOCUS_17250 1640367 1639951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1640544 1640371 gene locus_tag LOCUS_17260 1640544 1640371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1641461 1642249 gene locus_tag LOCUS_17270 gene cas6 1641461 1642249 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168154.1 protein_id gnl|my_center|LOCUS_17270 1643316 1646171 gene locus_tag LOCUS_17280 1643316 1646171 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977932.1 protein_id gnl|my_center|LOCUS_17280 1647251 1648501 gene locus_tag LOCUS_17290 1647251 1648501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1648432 1649538 gene locus_tag LOCUS_17300 1648432 1649538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1651139 1650540 gene locus_tag LOCUS_17310 1651139 1650540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110271939.1 protein_id gnl|my_center|LOCUS_17310 1651989 1652690 gene locus_tag LOCUS_17320 1651989 1652690 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_17320 1652723 1653025 gene locus_tag LOCUS_17330 1652723 1653025 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978085.1 protein_id gnl|my_center|LOCUS_17330 1653615 1654400 gene locus_tag LOCUS_17340 1653615 1654400 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582919.1 protein_id gnl|my_center|LOCUS_17340 1654581 1654808 gene locus_tag LOCUS_17350 1654581 1654808 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980069.1 protein_id gnl|my_center|LOCUS_17350 1654768 1655205 gene locus_tag LOCUS_17360 1654768 1655205 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846698.1 protein_id gnl|my_center|LOCUS_17360 1656407 1656595 gene locus_tag LOCUS_17370 1656407 1656595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1658520 1657798 gene locus_tag LOCUS_17380 gene cas6 1658520 1657798 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_17380 1658914 1658558 gene locus_tag LOCUS_17390 1658914 1658558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1659213 1658914 gene locus_tag LOCUS_17400 1659213 1658914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1660128 1659223 gene locus_tag LOCUS_17410 gene cas7b 1660128 1659223 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082348.1 protein_id gnl|my_center|LOCUS_17410 1661905 1660178 gene locus_tag LOCUS_17420 1661905 1660178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1662533 1662790 gene locus_tag LOCUS_17430 gene cas2 1662533 1662790 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817554.1 protein_id gnl|my_center|LOCUS_17430 1663173 1663493 gene locus_tag LOCUS_17440 1663173 1663493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17440 1663568 1664518 gene locus_tag LOCUS_17450 gene cas1b 1663568 1664518 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082344.1 protein_id gnl|my_center|LOCUS_17450 1664539 1664727 gene locus_tag LOCUS_17460 1664539 1664727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1664810 1679609 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaagccctcaaaggtaagctacaaac 1679646 1680862 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaagccctcaaaggtaagctacaaac 1681273 1683450 gene locus_tag LOCUS_17470 1681273 1683450 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_17470 1684530 1684871 gene locus_tag LOCUS_17480 1684530 1684871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1686162 1685884 gene locus_tag LOCUS_17490 gene cas2 1686162 1685884 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846123.1 protein_id gnl|my_center|LOCUS_17490 1686554 1686162 gene locus_tag LOCUS_17500 1686554 1686162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1687432 1686551 gene locus_tag LOCUS_17510 gene cas1 1687432 1686551 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977959.1 protein_id gnl|my_center|LOCUS_17510 1687994 1687434 gene locus_tag LOCUS_17520 gene cas4 1687994 1687434 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977954.1 protein_id gnl|my_center|LOCUS_17520 1688612 1701897 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaagcatcctagaaggaattgaaag 1702153 1701923 gene locus_tag LOCUS_17530 1702153 1701923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1702566 1702312 gene locus_tag LOCUS_17540 1702566 1702312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1702709 1704031 gene locus_tag LOCUS_17550 1702709 1704031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17550 1704078 1704773 gene locus_tag LOCUS_17560 1704078 1704773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 1705745 1705461 gene locus_tag LOCUS_17570 1705745 1705461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1707471 1707830 gene locus_tag LOCUS_17580 1707471 1707830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1708048 1707827 gene locus_tag LOCUS_17590 1708048 1707827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1709139 1709552 gene locus_tag LOCUS_17600 1709139 1709552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1709546 1710292 gene locus_tag LOCUS_17610 gene cas6 1709546 1710292 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162309142.1 protein_id gnl|my_center|LOCUS_17610 1710300 1710701 gene locus_tag LOCUS_17620 1710300 1710701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1710703 1711443 gene locus_tag LOCUS_17630 gene csx7 1710703 1711443 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977938.1 protein_id gnl|my_center|LOCUS_17630 1711440 1712273 gene locus_tag LOCUS_17640 gene csx7 1711440 1712273 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977939.1 protein_id gnl|my_center|LOCUS_17640 1712326 1713087 gene locus_tag LOCUS_17650 1712326 1713087 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977941.1 protein_id gnl|my_center|LOCUS_17650 1713075 1713254 gene locus_tag LOCUS_17660 1713075 1713254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1713277 1715862 gene locus_tag LOCUS_17670 1713277 1715862 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977942.1 protein_id gnl|my_center|LOCUS_17670 1715859 1716497 gene locus_tag LOCUS_17680 1715859 1716497 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977943.1 protein_id gnl|my_center|LOCUS_17680 1716500 1717438 gene locus_tag LOCUS_17690 1716500 1717438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846117.1 protein_id gnl|my_center|LOCUS_17690 1717435 1718226 gene locus_tag LOCUS_17700 1717435 1718226 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977945.1 protein_id gnl|my_center|LOCUS_17700 1719319 1718663 gene locus_tag LOCUS_17710 1719319 1718663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1719510 1719346 gene locus_tag LOCUS_17720 1719510 1719346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1721937 1721521 gene locus_tag LOCUS_17730 1721937 1721521 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978781.1 protein_id gnl|my_center|LOCUS_17730 1722329 1721925 gene locus_tag LOCUS_17740 1722329 1721925 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978780.1 protein_id gnl|my_center|LOCUS_17740 1724329 1725699 gene locus_tag LOCUS_17750 1724329 1725699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1725696 1726919 gene locus_tag LOCUS_17760 1725696 1726919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977968.1 protein_id gnl|my_center|LOCUS_17760 1728177 1727929 gene locus_tag LOCUS_17770 1728177 1727929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1728234 1728959 gene locus_tag LOCUS_17780 1728234 1728959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1729885 1729286 gene locus_tag LOCUS_17790 1729885 1729286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1730823 1731818 gene locus_tag LOCUS_17800 1730823 1731818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1731815 1732441 gene locus_tag LOCUS_17810 1731815 1732441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1732465 1733217 gene locus_tag LOCUS_17820 1732465 1733217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1734067 1734831 gene locus_tag LOCUS_17830 1734067 1734831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1735290 1735520 gene locus_tag LOCUS_17840 1735290 1735520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1735517 1735903 gene locus_tag LOCUS_17850 1735517 1735903 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979870.1 protein_id gnl|my_center|LOCUS_17850 1736737 1736558 gene locus_tag LOCUS_17860 1736737 1736558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1736955 1736743 gene locus_tag LOCUS_17870 1736955 1736743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17870 1737225 1737073 gene locus_tag LOCUS_17880 1737225 1737073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1737649 1737455 gene locus_tag LOCUS_17890 1737649 1737455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 1738164 1737994 gene locus_tag LOCUS_17900 1738164 1737994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1738232 1738510 gene locus_tag LOCUS_17910 1738232 1738510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17910 1738459 1739328 gene locus_tag LOCUS_17920 1738459 1739328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 1741267 1740059 gene locus_tag LOCUS_17930 1741267 1740059 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_17930 1741657 1741301 gene locus_tag LOCUS_17940 1741657 1741301 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_17940 1743406 1742003 gene locus_tag LOCUS_17950 1743406 1742003 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206504.1 protein_id gnl|my_center|LOCUS_17950 1744007 1743636 gene locus_tag LOCUS_17960 1744007 1743636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1744718 1744035 gene locus_tag LOCUS_17970 1744718 1744035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17970 1744796 1745095 gene locus_tag LOCUS_17980 1744796 1745095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1745110 1745325 gene locus_tag LOCUS_17990 1745110 1745325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1745379 1745540 gene locus_tag LOCUS_18000 1745379 1745540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18000 1746950 1745790 gene locus_tag LOCUS_18010 1746950 1745790 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_18010 1747109 1747513 gene locus_tag LOCUS_18020 1747109 1747513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1749096 1748557 gene locus_tag LOCUS_18030 1749096 1748557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18030 1749758 1749042 gene locus_tag LOCUS_18040 1749758 1749042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18040 1751190 1750492 gene locus_tag LOCUS_18050 1751190 1750492 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978627.1 protein_id gnl|my_center|LOCUS_18050 1751773 1751231 gene locus_tag LOCUS_18060 1751773 1751231 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980595.1 protein_id gnl|my_center|LOCUS_18060 1752232 1752489 gene locus_tag LOCUS_18070 1752232 1752489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1752614 1752940 gene locus_tag LOCUS_18080 1752614 1752940 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461621.1 protein_id gnl|my_center|LOCUS_18080 1752992 1753228 gene locus_tag LOCUS_18090 1752992 1753228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18090 1753225 1753578 gene locus_tag LOCUS_18100 1753225 1753578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18100 1753579 1754193 gene locus_tag LOCUS_18110 1753579 1754193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18110 1755153 1756130 gene locus_tag LOCUS_18120 1755153 1756130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1757687 1756377 gene locus_tag LOCUS_18130 1757687 1756377 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660710.1 protein_id gnl|my_center|LOCUS_18130 1757798 1758856 gene locus_tag LOCUS_18140 gene comC 1757798 1758856 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_18140 1759926 1758862 gene locus_tag LOCUS_18150 1759926 1758862 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980659.1 protein_id gnl|my_center|LOCUS_18150 1760778 1760359 gene locus_tag LOCUS_18160 1760778 1760359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1760989 1760765 gene locus_tag LOCUS_18170 1760989 1760765 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980667.1 protein_id gnl|my_center|LOCUS_18170 1761668 1762714 gene locus_tag LOCUS_18180 1761668 1762714 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980658.1 protein_id gnl|my_center|LOCUS_18180 1763050 1762700 gene locus_tag LOCUS_18190 1763050 1762700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1763535 1763083 gene locus_tag LOCUS_18200 1763535 1763083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979651.1 protein_id gnl|my_center|LOCUS_18200 1764781 1764182 gene locus_tag LOCUS_18210 gene wrbA 1764781 1764182 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978866.1 protein_id gnl|my_center|LOCUS_18210 1765526 1764999 gene locus_tag LOCUS_18220 1765526 1764999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1765802 1765536 gene locus_tag LOCUS_18230 1765802 1765536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1767123 1766017 gene locus_tag LOCUS_18240 1767123 1766017 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061884.1 protein_id gnl|my_center|LOCUS_18240 1768872 1767457 gene locus_tag LOCUS_18250 1768872 1767457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1771094 1770045 gene locus_tag LOCUS_18260 1771094 1770045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1772765 1772160 gene locus_tag LOCUS_18270 1772765 1772160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980166.1 protein_id gnl|my_center|LOCUS_18270 1773536 1774591 gene locus_tag LOCUS_18280 1773536 1774591 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243045.1 protein_id gnl|my_center|LOCUS_18280 1775775 1774726 gene locus_tag LOCUS_18290 1775775 1774726 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980292.1 protein_id gnl|my_center|LOCUS_18290 1776111 1775836 gene locus_tag LOCUS_18300 1776111 1775836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1776881 1776087 gene locus_tag LOCUS_18310 1776881 1776087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1777719 1776886 gene locus_tag LOCUS_18320 1777719 1776886 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_18320 1778594 1777710 gene locus_tag LOCUS_18330 1778594 1777710 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_18330 1779987 1778596 gene locus_tag LOCUS_18340 1779987 1778596 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_18340 1780063 1781757 gene locus_tag LOCUS_18350 1780063 1781757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1783624 1781747 gene locus_tag LOCUS_18360 1783624 1781747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1783671 1784768 gene locus_tag LOCUS_18370 1783671 1784768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1786269 1787468 gene locus_tag LOCUS_18380 1786269 1787468 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_18380 1787545 1788984 gene locus_tag LOCUS_18390 1787545 1788984 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_18390 1789513 1788959 gene locus_tag LOCUS_18400 1789513 1788959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18400 1790346 1789525 gene locus_tag LOCUS_18410 1790346 1789525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18410 1791849 1791166 gene locus_tag LOCUS_18420 1791849 1791166 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980165.1 protein_id gnl|my_center|LOCUS_18420 1792606 1794039 gene locus_tag LOCUS_18430 1792606 1794039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1794061 1794672 gene locus_tag LOCUS_18440 1794061 1794672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1795177 1796250 gene locus_tag LOCUS_18450 1795177 1796250 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761910.1 protein_id gnl|my_center|LOCUS_18450 1797907 1796879 gene locus_tag LOCUS_18460 1797907 1796879 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_18460 1798658 1798302 gene locus_tag LOCUS_18470 1798658 1798302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1799044 1798631 gene locus_tag LOCUS_18480 1799044 1798631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429686.1 protein_id gnl|my_center|LOCUS_18480 1799282 1799022 gene locus_tag LOCUS_18490 1799282 1799022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1799714 1799520 gene locus_tag LOCUS_18500 1799714 1799520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 1801668 1802735 gene locus_tag LOCUS_18510 1801668 1802735 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980011.1 protein_id gnl|my_center|LOCUS_18510 1802752 1803240 gene locus_tag LOCUS_18520 1802752 1803240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980010.1 protein_id gnl|my_center|LOCUS_18520 1804352 1804651 gene locus_tag LOCUS_18530 1804352 1804651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1806637 1807389 gene locus_tag LOCUS_18540 1806637 1807389 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_18540 1807470 1807649 gene locus_tag LOCUS_18550 1807470 1807649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1808057 1808944 gene locus_tag LOCUS_18560 1808057 1808944 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_18560 1808941 1809978 gene locus_tag LOCUS_18570 1808941 1809978 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980042.1 protein_id gnl|my_center|LOCUS_18570 1810378 1811049 gene locus_tag LOCUS_18580 1810378 1811049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1811734 1811898 gene locus_tag LOCUS_18590 1811734 1811898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1811870 1812649 gene locus_tag LOCUS_18600 1811870 1812649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1813351 1813947 gene locus_tag LOCUS_18610 gene rfbC 1813351 1813947 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980040.1 protein_id gnl|my_center|LOCUS_18610 1815683 1814706 gene locus_tag LOCUS_18620 1815683 1814706 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958477.1 protein_id gnl|my_center|LOCUS_18620 1816336 1815941 gene locus_tag LOCUS_18630 1816336 1815941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1816706 1817518 gene locus_tag LOCUS_18640 1816706 1817518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1818379 1818855 gene locus_tag LOCUS_18650 1818379 1818855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18650 1821965 1820586 gene locus_tag LOCUS_18660 1821965 1820586 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980022.1 protein_id gnl|my_center|LOCUS_18660 1823174 1822137 gene locus_tag LOCUS_18670 1823174 1822137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1823725 1824735 gene locus_tag LOCUS_18680 1823725 1824735 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763230.1 protein_id gnl|my_center|LOCUS_18680 1825608 1825057 gene locus_tag LOCUS_18690 1825608 1825057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18690 1825985 1825626 gene locus_tag LOCUS_18700 1825985 1825626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18700 1826586 1826032 gene locus_tag LOCUS_18710 1826586 1826032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18710 1827194 1826589 gene locus_tag LOCUS_18720 1827194 1826589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1827791 1827973 gene locus_tag LOCUS_18730 1827791 1827973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1827983 1828225 gene locus_tag LOCUS_18740 1827983 1828225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18740 1828400 1828242 gene locus_tag LOCUS_18750 1828400 1828242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1828799 1828512 gene locus_tag LOCUS_18760 1828799 1828512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1829051 1828821 gene locus_tag LOCUS_18770 1829051 1828821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1829470 1829685 gene locus_tag LOCUS_18780 1829470 1829685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18780 1829634 1830155 gene locus_tag LOCUS_18790 1829634 1830155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 1830367 1830684 gene locus_tag LOCUS_18800 1830367 1830684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1830566 1830964 gene locus_tag LOCUS_18810 1830566 1830964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1831485 1831817 gene locus_tag LOCUS_18820 1831485 1831817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18820 1832592 1834340 gene locus_tag LOCUS_18830 1832592 1834340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1834340 1835074 gene locus_tag LOCUS_18840 1834340 1835074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1837458 1836292 gene locus_tag LOCUS_18850 1837458 1836292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1841603 1840611 gene locus_tag LOCUS_18860 1841603 1840611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1842806 1842495 gene locus_tag LOCUS_18870 1842806 1842495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1844208 1843450 gene locus_tag LOCUS_18880 1844208 1843450 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763234.1 protein_id gnl|my_center|LOCUS_18880 1845497 1844208 gene locus_tag LOCUS_18890 1845497 1844208 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_18890 1846344 1845475 gene locus_tag LOCUS_18900 1846344 1845475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763235.1 protein_id gnl|my_center|LOCUS_18900 1847598 1846540 gene locus_tag LOCUS_18910 1847598 1846540 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980470.1 protein_id gnl|my_center|LOCUS_18910 1848667 1847627 gene locus_tag LOCUS_18920 1848667 1847627 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909115.1 protein_id gnl|my_center|LOCUS_18920 1849393 1849187 gene locus_tag LOCUS_18930 1849393 1849187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1849708 1849439 gene locus_tag LOCUS_18940 1849708 1849439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1850149 1849784 gene locus_tag LOCUS_18950 1850149 1849784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18950 1850706 1850290 gene locus_tag LOCUS_18960 1850706 1850290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1850609 1851568 gene locus_tag LOCUS_18970 1850609 1851568 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980470.1 protein_id gnl|my_center|LOCUS_18970 1852043 1852318 gene locus_tag LOCUS_18980 1852043 1852318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 1852323 1853357 gene locus_tag LOCUS_18990 1852323 1853357 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126450739.1 protein_id gnl|my_center|LOCUS_18990 1853368 1853754 gene locus_tag LOCUS_19000 1853368 1853754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126450741.1 protein_id gnl|my_center|LOCUS_19000 1853974 1853819 gene locus_tag LOCUS_19010 1853974 1853819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1854015 1854323 gene locus_tag LOCUS_19020 1854015 1854323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1854343 1856850 gene locus_tag LOCUS_19030 1854343 1856850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980059.1 protein_id gnl|my_center|LOCUS_19030 1856847 1857533 gene locus_tag LOCUS_19040 1856847 1857533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980060.1 protein_id gnl|my_center|LOCUS_19040 1859840 1859574 gene locus_tag LOCUS_19050 1859840 1859574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846600.1 protein_id gnl|my_center|LOCUS_19050 1860548 1860712 gene locus_tag LOCUS_19060 1860548 1860712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1862841 1862011 gene locus_tag LOCUS_19070 1862841 1862011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979102.1 protein_id gnl|my_center|LOCUS_19070 1863266 1863099 gene locus_tag LOCUS_19080 1863266 1863099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1863634 1863410 gene locus_tag LOCUS_19090 1863634 1863410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1864160 1865926 gene locus_tag LOCUS_19100 1864160 1865926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1865923 1868535 gene locus_tag LOCUS_19110 1865923 1868535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1868636 1869862 gene locus_tag LOCUS_19120 1868636 1869862 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389327.1 protein_id gnl|my_center|LOCUS_19120 1870849 1869842 gene locus_tag LOCUS_19130 1870849 1869842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1871595 1871434 gene locus_tag LOCUS_19140 1871595 1871434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 1871639 1872592 gene locus_tag LOCUS_19150 1871639 1872592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1873779 1872595 gene locus_tag LOCUS_19160 1873779 1872595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1874744 1874043 gene locus_tag LOCUS_19170 1874744 1874043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1874847 1875050 gene locus_tag LOCUS_19180 1874847 1875050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1876749 1875037 gene locus_tag LOCUS_19190 1876749 1875037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1878879 1877128 gene locus_tag LOCUS_19200 1878879 1877128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1879482 1878949 gene locus_tag LOCUS_19210 1879482 1878949 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980467.1 protein_id gnl|my_center|LOCUS_19210 1880282 1880476 gene locus_tag LOCUS_19220 1880282 1880476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19220 1880530 1881012 gene locus_tag LOCUS_19230 1880530 1881012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19230 1881045 1881734 gene locus_tag LOCUS_19240 1881045 1881734 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978969.1 protein_id gnl|my_center|LOCUS_19240 1881918 1881715 gene locus_tag LOCUS_19250 1881918 1881715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1882840 1882424 gene locus_tag LOCUS_19260 1882840 1882424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1883625 1882837 gene locus_tag LOCUS_19270 1883625 1882837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1884892 1883771 gene locus_tag LOCUS_19280 1884892 1883771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_19280 1886040 1884889 gene locus_tag LOCUS_19290 1886040 1884889 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_19290 1886220 1886429 gene locus_tag LOCUS_19300 1886220 1886429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1888677 1889411 gene locus_tag LOCUS_19310 1888677 1889411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19310 1890471 1889554 gene locus_tag LOCUS_19320 1890471 1889554 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_19320 1891189 1891010 gene locus_tag LOCUS_19330 1891189 1891010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1891307 1892647 gene locus_tag LOCUS_19340 1891307 1892647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1895317 1894709 gene locus_tag LOCUS_19350 1895317 1894709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1896014 1898959 gene locus_tag LOCUS_19360 1896014 1898959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1898964 1899983 gene locus_tag LOCUS_19370 1898964 1899983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1899983 1901626 gene locus_tag LOCUS_19380 1899983 1901626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1901619 1902431 gene locus_tag LOCUS_19390 1901619 1902431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1903256 1902567 gene locus_tag LOCUS_19400 1903256 1902567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1904142 1905035 gene locus_tag LOCUS_19410 1904142 1905035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19410 1904975 1905727 gene locus_tag LOCUS_19420 1904975 1905727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1905736 1906356 gene locus_tag LOCUS_19430 1905736 1906356 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 protein_id gnl|my_center|LOCUS_19430 1906507 1906337 gene locus_tag LOCUS_19440 1906507 1906337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1907256 1906474 gene locus_tag LOCUS_19450 1907256 1906474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762316.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19450 1908197 1907253 gene locus_tag LOCUS_19460 1908197 1907253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_19460 1909048 1908197 gene locus_tag LOCUS_19470 1909048 1908197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19470 1910022 1909048 gene locus_tag LOCUS_19480 1910022 1909048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_19480 1911705 1910029 gene locus_tag LOCUS_19490 1911705 1910029 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020884.1 protein_id gnl|my_center|LOCUS_19490 1912052 1912981 gene locus_tag LOCUS_19500 1912052 1912981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19500 1912948 1913994 gene locus_tag LOCUS_19510 1912948 1913994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19510 1913999 1915525 gene locus_tag LOCUS_19520 1913999 1915525 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979745.1 protein_id gnl|my_center|LOCUS_19520 1915648 1916823 gene locus_tag LOCUS_19530 1915648 1916823 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_19530 1917065 1916835 gene locus_tag LOCUS_19540 1917065 1916835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1917193 1917852 gene locus_tag LOCUS_19550 1917193 1917852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1918520 1918960 gene locus_tag LOCUS_19560 1918520 1918960 CDS product IS607-like element ISSto11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742643.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19560 1919004 1919627 gene locus_tag LOCUS_19570 1919004 1919627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19570 1919614 1920213 gene locus_tag LOCUS_19580 1919614 1920213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19580 1920381 1920689 gene locus_tag LOCUS_19590 1920381 1920689 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978640.1 protein_id gnl|my_center|LOCUS_19590 1922587 1920809 gene locus_tag LOCUS_19600 1922587 1920809 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015680.1 protein_id gnl|my_center|LOCUS_19600 1922965 1923147 gene locus_tag LOCUS_19610 1922965 1923147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1924417 1923482 gene locus_tag LOCUS_19620 1924417 1923482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1925198 1924464 gene locus_tag LOCUS_19630 1925198 1924464 CDS product CRISPR-associated endonuclease Cas3'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980736.1 protein_id gnl|my_center|LOCUS_19630 1926673 1925195 gene locus_tag LOCUS_19640 gene cas3 1926673 1925195 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013776535.1 protein_id gnl|my_center|LOCUS_19640 1927394 1926654 gene locus_tag LOCUS_19650 gene cas5a 1927394 1926654 CDS product type I-A CRISPR-associated protein Cas5a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980734.1 protein_id gnl|my_center|LOCUS_19650 1928347 1927391 gene locus_tag LOCUS_19660 gene cas7a 1928347 1927391 CDS product type I-A CRISPR-associated protein Cas7/Csa2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980733.1 protein_id gnl|my_center|LOCUS_19660 1928745 1928344 gene locus_tag LOCUS_19670 gene csa5 1928745 1928344 CDS product type I-A CRISPR-associated protein Csa5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980732.1 protein_id gnl|my_center|LOCUS_19670 1929426 1928806 gene locus_tag LOCUS_19680 gene csa3 1929426 1928806 CDS product CRISPR-associated CARF protein Csa3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846494.1 protein_id gnl|my_center|LOCUS_19680 1930874 1930512 gene locus_tag LOCUS_19690 1930874 1930512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1931029 1931253 gene locus_tag LOCUS_19700 1931029 1931253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1931362 1932576 gene locus_tag LOCUS_19710 1931362 1932576 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_19710 1932992 1933327 gene locus_tag LOCUS_19720 1932992 1933327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1933315 1934226 gene locus_tag LOCUS_19730 1933315 1934226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19730 1936252 1935152 gene locus_tag LOCUS_19740 1936252 1935152 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979690.1 protein_id gnl|my_center|LOCUS_19740 1936350 1937012 gene locus_tag LOCUS_19750 1936350 1937012 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979689.1 protein_id gnl|my_center|LOCUS_19750 1937019 1937738 gene locus_tag LOCUS_19760 1937019 1937738 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979688.1 protein_id gnl|my_center|LOCUS_19760 1938920 1937865 gene locus_tag LOCUS_19770 gene uxuA 1938920 1937865 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426045.1 protein_id gnl|my_center|LOCUS_19770 1939183 1939599 gene locus_tag LOCUS_19780 1939183 1939599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1939983 1939744 gene locus_tag LOCUS_19790 1939983 1939744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1941550 1939955 gene locus_tag LOCUS_19800 1941550 1939955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 1941719 1942576 gene locus_tag LOCUS_19810 1941719 1942576 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_19810 1942573 1943430 gene locus_tag LOCUS_19820 1942573 1943430 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_19820 1943480 1944511 gene locus_tag LOCUS_19830 1943480 1944511 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966229.1 protein_id gnl|my_center|LOCUS_19830 1944909 1945163 gene locus_tag LOCUS_19840 1944909 1945163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1945160 1945570 gene locus_tag LOCUS_19850 1945160 1945570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1945641 1946762 gene locus_tag LOCUS_19860 gene araD 1945641 1946762 CDS product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_19860 1948297 1947215 gene locus_tag LOCUS_19870 1948297 1947215 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868111.1 protein_id gnl|my_center|LOCUS_19870 1950907 1949633 gene locus_tag LOCUS_19880 1950907 1949633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978029.1 protein_id gnl|my_center|LOCUS_19880 1951250 1950948 gene locus_tag LOCUS_19890 1951250 1950948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1951405 1952868 gene locus_tag LOCUS_19900 1951405 1952868 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_19900 1953668 1952844 gene locus_tag LOCUS_19910 gene prpB 1953668 1952844 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_19910 1954758 1954009 gene locus_tag LOCUS_19920 1954758 1954009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1956087 1954768 gene locus_tag LOCUS_19930 1956087 1954768 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393890.1 protein_id gnl|my_center|LOCUS_19930 1956620 1956159 gene locus_tag LOCUS_19940 1956620 1956159 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879802.1 protein_id gnl|my_center|LOCUS_19940 1958502 1958347 gene locus_tag LOCUS_19950 1958502 1958347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1958540 1958737 gene locus_tag LOCUS_19960 1958540 1958737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 1958913 1959317 gene locus_tag LOCUS_19970 1958913 1959317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19970 1960270 1959956 gene locus_tag LOCUS_19980 1960270 1959956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19980 1960478 1961110 gene locus_tag LOCUS_19990 1960478 1961110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1962305 1961115 gene locus_tag LOCUS_20000 1962305 1961115 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_20000 1963496 1962366 gene locus_tag LOCUS_20010 1963496 1962366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970567.1 protein_id gnl|my_center|LOCUS_20010 1964752 1963493 gene locus_tag LOCUS_20020 1964752 1963493 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_20020 1965186 1964758 gene locus_tag LOCUS_20030 1965186 1964758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20030 1965536 1965171 gene locus_tag LOCUS_20040 1965536 1965171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20040 1965698 1967059 gene locus_tag LOCUS_20050 1965698 1967059 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429707.1 protein_id gnl|my_center|LOCUS_20050 1967420 1967163 gene locus_tag LOCUS_20060 1967420 1967163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1967679 1968323 gene locus_tag LOCUS_20070 1967679 1968323 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846139.1 protein_id gnl|my_center|LOCUS_20070 1968532 1969023 gene locus_tag LOCUS_20080 1968532 1969023 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978007.1 protein_id gnl|my_center|LOCUS_20080 1970177 1969017 gene locus_tag LOCUS_20090 1970177 1969017 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978005.1 protein_id gnl|my_center|LOCUS_20090 1971546 1970431 gene locus_tag LOCUS_20100 1971546 1970431 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978006.1 protein_id gnl|my_center|LOCUS_20100 1972074 1973411 gene locus_tag LOCUS_20110 1972074 1973411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764782.1 protein_id gnl|my_center|LOCUS_20110 1974658 1973450 gene locus_tag LOCUS_20120 1974658 1973450 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 protein_id gnl|my_center|LOCUS_20120 1975733 1974717 gene locus_tag LOCUS_20130 1975733 1974717 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895369.1 protein_id gnl|my_center|LOCUS_20130 1975946 1976887 gene locus_tag LOCUS_20140 1975946 1976887 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040419.1 protein_id gnl|my_center|LOCUS_20140 1976902 1977891 gene locus_tag LOCUS_20150 1976902 1977891 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_20150 1979280 1977895 gene locus_tag LOCUS_20160 gene hydA 1979280 1977895 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979132.1 protein_id gnl|my_center|LOCUS_20160 1980086 1979289 gene locus_tag LOCUS_20170 1980086 1979289 CDS product beta-ureidopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979024.1 protein_id gnl|my_center|LOCUS_20170 1981769 1982254 gene locus_tag LOCUS_20180 1981769 1982254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1982352 1983332 gene locus_tag LOCUS_20190 1982352 1983332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1984005 1983703 gene locus_tag LOCUS_20200 1984005 1983703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1984664 1985047 gene locus_tag LOCUS_20210 1984664 1985047 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_20210 1985263 1985712 gene locus_tag LOCUS_20220 1985263 1985712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1986270 1985848 gene locus_tag LOCUS_20230 1986270 1985848 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979883.1 protein_id gnl|my_center|LOCUS_20230 1986877 1987155 gene locus_tag LOCUS_20240 1986877 1987155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20240 1987188 1987391 gene locus_tag LOCUS_20250 1987188 1987391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20250 1987964 1988446 gene locus_tag LOCUS_20260 1987964 1988446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 1988448 1988801 gene locus_tag LOCUS_20270 1988448 1988801 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978733.1 protein_id gnl|my_center|LOCUS_20270 1989251 1988802 gene locus_tag LOCUS_20280 1989251 1988802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20280 1990496 1989393 gene locus_tag LOCUS_20290 1990496 1989393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979648.1 protein_id gnl|my_center|LOCUS_20290 1991215 1990502 gene locus_tag LOCUS_20300 1991215 1990502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978729.1 protein_id gnl|my_center|LOCUS_20300 1992096 1991275 gene locus_tag LOCUS_20310 1992096 1991275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1993030 1992134 gene locus_tag LOCUS_20320 1993030 1992134 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763004.1 protein_id gnl|my_center|LOCUS_20320 1993856 1993143 gene locus_tag LOCUS_20330 1993856 1993143 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429736.1 protein_id gnl|my_center|LOCUS_20330 1995054 1994449 gene locus_tag LOCUS_20340 1995054 1994449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20340 1995887 1994967 gene locus_tag LOCUS_20350 1995887 1994967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20350 1996360 1995902 gene locus_tag LOCUS_20360 1996360 1995902 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_20360 1996457 1997320 gene locus_tag LOCUS_20370 1996457 1997320 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485796.1 protein_id gnl|my_center|LOCUS_20370 1997287 1998015 gene locus_tag LOCUS_20380 1997287 1998015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1997976 1998908 gene locus_tag LOCUS_20390 1997976 1998908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1998928 1999101 gene locus_tag LOCUS_20400 1998928 1999101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1999126 2000838 gene locus_tag LOCUS_20410 1999126 2000838 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979811.1 protein_id gnl|my_center|LOCUS_20410 2002386 2000779 gene locus_tag LOCUS_20420 2002386 2000779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2003071 2003493 gene locus_tag LOCUS_20430 2003071 2003493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2003546 2003983 gene locus_tag LOCUS_20440 2003546 2003983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2004072 2004608 gene locus_tag LOCUS_20450 gene msrA 2004072 2004608 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_20450 2004949 2004713 gene locus_tag LOCUS_20460 2004949 2004713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2005504 2005235 gene locus_tag LOCUS_20470 2005504 2005235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2006238 2005504 gene locus_tag LOCUS_20480 2006238 2005504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2007231 2006392 gene locus_tag LOCUS_20490 2007231 2006392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979772.1 protein_id gnl|my_center|LOCUS_20490 2008131 2007406 gene locus_tag LOCUS_20500 2008131 2007406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2008763 2008137 gene locus_tag LOCUS_20510 2008763 2008137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2009806 2008760 gene locus_tag LOCUS_20520 2009806 2008760 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_20520 2009881 2010630 gene locus_tag LOCUS_20530 2009881 2010630 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869899.1 protein_id gnl|my_center|LOCUS_20530 2010627 2011331 gene locus_tag LOCUS_20540 2010627 2011331 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867607.1 protein_id gnl|my_center|LOCUS_20540 2012095 2011313 gene locus_tag LOCUS_20550 2012095 2011313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2012799 2012059 gene locus_tag LOCUS_20560 2012799 2012059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2013381 2013196 gene locus_tag LOCUS_20570 2013381 2013196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2014099 2013578 gene locus_tag LOCUS_20580 2014099 2013578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2014436 2014284 gene locus_tag LOCUS_20590 2014436 2014284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2014741 2015949 gene locus_tag LOCUS_20600 2014741 2015949 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980484.1 protein_id gnl|my_center|LOCUS_20600 2016358 2017728 gene locus_tag LOCUS_20610 2016358 2017728 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980514.1 protein_id gnl|my_center|LOCUS_20610 2019512 2017806 gene locus_tag LOCUS_20620 gene treH1 2019512 2017806 CDS product alpha,alpha-trehalase TreH1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979139.1 protein_id gnl|my_center|LOCUS_20620 2019569 2019721 gene locus_tag LOCUS_20630 2019569 2019721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2019890 2020366 gene locus_tag LOCUS_20640 2019890 2020366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2020326 2020955 gene locus_tag LOCUS_20650 2020326 2020955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2022784 2022972 gene locus_tag LOCUS_20660 2022784 2022972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2023023 2023769 gene locus_tag LOCUS_20670 2023023 2023769 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_20670 2025141 2023741 gene locus_tag LOCUS_20680 gene gudP 2025141 2023741 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098524.1 protein_id gnl|my_center|LOCUS_20680 2025709 2025329 gene locus_tag LOCUS_20690 2025709 2025329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20690 2025933 2025760 gene locus_tag LOCUS_20700 2025933 2025760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20700 2026466 2027011 gene locus_tag LOCUS_20710 2026466 2027011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20710 2027005 2027214 gene locus_tag LOCUS_20720 2027005 2027214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2027288 2027500 gene locus_tag LOCUS_20730 2027288 2027500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2027652 2028479 gene locus_tag LOCUS_20740 2027652 2028479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2029660 2028671 gene locus_tag LOCUS_20750 2029660 2028671 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846753.1 protein_id gnl|my_center|LOCUS_20750 2030040 2029714 gene locus_tag LOCUS_20760 2030040 2029714 CDS product DUF2250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980110.1 protein_id gnl|my_center|LOCUS_20760 2032457 2031159 gene locus_tag LOCUS_20770 2032457 2031159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979148.1 protein_id gnl|my_center|LOCUS_20770 2032592 2033320 gene locus_tag LOCUS_20780 2032592 2033320 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980372.1 protein_id gnl|my_center|LOCUS_20780 2034314 2033301 gene locus_tag LOCUS_20790 2034314 2033301 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218266461.1 protein_id gnl|my_center|LOCUS_20790 2034980 2034354 gene locus_tag LOCUS_20800 2034980 2034354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763678.1 protein_id gnl|my_center|LOCUS_20800 2035932 2034994 gene locus_tag LOCUS_20810 2035932 2034994 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978837.1 protein_id gnl|my_center|LOCUS_20810 2037845 2036094 gene locus_tag LOCUS_20820 2037845 2036094 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980495.1 protein_id gnl|my_center|LOCUS_20820 2039562 2037877 gene locus_tag LOCUS_20830 2039562 2037877 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_20830 2041338 2040514 gene locus_tag LOCUS_20840 2041338 2040514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20840 2041784 2041335 gene locus_tag LOCUS_20850 2041784 2041335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20850 2042053 2042946 gene locus_tag LOCUS_20860 2042053 2042946 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_20860 2042939 2043808 gene locus_tag LOCUS_20870 2042939 2043808 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_20870 2043810 2044871 gene locus_tag LOCUS_20880 gene glcV 2043810 2044871 CDS product glucose ABC transporter ATP-binding protein GlcV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763038.1 protein_id gnl|my_center|LOCUS_20880 2046483 2044915 gene locus_tag LOCUS_20890 2046483 2044915 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978791.1 protein_id gnl|my_center|LOCUS_20890 2047621 2047947 gene locus_tag LOCUS_20900 2047621 2047947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2048239 2047913 gene locus_tag LOCUS_20910 2048239 2047913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980197.1 protein_id gnl|my_center|LOCUS_20910 2048632 2048285 gene locus_tag LOCUS_20920 2048632 2048285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009989835.1 protein_id gnl|my_center|LOCUS_20920 2048744 2049868 gene locus_tag LOCUS_20930 2048744 2049868 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980220.1 protein_id gnl|my_center|LOCUS_20930 2051303 2052964 gene locus_tag LOCUS_20940 gene ilvB 2051303 2052964 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_20940 2053772 2052948 gene locus_tag LOCUS_20950 2053772 2052948 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846818.1 protein_id gnl|my_center|LOCUS_20950 2055543 2053804 gene locus_tag LOCUS_20960 2055543 2053804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980196.1 protein_id gnl|my_center|LOCUS_20960 2055581 2056549 gene locus_tag LOCUS_20970 2055581 2056549 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980195.1 protein_id gnl|my_center|LOCUS_20970 2056964 2056509 gene locus_tag LOCUS_20980 2056964 2056509 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980194.1 protein_id gnl|my_center|LOCUS_20980 2057141 2057001 gene locus_tag LOCUS_20990 2057141 2057001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2058061 2058672 gene locus_tag LOCUS_21000 2058061 2058672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2058654 2059178 gene locus_tag LOCUS_21010 2058654 2059178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2059727 2059182 gene locus_tag LOCUS_21020 2059727 2059182 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_21020 2059955 2060350 gene locus_tag LOCUS_21030 2059955 2060350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2060391 2060825 gene locus_tag LOCUS_21040 2060391 2060825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2060910 2061812 gene locus_tag LOCUS_21050 2060910 2061812 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978683.1 protein_id gnl|my_center|LOCUS_21050 2062138 2061920 gene locus_tag LOCUS_21060 2062138 2061920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2063271 2062135 gene locus_tag LOCUS_21070 2063271 2062135 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978035.1 protein_id gnl|my_center|LOCUS_21070 2063739 2063293 gene locus_tag LOCUS_21080 2063739 2063293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2064631 2063741 gene locus_tag LOCUS_21090 2064631 2063741 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014963.1 protein_id gnl|my_center|LOCUS_21090 2065123 2064635 gene locus_tag LOCUS_21100 2065123 2064635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979834.1 protein_id gnl|my_center|LOCUS_21100 2065215 2066378 gene locus_tag LOCUS_21110 gene cyp119 2065215 2066378 CDS product cytochrome P450 Cyp119 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979165.1 protein_id gnl|my_center|LOCUS_21110 2066375 2067271 gene locus_tag LOCUS_21120 2066375 2067271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148692580.1 protein_id gnl|my_center|LOCUS_21120 2067520 2067173 gene locus_tag LOCUS_21130 2067520 2067173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2068199 2069425 gene locus_tag LOCUS_21140 2068199 2069425 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_21140 2070860 2069397 gene locus_tag LOCUS_21150 2070860 2069397 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979709.1 protein_id gnl|my_center|LOCUS_21150 2072657 2071872 gene locus_tag LOCUS_21160 2072657 2071872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2073912 2072644 gene locus_tag LOCUS_21170 2073912 2072644 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869166.1 protein_id gnl|my_center|LOCUS_21170 2074083 2073913 gene locus_tag LOCUS_21180 2074083 2073913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2075660 2074080 gene locus_tag LOCUS_21190 gene fdrA 2075660 2074080 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_21190 2075755 2077410 gene locus_tag LOCUS_21200 2075755 2077410 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979131.1 protein_id gnl|my_center|LOCUS_21200 2078659 2077385 gene locus_tag LOCUS_21210 2078659 2077385 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980487.1 protein_id gnl|my_center|LOCUS_21210 2079213 2078740 gene locus_tag LOCUS_21220 2079213 2078740 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226423.1 protein_id gnl|my_center|LOCUS_21220 2080026 2079214 gene locus_tag LOCUS_21230 gene xdhB 2080026 2079214 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948906.1 protein_id gnl|my_center|LOCUS_21230 2082354 2080030 gene locus_tag LOCUS_21240 2082354 2080030 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948052.1 protein_id gnl|my_center|LOCUS_21240 2084085 2082454 gene locus_tag LOCUS_21250 2084085 2082454 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979131.1 protein_id gnl|my_center|LOCUS_21250 2084908 2084156 gene locus_tag LOCUS_21260 2084908 2084156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2085129 2085992 gene locus_tag LOCUS_21270 2085129 2085992 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_21270 2088273 2086945 gene locus_tag LOCUS_21280 2088273 2086945 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763321.1 protein_id gnl|my_center|LOCUS_21280 2089085 2088270 gene locus_tag LOCUS_21290 gene arcC 2089085 2088270 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_21290 2089298 2090686 gene locus_tag LOCUS_21300 2089298 2090686 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076659.1 protein_id gnl|my_center|LOCUS_21300 2091071 2092321 gene locus_tag LOCUS_21310 2091071 2092321 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978918.1 protein_id gnl|my_center|LOCUS_21310 2092589 2092284 gene locus_tag LOCUS_21320 2092589 2092284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2093531 2092647 gene locus_tag LOCUS_21330 gene porB 2093531 2092647 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846652.1 protein_id gnl|my_center|LOCUS_21330 2094702 2093500 gene locus_tag LOCUS_21340 2094702 2093500 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846988.1 protein_id gnl|my_center|LOCUS_21340 2094969 2094703 gene locus_tag LOCUS_21350 2094969 2094703 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846653.1 protein_id gnl|my_center|LOCUS_21350 2095309 2094959 gene locus_tag LOCUS_21360 2095309 2094959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21360 2095542 2095372 gene locus_tag LOCUS_21370 2095542 2095372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21370 2096865 2095759 gene locus_tag LOCUS_21380 2096865 2095759 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979857.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21380 2097070 2097315 gene locus_tag LOCUS_21390 2097070 2097315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2097457 2098578 gene locus_tag LOCUS_21400 2097457 2098578 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978564.1 protein_id gnl|my_center|LOCUS_21400 2099442 2098501 gene locus_tag LOCUS_21410 2099442 2098501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2100413 2099439 gene locus_tag LOCUS_21420 2100413 2099439 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980275.1 protein_id gnl|my_center|LOCUS_21420 2100574 2101515 gene locus_tag LOCUS_21430 2100574 2101515 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978124.1 protein_id gnl|my_center|LOCUS_21430 2101759 2102988 gene locus_tag LOCUS_21440 gene larC 2101759 2102988 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_21440 2103759 2103055 gene locus_tag LOCUS_21450 gene larB 2103759 2103055 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869660.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21450 2103954 2104820 gene locus_tag LOCUS_21460 gene larE 2103954 2104820 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_21460 2104840 2105022 gene locus_tag LOCUS_21470 2104840 2105022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2105019 2105720 gene locus_tag LOCUS_21480 2105019 2105720 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21480 2106125 2107279 gene locus_tag LOCUS_21490 2106125 2107279 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978596.1 protein_id gnl|my_center|LOCUS_21490 2107276 2107650 gene locus_tag LOCUS_21500 2107276 2107650 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978597.1 protein_id gnl|my_center|LOCUS_21500 2107644 2108336 gene locus_tag LOCUS_21510 2107644 2108336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2108790 2108362 gene locus_tag LOCUS_21520 2108790 2108362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2109866 2108937 gene locus_tag LOCUS_21530 2109866 2108937 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009988488.1 protein_id gnl|my_center|LOCUS_21530 2110268 2109870 gene locus_tag LOCUS_21540 2110268 2109870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980335.1 protein_id gnl|my_center|LOCUS_21540 2112125 2110329 gene locus_tag LOCUS_21550 2112125 2110329 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980334.1 protein_id gnl|my_center|LOCUS_21550 2113192 2112122 gene locus_tag LOCUS_21560 2113192 2112122 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980333.1 protein_id gnl|my_center|LOCUS_21560 2114637 2113318 gene locus_tag LOCUS_21570 2114637 2113318 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980332.1 protein_id gnl|my_center|LOCUS_21570 2114690 2115130 gene locus_tag LOCUS_21580 2114690 2115130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2115153 2116025 gene locus_tag LOCUS_21590 2115153 2116025 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980330.1 protein_id gnl|my_center|LOCUS_21590 2116022 2117446 gene locus_tag LOCUS_21600 gene cysS 2116022 2117446 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847028.1 protein_id gnl|my_center|LOCUS_21600 2117750 2117427 gene locus_tag LOCUS_21610 2117750 2117427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21610 2118853 2118080 gene locus_tag LOCUS_21620 2118853 2118080 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978125.1 protein_id gnl|my_center|LOCUS_21620 2119567 2120832 gene locus_tag LOCUS_21630 2119567 2120832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2120907 2122172 gene locus_tag LOCUS_21640 2120907 2122172 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980326.1 protein_id gnl|my_center|LOCUS_21640 2123063 2122794 gene locus_tag LOCUS_21650 2123063 2122794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2124538 2123069 gene locus_tag LOCUS_21660 2124538 2123069 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980324.1 protein_id gnl|my_center|LOCUS_21660 2125430 2124651 gene locus_tag LOCUS_21670 2125430 2124651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847027.1 protein_id gnl|my_center|LOCUS_21670 2125917 2125432 gene locus_tag LOCUS_21680 2125917 2125432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2128974 2126053 gene locus_tag LOCUS_21690 2128974 2126053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2129433 2130734 gene locus_tag LOCUS_21700 2129433 2130734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030686.1 protein_id gnl|my_center|LOCUS_21700 2131710 2131396 gene locus_tag LOCUS_21710 2131710 2131396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2131949 2131710 gene locus_tag LOCUS_21720 2131949 2131710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2132766 2132065 gene locus_tag LOCUS_21730 2132766 2132065 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978306.1 protein_id gnl|my_center|LOCUS_21730 2133442 2133203 gene locus_tag LOCUS_21740 2133442 2133203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2133696 2134031 gene locus_tag LOCUS_21750 2133696 2134031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21750 2134010 2134537 gene locus_tag LOCUS_21760 2134010 2134537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21760 2135330 2134539 gene locus_tag LOCUS_21770 2135330 2134539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21770 2136154 2135420 gene locus_tag LOCUS_21780 2136154 2135420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21780 2136723 2136151 gene locus_tag LOCUS_21790 2136723 2136151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978575.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21790 2137126 2137338 gene locus_tag LOCUS_21800 2137126 2137338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2137543 2137791 gene locus_tag LOCUS_21810 2137543 2137791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2137781 2137978 gene locus_tag LOCUS_21820 2137781 2137978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21820 2137978 2138646 gene locus_tag LOCUS_21830 2137978 2138646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21830 2138627 2139427 gene locus_tag LOCUS_21840 gene lipM 2138627 2139427 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_21840 2140178 2139441 gene locus_tag LOCUS_21850 2140178 2139441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2140271 2140624 gene locus_tag LOCUS_21860 2140271 2140624 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978750.1 protein_id gnl|my_center|LOCUS_21860 2141790 2142617 gene locus_tag LOCUS_21870 gene panB 2141790 2142617 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978510.1 protein_id gnl|my_center|LOCUS_21870 2143492 2142578 gene locus_tag LOCUS_21880 2143492 2142578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2143547 2143912 gene locus_tag LOCUS_21890 2143547 2143912 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_21890 2143972 2145996 gene locus_tag LOCUS_21900 2143972 2145996 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980573.1 protein_id gnl|my_center|LOCUS_21900 2146027 2146710 gene locus_tag LOCUS_21910 2146027 2146710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2147296 2147222 gene locus_tag LOCUS_t00280 2147296 2147222 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2148094 2147345 gene locus_tag LOCUS_21920 2148094 2147345 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980124.1 protein_id gnl|my_center|LOCUS_21920 2149480 2148176 gene locus_tag LOCUS_21930 2149480 2148176 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_21930 2150298 2149477 gene locus_tag LOCUS_21940 2150298 2149477 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_21940 2150496 2151824 gene locus_tag LOCUS_21950 2150496 2151824 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_21950 2151908 2152390 gene locus_tag LOCUS_21960 2151908 2152390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21960 2152356 2152703 gene locus_tag LOCUS_21970 2152356 2152703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21970 2153831 2152791 gene locus_tag LOCUS_21980 2153831 2152791 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762093.1 protein_id gnl|my_center|LOCUS_21980 2154272 2153844 gene locus_tag LOCUS_21990 2154272 2153844 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240265.1 protein_id gnl|my_center|LOCUS_21990 2154432 2155247 gene locus_tag LOCUS_22000 2154432 2155247 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496728.1 protein_id gnl|my_center|LOCUS_22000 2158813 2155244 gene locus_tag LOCUS_22010 2158813 2155244 CDS product protease pro-enzyme activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980449.1 protein_id gnl|my_center|LOCUS_22010 2159807 2159634 gene locus_tag LOCUS_22020 2159807 2159634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2160228 2159941 gene locus_tag LOCUS_22030 2160228 2159941 CDS product TA0938 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980695.1 protein_id gnl|my_center|LOCUS_22030 2161111 2160221 gene locus_tag LOCUS_22040 2161111 2160221 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980694.1 protein_id gnl|my_center|LOCUS_22040 2161360 2161121 gene locus_tag LOCUS_22050 2161360 2161121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2161463 2161999 gene locus_tag LOCUS_22060 2161463 2161999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979768.1 protein_id gnl|my_center|LOCUS_22060 2161996 2162568 gene locus_tag LOCUS_22070 2161996 2162568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168152.1 protein_id gnl|my_center|LOCUS_22070 2162541 2163650 gene locus_tag LOCUS_22080 2162541 2163650 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979766.1 protein_id gnl|my_center|LOCUS_22080 2164249 2164974 gene locus_tag LOCUS_22090 2164249 2164974 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979861.1 protein_id gnl|my_center|LOCUS_22090 2164971 2165822 gene locus_tag LOCUS_22100 2164971 2165822 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846989.1 protein_id gnl|my_center|LOCUS_22100 2165819 2167027 gene locus_tag LOCUS_22110 2165819 2167027 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979863.1 protein_id gnl|my_center|LOCUS_22110 2167024 2167287 gene locus_tag LOCUS_22120 2167024 2167287 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979864.1 protein_id gnl|my_center|LOCUS_22120 2168446 2167652 gene locus_tag LOCUS_22130 2168446 2167652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2169224 2168451 gene locus_tag LOCUS_22140 2169224 2168451 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978988.1 protein_id gnl|my_center|LOCUS_22140 2170435 2172393 gene locus_tag LOCUS_22150 gene acs 2170435 2172393 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978720.1 protein_id gnl|my_center|LOCUS_22150 2172531 2172971 gene locus_tag LOCUS_22160 2172531 2172971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2173035 2175947 gene locus_tag LOCUS_22170 gene fdhF 2173035 2175947 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978020.1 protein_id gnl|my_center|LOCUS_22170 2175982 2176293 gene locus_tag LOCUS_22180 2175982 2176293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2176244 2176987 gene locus_tag LOCUS_22190 gene fdhD 2176244 2176987 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978022.1 protein_id gnl|my_center|LOCUS_22190 2177620 2177423 gene locus_tag LOCUS_22200 2177620 2177423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2178406 2177753 gene locus_tag LOCUS_22210 2178406 2177753 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980111.1 protein_id gnl|my_center|LOCUS_22210 2179117 2179290 gene locus_tag LOCUS_22220 2179117 2179290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2179389 2179234 gene locus_tag LOCUS_22230 2179389 2179234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2180111 2179911 gene locus_tag LOCUS_22240 2180111 2179911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2182170 2180791 gene locus_tag LOCUS_22250 2182170 2180791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2182936 2182337 gene locus_tag LOCUS_22260 2182936 2182337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2183548 2182937 gene locus_tag LOCUS_22270 2183548 2182937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2184573 2183548 gene locus_tag LOCUS_22280 2184573 2183548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2184679 2185104 gene locus_tag LOCUS_22290 2184679 2185104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2185101 2185757 gene locus_tag LOCUS_22300 2185101 2185757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22300 2185796 2186326 gene locus_tag LOCUS_22310 2185796 2186326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22310 2187147 2186425 gene locus_tag LOCUS_22320 2187147 2186425 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846782.1 protein_id gnl|my_center|LOCUS_22320 2189663 2188203 gene locus_tag LOCUS_22330 2189663 2188203 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979012.1 protein_id gnl|my_center|LOCUS_22330 2189792 2190574 gene locus_tag LOCUS_22340 2189792 2190574 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846813.1 protein_id gnl|my_center|LOCUS_22340 2191173 2190664 gene locus_tag LOCUS_22350 2191173 2190664 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871083.1 protein_id gnl|my_center|LOCUS_22350 2191925 2191170 gene locus_tag LOCUS_22360 2191925 2191170 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978009.1 protein_id gnl|my_center|LOCUS_22360 2192636 2191950 gene locus_tag LOCUS_22370 2192636 2191950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2192810 2193547 gene locus_tag LOCUS_22380 2192810 2193547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2193806 2195215 gene locus_tag LOCUS_22390 2193806 2195215 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979899.1 protein_id gnl|my_center|LOCUS_22390 2195239 2197119 gene locus_tag LOCUS_22400 2195239 2197119 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979927.1 protein_id gnl|my_center|LOCUS_22400 2197116 2197730 gene locus_tag LOCUS_22410 2197116 2197730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846727.1 protein_id gnl|my_center|LOCUS_22410 2198567 2197734 gene locus_tag LOCUS_22420 2198567 2197734 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980411.1 protein_id gnl|my_center|LOCUS_22420 2198819 2199151 gene locus_tag LOCUS_22430 2198819 2199151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2199178 2200044 gene locus_tag LOCUS_22440 2199178 2200044 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978567.1 protein_id gnl|my_center|LOCUS_22440 2200792 2200133 gene locus_tag LOCUS_22450 2200792 2200133 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846896.1 protein_id gnl|my_center|LOCUS_22450 2201553 2202947 gene locus_tag LOCUS_22460 2201553 2202947 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228118.1 protein_id gnl|my_center|LOCUS_22460 2203005 2203598 gene locus_tag LOCUS_22470 2203005 2203598 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732846.1 protein_id gnl|my_center|LOCUS_22470 2205524 2204160 gene locus_tag LOCUS_22480 2205524 2204160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2206239 2205517 gene locus_tag LOCUS_22490 2206239 2205517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877900.1 protein_id gnl|my_center|LOCUS_22490 2206332 2206802 gene locus_tag LOCUS_22500 2206332 2206802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2207467 2209584 gene locus_tag LOCUS_22510 gene hel308 2207467 2209584 CDS product ATP-dependent DNA helicase Hel308 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978569.1 protein_id gnl|my_center|LOCUS_22510 2209544 2209723 gene locus_tag LOCUS_22520 2209544 2209723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2210752 2211129 gene locus_tag LOCUS_22530 2210752 2211129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978925.1 protein_id gnl|my_center|LOCUS_22530 2211316 2211786 gene locus_tag LOCUS_22540 2211316 2211786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979900.1 protein_id gnl|my_center|LOCUS_22540 2212275 2212538 gene locus_tag LOCUS_22550 2212275 2212538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2212651 2213118 gene locus_tag LOCUS_22560 2212651 2213118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2213206 2213445 gene locus_tag LOCUS_22570 2213206 2213445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2214083 2215795 gene locus_tag LOCUS_22580 2214083 2215795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_22580 2215773 2216240 gene locus_tag LOCUS_22590 2215773 2216240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2217218 2216229 gene locus_tag LOCUS_22600 2217218 2216229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22600 2217805 2217200 gene locus_tag LOCUS_22610 2217805 2217200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22610 2217999 2217802 gene locus_tag LOCUS_22620 2217999 2217802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846382.1 protein_id gnl|my_center|LOCUS_22620 2219579 2218248 gene locus_tag LOCUS_22630 2219579 2218248 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978631.1 protein_id gnl|my_center|LOCUS_22630 2220588 2219611 gene locus_tag LOCUS_22640 2220588 2219611 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980410.1 protein_id gnl|my_center|LOCUS_22640 2221895 2221485 gene locus_tag LOCUS_22650 2221895 2221485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2223111 2222098 gene locus_tag LOCUS_22660 2223111 2222098 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015527.1 protein_id gnl|my_center|LOCUS_22660 2223728 2223108 gene locus_tag LOCUS_22670 2223728 2223108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22670 2224365 2223733 gene locus_tag LOCUS_22680 2224365 2223733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22680 2224453 2226225 gene locus_tag LOCUS_22690 2224453 2226225 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978774.1 protein_id gnl|my_center|LOCUS_22690 2228531 2226231 gene locus_tag LOCUS_22700 2228531 2226231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980338.1 protein_id gnl|my_center|LOCUS_22700 2230024 2229191 gene locus_tag LOCUS_22710 2230024 2229191 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846724.1 protein_id gnl|my_center|LOCUS_22710 2231688 2230099 gene locus_tag LOCUS_22720 2231688 2230099 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980485.1 protein_id gnl|my_center|LOCUS_22720 2232379 2232137 gene locus_tag LOCUS_22730 2232379 2232137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2234213 2233044 gene locus_tag LOCUS_22740 2234213 2233044 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978854.1 protein_id gnl|my_center|LOCUS_22740 2234434 2234787 gene locus_tag LOCUS_22750 2234434 2234787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978050.1 protein_id gnl|my_center|LOCUS_22750 2235085 2235468 gene locus_tag LOCUS_22760 2235085 2235468 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979712.1 protein_id gnl|my_center|LOCUS_22760 2236930 2235455 gene locus_tag LOCUS_22770 2236930 2235455 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979711.1 protein_id gnl|my_center|LOCUS_22770 2238406 2237477 gene locus_tag LOCUS_22780 2238406 2237477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2238540 2238800 gene locus_tag LOCUS_22790 2238540 2238800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2239507 2238746 gene locus_tag LOCUS_22800 2239507 2238746 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651040.1 protein_id gnl|my_center|LOCUS_22800 2241870 2239921 gene locus_tag LOCUS_22810 2241870 2239921 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846763.1 protein_id gnl|my_center|LOCUS_22810 2243113 2241908 gene locus_tag LOCUS_22820 2243113 2241908 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979634.1 protein_id gnl|my_center|LOCUS_22820 2243211 2243972 gene locus_tag LOCUS_22830 2243211 2243972 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868812.1 protein_id gnl|my_center|LOCUS_22830 2244077 2245000 gene locus_tag LOCUS_22840 2244077 2245000 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_22840 2245787 2245011 gene locus_tag LOCUS_22850 2245787 2245011 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979458.1 protein_id gnl|my_center|LOCUS_22850 2245732 2247015 gene locus_tag LOCUS_22860 2245732 2247015 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979456.1 protein_id gnl|my_center|LOCUS_22860 2248718 2247849 gene locus_tag LOCUS_22870 2248718 2247849 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979455.1 protein_id gnl|my_center|LOCUS_22870 2248687 2249100 gene locus_tag LOCUS_22880 2248687 2249100 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979454.1 protein_id gnl|my_center|LOCUS_22880 2249536 2249114 gene locus_tag LOCUS_22890 2249536 2249114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979453.1 protein_id gnl|my_center|LOCUS_22890 2249595 2250299 gene locus_tag LOCUS_22900 2249595 2250299 CDS product DUF2192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846962.1 protein_id gnl|my_center|LOCUS_22900 2250326 2251228 gene locus_tag LOCUS_22910 2250326 2251228 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979450.1 protein_id gnl|my_center|LOCUS_22910 2251216 2251557 gene locus_tag LOCUS_22920 2251216 2251557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048100233.1 protein_id gnl|my_center|LOCUS_22920 2254107 2251441 gene locus_tag LOCUS_22930 2254107 2251441 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429806.1 protein_id gnl|my_center|LOCUS_22930 2255355 2254132 gene locus_tag LOCUS_22940 2255355 2254132 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979448.1 protein_id gnl|my_center|LOCUS_22940 2256002 2255490 gene locus_tag LOCUS_22950 2256002 2255490 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979447.1 protein_id gnl|my_center|LOCUS_22950 2256723 2255965 gene locus_tag LOCUS_22960 2256723 2255965 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979446.1 protein_id gnl|my_center|LOCUS_22960 2256810 2256736 gene locus_tag LOCUS_t00290 2256810 2256736 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2258144 2257173 gene locus_tag LOCUS_22970 2258144 2257173 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_22970 2259127 2258141 gene locus_tag LOCUS_22980 gene gds 2259127 2258141 CDS product geranylgeranyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980132.1 protein_id gnl|my_center|LOCUS_22980 2260152 2259124 gene locus_tag LOCUS_22990 gene fni 2260152 2259124 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980133.1 protein_id gnl|my_center|LOCUS_22990 2260523 2260314 gene locus_tag LOCUS_23000 2260523 2260314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2260797 2260722 gene locus_tag LOCUS_t00300 2260797 2260722 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2261228 2260839 gene locus_tag LOCUS_23010 gene rpl7ae 2261228 2260839 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_23010 2262926 2261274 gene locus_tag LOCUS_23020 2262926 2261274 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979468.1 protein_id gnl|my_center|LOCUS_23020 2263612 2262923 gene locus_tag LOCUS_23030 2263612 2262923 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846565.1 protein_id gnl|my_center|LOCUS_23030 2264802 2263609 gene locus_tag LOCUS_23040 2264802 2263609 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979466.1 protein_id gnl|my_center|LOCUS_23040 2264948 2264863 gene locus_tag LOCUS_r00030 2264948 2264863 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 72 percent of the 5S ribosomal RNA 2265170 2264988 gene locus_tag LOCUS_23050 2265170 2264988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2266317 2265181 gene locus_tag LOCUS_23060 2266317 2265181 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_23060 2267245 2266574 gene locus_tag LOCUS_23070 2267245 2266574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980135.1 protein_id gnl|my_center|LOCUS_23070 2268080 2267238 gene locus_tag LOCUS_23080 gene amrB 2268080 2267238 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_23080 2268757 2268077 gene locus_tag LOCUS_23090 gene rpsB 2268757 2268077 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980137.1 protein_id gnl|my_center|LOCUS_23090 2268977 2268765 gene locus_tag LOCUS_23100 2268977 2268765 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980138.1 protein_id gnl|my_center|LOCUS_23100 2269396 2268974 gene locus_tag LOCUS_23110 2269396 2268974 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980139.1 protein_id gnl|my_center|LOCUS_23110 2269826 2269386 gene locus_tag LOCUS_23120 2269826 2269386 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980140.1 protein_id gnl|my_center|LOCUS_23120 2270176 2269823 gene locus_tag LOCUS_23130 2270176 2269823 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980141.1 protein_id gnl|my_center|LOCUS_23130 2270961 2270173 gene locus_tag LOCUS_23140 2270961 2270173 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980142.1 protein_id gnl|my_center|LOCUS_23140 2271365 2270967 gene locus_tag LOCUS_23150 2271365 2270967 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846715.1 protein_id gnl|my_center|LOCUS_23150 2271873 2271355 gene locus_tag LOCUS_23160 2271873 2271355 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_23160 2272380 2271883 gene locus_tag LOCUS_23170 2272380 2271883 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980145.1 protein_id gnl|my_center|LOCUS_23170 2274127 2272757 gene locus_tag LOCUS_23180 2274127 2272757 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980146.1 protein_id gnl|my_center|LOCUS_23180 2274104 2274367 gene locus_tag LOCUS_23190 2274104 2274367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2274369 2274764 gene locus_tag LOCUS_23200 2274369 2274764 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980147.1 protein_id gnl|my_center|LOCUS_23200 2274806 2275114 gene locus_tag LOCUS_23210 2274806 2275114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2275201 2276277 gene locus_tag LOCUS_23220 2275201 2276277 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_23220 2276282 2277502 gene locus_tag LOCUS_23230 gene dnaG 2276282 2277502 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980150.1 protein_id gnl|my_center|LOCUS_23230 2277765 2277547 gene locus_tag LOCUS_23240 2277765 2277547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2278022 2278783 gene locus_tag LOCUS_23250 2278022 2278783 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007467.1 protein_id gnl|my_center|LOCUS_23250 2279839 2279531 gene locus_tag LOCUS_23260 gene yciH 2279839 2279531 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978313.1 protein_id gnl|my_center|LOCUS_23260 2280894 2279905 gene locus_tag LOCUS_23270 2280894 2279905 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980223.1 protein_id gnl|my_center|LOCUS_23270 2281987 2282796 gene locus_tag LOCUS_23280 2281987 2282796 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011277600.1 protein_id gnl|my_center|LOCUS_23280 2282751 2283269 gene locus_tag LOCUS_23290 2282751 2283269 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846254.1 protein_id gnl|my_center|LOCUS_23290 2283311 2284558 gene locus_tag LOCUS_23300 gene ahcY 2283311 2284558 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_23300 2285421 2285014 gene locus_tag LOCUS_23310 2285421 2285014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23310 2285614 2285405 gene locus_tag LOCUS_23320 2285614 2285405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23320 2286153 2285878 gene locus_tag LOCUS_23330 2286153 2285878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23330 2286624 2286286 gene locus_tag LOCUS_23340 2286624 2286286 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846996.1 protein_id gnl|my_center|LOCUS_23340 2287151 2286717 gene locus_tag LOCUS_23350 2287151 2286717 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_23350 2287519 2288454 gene locus_tag LOCUS_23360 2287519 2288454 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980351.1 protein_id gnl|my_center|LOCUS_23360 2288472 2289398 gene locus_tag LOCUS_23370 2288472 2289398 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980350.1 protein_id gnl|my_center|LOCUS_23370 2289402 2290376 gene locus_tag LOCUS_23380 2289402 2290376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2290379 2290672 gene locus_tag LOCUS_23390 2290379 2290672 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846760.1 protein_id gnl|my_center|LOCUS_23390 2290707 2291219 gene locus_tag LOCUS_23400 2290707 2291219 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 protein_id gnl|my_center|LOCUS_23400 2291233 2292231 gene locus_tag LOCUS_23410 gene dph2 2291233 2292231 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980347.1 protein_id gnl|my_center|LOCUS_23410 2292236 2292811 gene locus_tag LOCUS_23420 2292236 2292811 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980346.1 protein_id gnl|my_center|LOCUS_23420 2292795 2293067 gene locus_tag LOCUS_23430 2292795 2293067 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980345.1 protein_id gnl|my_center|LOCUS_23430 2293139 2293318 gene locus_tag LOCUS_23440 2293139 2293318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2293377 2293679 gene locus_tag LOCUS_23450 2293377 2293679 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980344.1 protein_id gnl|my_center|LOCUS_23450 2293712 2293788 gene locus_tag LOCUS_t00310 2293712 2293788 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2294424 2295413 gene locus_tag LOCUS_23460 2294424 2295413 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763592.1 protein_id gnl|my_center|LOCUS_23460 2297231 2295495 gene locus_tag LOCUS_23470 2297231 2295495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980450.1 protein_id gnl|my_center|LOCUS_23470 2301055 2297228 gene locus_tag LOCUS_23480 2301055 2297228 CDS product protease pro-enzyme activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980449.1 protein_id gnl|my_center|LOCUS_23480 2301567 2301286 gene locus_tag LOCUS_23490 2301567 2301286 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_23490 2301952 2301608 gene locus_tag LOCUS_23500 2301952 2301608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2303464 2301986 gene locus_tag LOCUS_23510 gene lysS 2303464 2301986 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847014.1 protein_id gnl|my_center|LOCUS_23510 2305100 2304885 gene locus_tag LOCUS_23520 2305100 2304885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23520 2306317 2305109 gene locus_tag LOCUS_23530 2306317 2305109 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23530 2307160 2306999 gene locus_tag LOCUS_23540 2307160 2306999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2308306 2308548 gene locus_tag LOCUS_23550 2308306 2308548 CDS product Rdx family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846377.1 protein_id gnl|my_center|LOCUS_23550 2308632 2308964 gene locus_tag LOCUS_23560 2308632 2308964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846147.1 protein_id gnl|my_center|LOCUS_23560 2309423 2308968 gene locus_tag LOCUS_23570 gene rimI 2309423 2308968 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980152.1 protein_id gnl|my_center|LOCUS_23570 2309452 2310480 gene locus_tag LOCUS_23580 2309452 2310480 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980153.1 protein_id gnl|my_center|LOCUS_23580 2310544 2311569 gene locus_tag LOCUS_23590 2310544 2311569 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846717.1 protein_id gnl|my_center|LOCUS_23590 2312121 2311573 gene locus_tag LOCUS_23600 2312121 2311573 CDS product DUF1122 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980155.1 protein_id gnl|my_center|LOCUS_23600 2312419 2312114 gene locus_tag LOCUS_23610 2312419 2312114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23610 2312763 2312401 gene locus_tag LOCUS_23620 2312763 2312401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23620 2312794 2313864 gene locus_tag LOCUS_23630 2312794 2313864 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650980.1 protein_id gnl|my_center|LOCUS_23630 2314348 2314272 gene locus_tag LOCUS_t00320 2314348 2314272 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2314899 2314824 gene locus_tag LOCUS_t00330 2314899 2314824 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2315241 2315155 gene locus_tag LOCUS_t00340 2315241 2315155 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2316092 2316439 gene locus_tag LOCUS_23640 2316092 2316439 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846473.1 protein_id gnl|my_center|LOCUS_23640 2317727 2316489 gene locus_tag LOCUS_23650 gene serS 2317727 2316489 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979517.1 protein_id gnl|my_center|LOCUS_23650 2318282 2317884 gene locus_tag LOCUS_23660 2318282 2317884 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979516.1 protein_id gnl|my_center|LOCUS_23660 2318697 2318320 gene locus_tag LOCUS_23670 gene hisI 2318697 2318320 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846970.1 protein_id gnl|my_center|LOCUS_23670 2319290 2318694 gene locus_tag LOCUS_23680 gene hisH 2319290 2318694 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846574.1 protein_id gnl|my_center|LOCUS_23680 2319577 2319287 gene locus_tag LOCUS_23690 gene hisE 2319577 2319287 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846573.1 protein_id gnl|my_center|LOCUS_23690 2319848 2319561 gene locus_tag LOCUS_23700 2319848 2319561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23700 2320759 2319920 gene locus_tag LOCUS_23710 2320759 2319920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23710 2321511 2320756 gene locus_tag LOCUS_23720 gene hisF 2321511 2320756 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979511.1 protein_id gnl|my_center|LOCUS_23720 2322038 2321508 gene locus_tag LOCUS_23730 gene hisBd 2322038 2321508 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979510.1 protein_id gnl|my_center|LOCUS_23730 2322774 2322082 gene locus_tag LOCUS_23740 gene hisA 2322774 2322082 CDS product 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979509.1 protein_id gnl|my_center|LOCUS_23740 2323628 2322771 gene locus_tag LOCUS_23750 gene hisG 2323628 2322771 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846572.1 protein_id gnl|my_center|LOCUS_23750 2324637 2323606 gene locus_tag LOCUS_23760 gene hisC 2324637 2323606 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152940674.1 protein_id gnl|my_center|LOCUS_23760 2324749 2325342 gene locus_tag LOCUS_23770 2324749 2325342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2328839 2325969 gene locus_tag LOCUS_23780 gene leuS 2328839 2325969 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846570.1 protein_id gnl|my_center|LOCUS_23780 2328890 2329420 gene locus_tag LOCUS_23790 2328890 2329420 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979504.1 protein_id gnl|my_center|LOCUS_23790 2330360 2329404 gene locus_tag LOCUS_23800 2330360 2329404 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979503.1 protein_id gnl|my_center|LOCUS_23800 2330641 2330357 gene locus_tag LOCUS_23810 2330641 2330357 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846969.1 protein_id gnl|my_center|LOCUS_23810 2331854 2332231 gene locus_tag LOCUS_23820 gene speD 2331854 2332231 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650921.1 protein_id gnl|my_center|LOCUS_23820 2332232 2333158 gene locus_tag LOCUS_23830 2332232 2333158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650939.1 protein_id gnl|my_center|LOCUS_23830 2333344 2333126 gene locus_tag LOCUS_23840 2333344 2333126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429663.1 protein_id gnl|my_center|LOCUS_23840 2333413 2333985 gene locus_tag LOCUS_23850 2333413 2333985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23850 2334018 2334236 gene locus_tag LOCUS_23860 2334018 2334236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2335211 2334264 gene locus_tag LOCUS_23870 2335211 2334264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979497.1 protein_id gnl|my_center|LOCUS_23870 2335257 2336015 gene locus_tag LOCUS_23880 2335257 2336015 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979496.1 protein_id gnl|my_center|LOCUS_23880 2336026 2336517 gene locus_tag LOCUS_23890 2336026 2336517 CDS product magnesium-dependent phosphatase-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846567.1 protein_id gnl|my_center|LOCUS_23890 2336693 2338402 gene locus_tag LOCUS_23900 2336693 2338402 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979494.1 protein_id gnl|my_center|LOCUS_23900 2338380 2338703 gene locus_tag LOCUS_23910 2338380 2338703 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979493.1 protein_id gnl|my_center|LOCUS_23910 2338696 2339694 gene locus_tag LOCUS_23920 gene ilvC 2338696 2339694 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979492.1 protein_id gnl|my_center|LOCUS_23920 2339706 2340140 gene locus_tag LOCUS_23930 gene hjc 2339706 2340140 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846967.1 protein_id gnl|my_center|LOCUS_23930 2341667 2340123 gene locus_tag LOCUS_23940 2341667 2340123 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979490.1 protein_id gnl|my_center|LOCUS_23940 2342390 2341791 gene locus_tag LOCUS_23950 gene pdxT 2342390 2341791 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979489.1 protein_id gnl|my_center|LOCUS_23950 2343370 2342387 gene locus_tag LOCUS_23960 gene pdxS 2343370 2342387 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979488.1 protein_id gnl|my_center|LOCUS_23960 2343668 2344009 gene locus_tag LOCUS_23970 2343668 2344009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2344006 2344992 gene locus_tag LOCUS_23980 2344006 2344992 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978331.1 protein_id gnl|my_center|LOCUS_23980 2345653 2345339 gene locus_tag LOCUS_23990 2345653 2345339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978330.1 protein_id gnl|my_center|LOCUS_23990 2345687 2346661 gene locus_tag LOCUS_24000 2345687 2346661 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846877.1 protein_id gnl|my_center|LOCUS_24000 2346982 2346665 gene locus_tag LOCUS_24010 2346982 2346665 CDS product 30S ribosomal protein S25e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978335.1 protein_id gnl|my_center|LOCUS_24010 2347032 2347775 gene locus_tag LOCUS_24020 2347032 2347775 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978334.1 protein_id gnl|my_center|LOCUS_24020 2347811 2347957 gene locus_tag LOCUS_24030 2347811 2347957 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846285.1 protein_id gnl|my_center|LOCUS_24030 2348013 2348807 gene locus_tag LOCUS_24040 2348013 2348807 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978333.1 protein_id gnl|my_center|LOCUS_24040 2349347 2348781 gene locus_tag LOCUS_24050 2349347 2348781 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978328.1 protein_id gnl|my_center|LOCUS_24050 2349963 2349310 gene locus_tag LOCUS_24060 2349963 2349310 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978327.1 protein_id gnl|my_center|LOCUS_24060 2350949 2349954 gene locus_tag LOCUS_24070 gene kae1 2350949 2349954 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978326.1 protein_id gnl|my_center|LOCUS_24070 2351131 2350946 gene locus_tag LOCUS_24080 2351131 2350946 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978325.1 protein_id gnl|my_center|LOCUS_24080 2351465 2351124 gene locus_tag LOCUS_24090 2351465 2351124 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868806.1 protein_id gnl|my_center|LOCUS_24090 2352076 2351504 gene locus_tag LOCUS_24100 2352076 2351504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24100 2352309 2352088 gene locus_tag LOCUS_24110 2352309 2352088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24110 2352662 2352898 gene locus_tag LOCUS_24120 2352662 2352898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24120